Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Квази метагеномных анализ сальмонеллы от пищевых продуктов и экологические пробы

doi: 10.3791/58612 Published: October 25, 2018

Summary

Здесь мы представляем протокол подготовить образцы ДНК от продуктов питания и окружающей среды microbiomes для согласованных обнаружения и подтипов сальмонеллы через quasimetagenomic последовательности. Комбинированное использование обогащения культуры, иммуномагнитная разделения (IMS) и несколько перемещения амплификации (MDA) позволяет эффективная концентрация сальмонеллы геномной ДНК от пищевых продуктов и экологические пробы.

Abstract

Quasi метагеномики последовательности относится к последовательности на основе анализа модифицированных microbiomes продовольствия и проб окружающей среды. В этом протоколе микрофлора модификация предназначена для сконцентрировать геномной ДНК для облегчения обнаружения целевой пищевого происхождения патогенных загрязнителей и подтипов возбудителя в одном рабочем процессе. Здесь, мы объяснить и продемонстрировать шаги подготовки образцов для анализа квази метагеномики Salmonella enterica от представителя Продовольственной и проб окружающей среды, включая ростки люцерны, молотый черный перец, говяжий фарш, куриные груди и экологические тампоны. Первые образцы подвергаются обогащения культуры сальмонеллы укороченные и регулируемая длительность (4 – 24 ч). Сальмонелла клетки затем выборочно захватываются от обогащения культуры иммуномагнитная разделения (IMS). Наконец для того чтобы усилить дна от клеток, IMS-захватили выполняется несколько перемещения амплификации (MDA). ДНК вывода этого протокола можно упорядочивать по высокой пропускной способности виртуализации платформ. Необязательный количественный анализ ПЦР может выполняться заменить последовательности для обнаружения сальмонеллы или оценить концентрацию сальмонеллы ДНК до последовательности.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Секвенирование метагеномики теоретически позволяет согласованные обнаружения и подтипов пищевых патогенов. Однако проб продуктов питания создают проблемы для анализа возбудителя путем прямого секвенирования микрофлора пищи. Во-первых пищевых патогенов часто присутствуют на низких уровнях в образцах пищевых продуктов. Большинство коммерчески доступных быстрое обнаружение методов по-прежнему требуют 8 – 48 ч культивирования для обогащения клеток возбудителя к обнаружению уровня1. Во-вторых многие продукты содержат обильной микрофлоры клеток и/или пищи ДНК, делая ДНК возбудителя пищевого небольшая еда metagenome и недостижимой цели для обнаружения и подтипов, прямые метагеномных последовательности.

Модификация microbiomes пищи было сообщено позволить значительные концентрации пищевых патогенов ДНК для облегчения обнаружения на основе последовательности Сига производства токсина кишечная палочка2,3 и Salmonella enterica4. Потому что модифицированные продукты microbiomes по-прежнему смеси различных видов микроорганизмов, их последовательность называют квази метагеномных анализ4. Микрофлора модификация может выполняться путем обогащения культуры только2,3 или в комбинации с иммуномагнитная разделением (IMS) и несколько перемещения амплификации (MDA)4,5. IMS может выборочно захватить возбудителя клетки от обогащения культуры через антителами магнитные бусы. MDA можно создавать достаточное количество геномной ДНК для секвенирования через ДНК полимеразы высокоэффективных ɸ296. IMS-MDA позволяет обнаружения зависящих от культуры возбудителя из клинических образцов7и сокращение обогащения культуры для обнаружения квази метагеномных и подтипов сальмонеллы в пищевой образцы4.

Общая цель этого метода-подготовить квази metagenomic ДНК из проб продуктов питания целевых концентрация сальмонеллы геномной ДНК и последующего обнаружения и подтипов сальмонеллы загрязнителей путем sequencing. По сравнению с стандартными методами для обнаружения сальмонеллы 8,9 и подтипов10, quasimetagenomic подход существенно может сократить время обработки загрязненных пищевых продуктов и экологические пробы для молекулярные подтипы возбудителя, объединяющей два обычно разделены анализы на один рабочий процесс. Этот метод особенно полезен для таких ответных действий на вспышку пищевого происхождения и другие трассировки обратно расследования где надежный возбудитель подтипов требуется Помимо обнаружения возбудителя и важен быстрый поворот аналитических приложений.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Пробоподготовка

Примечание: Еда образцы подготовлены для предварительного обогащения согласно Путеводитель Лаборатория микробиологии (MLG) Департамента сельского хозяйства США продовольственной безопасности и инспекции (USDA-ФГУН)11 и бактериологического аналитическое руководство (BAM) США продовольствия и Наркотиками администрации (FDA)12.

  1. Асептически место 25 g часть пищи выборки например, черный перец, куриное филе, говяжий фарш и ростки люцерны или экологической тампоном в стерильных лабораторных блендер сумку с встроенным фильтром. Подготовка экологических тампоном асептически увлажнения губкой с обогащением бульон (Раппапорт-Вассилиадис, RV). Затем перетащите тампоном по всей поверхности или заданной области и поместите его в сумку блендер лаборатории.

Figure 1
Рисунок 1: представитель Продовольственной и экологические пробы для обнаружения квази метагеномики и подтипов сальмонеллы. Образцы помещаются в стерильной фильтрации stomacher сумки вместе с отваром RV. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

  1. Тщательно перемешайте каждый образец 25 g с 225 мл RV обогащения бульон с помощью лабораторных блендер или ручной массаж 30 s.
    Примечание: Варианты RV бульона, рекомендованные MLG и BAM может быть использовано в зависимости от типов образцов.
  2. Инкубируйте бульон образца обогащение смеси в инкубатора лаборатории при 42 ° C 4-24 ч.
  3. После инкубации Соберите подвыборки 50 мл бульона обогащения со стороны отфильтрованных мешка в отдельном 50 мл пластиковых пробирок.
  4. Центрифуга трубки на 100 g x 10 мин для удаления твердого мусора в огневки.
  5. Восстановите супернатант внимательно к новой 50 мл трубки центрифуги и центрифуги трубы на 3000 – 6000 x g 10 мин для восстановления клеток Пелле.
  6. (Необязательно) Отменить супернатант и помыть лепешка, ре подвеска в 5 мл буферизуются Пептон воды (BPW) и центрифуги трубы на 3000 – 6000 × г за 10 мин.
    Примечание: BPW может подготовленный растворения 10 g Пептон, 5 г натрия хлорида, 3.5 g динатрия фосфат, и 1,5 г Дигидрофосфат калия в 1 Л дистиллированной воды. Окончательный pH следует скорректировать до 7,2 ± 0,2 при 25 ° C. Может также использоваться автоклавированием при температуре 121 ° c на 15 мин коммерчески доступных BPW.
  7. Отменить супернатант и вновь приостановить гранулы в 5 мл BPW.

2. иммуномагнитная разделения (IMS) и несколько перемещения амплификации (MDA)

Примечание: Для предотвращения перекрестного загрязнения между образцами, работы в области биобезопасности кабинета, менять наконечники для каждой трубы, не прикасайтесь к трубе с пипеткой и не место трубы близко друг к другу в магнитного стенд на этапе стирки.

  1. Оттепель в буфер образца и реакции буфер из комплекта MDA на льду или на 4 ° C заранее.
  2. Смешайте 1 мл вновь приостановлено ячейки пеллет в BPW с 20 мкл анти -сальмонеллы бисера в 1,5 мл microcentrifuge трубы и поместите его на вращающейся смеситель для 30 мин при комнатной температуре.
    Примечание: Конкурентной флору, частиц жиров и белков в ресуспензированы Пелле может вмешиваться IMS. Разбавление Пелле вновь приостановлено клеток в BPW полезно для уменьшения потери комплексовсальмонеллы шарик - от магнитного стенд во время стирки шаги.
  3. Вставьте трубки магнитного стенд и разрешить 3 мин для надлежащего восстановления бусы, инвертирование стойки несколько раз сконцентрировать бисер в Пелле на стороне трубки.
  4. Держите трубы на магнитную подставку. Аспирационная и удалить супернатант от каждой трубы, а также остальные жидкости в каждую пробирку Кап.
    Примечание: Будьте осторожны, чтобы не нарушить Пелле IMS бусы на боковой стенке трубки против магнита.
  5. Выньте держатель трубки из магнитного стенд и добавьте 1 mL мыть буфера (PBS, содержащие 0,05% (v/v) Полисорбат 20) и инвертировать несколько раз, чтобы удалить бактерии,-специально привязки от комплекса.
  6. Повторите шаги 2.3-2.5 дважды.
  7. После стирки 3rd выполните окончательный магнитной сепарации бусы, повторив шаги 2,3-2,4. Удалить трубы из магнитные стойки и поместите их в отцентрифугировать 1 s крутиться вниз бусины. Затем место трубы в магнитные стойки для 3 мин перед удалением любого остаточного мыть буфера.
  8. Вновь приостановить комплексовсальмонеллы шарик - в 9 мкл пример буфера и Инкубируйте на 95 ° C 3 мин для денатурации.
  9. После охлаждения до 4 ° C на льду, сочетают с 9 мкл буфера реакции плюс 1 мкл фермента смешивать и держать на льду.
  10. В тепловая велосипедист Инкубируйте трубы при 30 ° C на 2 ч для амплификации, следуют Отопление при 65 ° C для 10 мин для инактивации ферментов и охладить до 4 ° C на льду.
  11. Оценить количество и качество продукции MDA посредством измерения концентрации ДНК и чистоты (260/280 соотношение > 1.8) на fluorospectrometer инструменте.
    Примечание: Из-за привязки неспецифической IMS бусы, геномной ДНК от организмов помимо сальмонеллы могут присутствовать в продуктах MDA, но она не влияет на течению анализа.
  12. Хранение готовой продукции (20 мкл) при-20 ° C до использования для ПЦР в реальном времени и/или подготовка библиотеки для quasimetagenomics последовательности.

3. в реальном масштабе времени PCR

Примечание: Этот шаг является необязательным для 1) обнаружения сальмонеллы без подтипов и 2) оценки качества образца до quasimetagenomics последовательности.

  1. Подготовка 18 мкл смеси ПЦР на сэмпл, содержащий универсальный мастер ПЦР Mix (10 мкл), вперед грунтовка (2 мкл, 900 нм), обратный грунтовка (2 мкл, 900 нм), зонд (2 мкл, 250 Нм) и молекулярного уровня воды (2 мкл).
    Примечание: сальмонелла-праймеры олигонуклеотида конкретных (вперед: CTCACCAGGAGATTACAACATGG, реверс: AGCTCAGACCAAAAGTGACCATC) и зонд были призваны усилить 94-ВР последовательность в пределах ttr гена (GenBank присоединение нет. AF 282268)13.
  2. Смешайте MDA продукт от шага 2.12, мягко закупорить вверх и вниз шарик -сальмонеллы комплексов наряду с жидкостью для создания подвеска. Добавьте 2 мкл суспензии в 18 мкл смеси ПЦР.
  3. Запуск ПЦР в реальном времени, используя оптимизированный протокол постановки ПЦР в реальном времени, указание двух периодов Холдинг, один на 50 ° C за 2 мин, а другой на 95 ° C в течение 10 мин, после чего 40 циклов 95 ° c 15 s и 60 ° C 60 s.
  4. Рассчитайте порог цикла (КТ), который является количество циклов, необходимых для флуоресценции от амплифицированного ДНК пересечь линию порогового значения.
    Примечание: Линия порог расположен в линейной фазы между базовой линией и плато усиления участков образцов. Отрицательные результаты соответствуют значениям Ct 40 или образцы с КТ значения выше, чем у отрицательного контроля.

4. Библиотека подготовка к Quasimetagenomic последовательности

Примечание: Продукты MDA можно упорядочивать обеими короткий читать и долго читать (Нанопор) платформ виртуализации. Используйте последнюю версию ДНК приготовительный комплекты библиотека производителей платформы виртуализации. Выполните подготовку библиотеки ДНК согласно инструкции производителя. Используйте 2D низкозатратных геномной ДНК протокол для приготовления библиотека для длительного чтения последовательности платформы5. Для подготовки библиотека для платформы короткие чтения последовательности незначительные изменения в протокол изготовителя приводится ниже.

  1. Следуйте стандартной библиотеки методы подготовки путем добавления продуктов MDA буферных растворов и реагентов. Передача 40 мкл MDA продуктов виртуализации нацелен на новой пластинкой и добавить 20 мкл ПЦР очистка бусин в каждой скважине.
  2. Инкубируйте пластины при комнатной температуре в течение 10 минут без встряхивания.
  3. Бусины с 80% этанола Вымойте и высушите Бусины для 12 мин.
  4. Вновь приостановить высушенные шарики в 53 мкл буфера ресуспендирования и проинкубируйте 2 мин без встряхивания.
  5. Разбавить и бассейн библиотек, следуя инструкции производителя.
    Примечание: 10 pM объединяются и денатурированные библиотека готова к виртуализации.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

До quasimetagenomic последовательности, общее количество и чистота IMS-MDA продуктов могут быть оценены fluorospectrometer (Таблица 1).

Обогащение время (h) Значение CT Концентрация (нг/ul) Чистоты (260/280)
Марка А 4 24.71 812.91 1.89
8 25,80 900.36 1,87
12 15.41 753.88 1.84
Марка Б 4 20.63 872.61 1,87
8 22.61 993.41 1,87
12 19.08 954.44 1,87

Таблица 1: Оценка качества и количества ДНК образцов для секвенирования квази метагеномных. Сальмонелла клетки были привиты в 25 g сырые куриные грудки двух брендов на 1 Inoculated кое/г. образцы обогатились в RV для 4, 8 и 12 h до IMS-MDA.

Оценка целевых количество сальмонелл ДНК может выполняться путем ПЦР в реальном времени (Таблица 1 и 2), который также служит в качестве альтернативы для обнаружения сальмонеллы , если подтипов не требуется.

Figure 2
Рисунок 2: ПЦР в реальном времени для сальмонеллы обнаружения или пример оценки для секвенирования квази метагеномики. Амплификация кривые ПЦР в реальном времени сальмонеллы ДНК в IMS-MDA продукции после 4, 8 и 12 h обогащения времени показываются. Пример после только 2 h обогащения также входит в стоимость номера. Сальмонелла клетки (0.27 кое/г) были привитых 25 g сырые куриные грудки из двух марок А и б. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Fluorospectrometer чтения позволяют первоначальной оценки пробоподготовки. Концентрация IMS-MDA продуктов, приготовленных из сальмонеллы загрязненных куриная грудка образцы варьировались от 701.54 до 945.86 нг/мкл, предполагая, что образец ДНК были усилены. Согласно указаний производителя минимальная концентрация образца ДНК для краткости читать и читать длинные последовательности составляет 0,2 нг/мкл и 1 мкг, соответственно. Отношение 260/280 варьировались от 1,85 до 1,88 (Таблица 1), показаны высокой чистоты образцов ДНК с низким уровнем загрязнения белка.

Меньшие Ct значения указывают на более высокие концентрации сальмонеллы genomic дна в образце. Как показано в таблице 1 и на рисунке 2, Ct значения IMS-MDA продуктов уменьшение как обогащение время увеличивается. В наших предыдущих исследования4, когда Ct значения были ниже, чем 25, большинство (> 50%) ГП был вероятно секвенировать геном, и серотип предсказание от сырой последовательности чтений был успешным.

Неудачной культуры обогащения или IMS может привести к относительно высоким Ct значения, указывающие низкой концентрации геномной ДНК сальмонеллы в заключительном примере, как показано на рисунке 2. Это может произойти, несмотря на высокую концентрацию ДНК и чистоту продуктов IMS-MDA, как было предложено fluorospectrometer чтений.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Из-за изобилия часто низкий и в однородных присутствие в продуктах питания и окружающей среды образцы сальмонеллы обогащение культуры до IMS-MDA все еще необходим для обнаружения сальмонеллы и подтипов; Именно поэтому важнейшим шагом протокола. Чтобы определить оптимальные условия для увеличения изобилия сальмонеллы относительно образец фона флоры, обогащения различных СМИ может оцениваться для конкретных образцов. Согласно MLG и BAM селективной среде такие RV бульон и неселективной среднего например буферизации Пептон воды и лактозы бульон может использоваться для обогащения сальмонеллы из проб продуктов питания. Использование RV при 42 ° C был оценен в наших предыдущих исследования4 для сальмонеллы обогащения от сырого куриного мяса, салат Айсберг и черный перец для поддержки анализа quasimetagenomic возбудителя. По данным FDA BAM и АОХА precollaborative8,9и совместные исследования14,15RV рекомендуется для анализа продуктов высокой микробной и низкой микробной нагрузки.

Оптимальная продолжительность обогащения культуры зависит от нескольких факторов, таких как тип образца, уровень загрязнения сальмонеллой и физиологического состояния загрязнения сальмонеллой . Например, когда низкие уровни сальмонеллеза (например, < 1 кое/г) клетки присутствуют в образец мяса и под холодильной стресс, дольше обогащения (например, > 12 h) может быть необходимо возродить и обогатить сальмонеллы клетки. Достаточные обилие сальмонеллы в модифицированных микрофлора приводит к надлежащей последовательности освещение сальмонеллы загрязнения генома, который может позволить штамм уровне полиморфизм (SNP) введите4. Короче, обогащение культуры (например, менее 12 ч) для быстрого обнаружения5 или типирования сальмонеллы4.

Более высокие уровни загрязнения сальмонеллами или больше культуры обогащение проб загрязненных продуктов питания может привести к более высокой концентрации сальмонеллы геномной ДНК в microbiomes модифицированных продуктов питания, которые приводят к снижению значения Ct из анализ ПЦР в реальном времени. CT значения отображения отрицательная корреляция с охватом секвенирования генома сальмонеллы загрязнения4и поэтому может использоваться для оптимизации и изменения рабочего процесса. Согласно нашему опыту обогащению культуры, особенно длина его, часто находится в центре внимания усилий по устранению неполадок. Например значение Ct IMS-MDA продукта сырые куриные грудки выборки был относительно высоким на 35.94 (рис. 1). Этот образец был засеян с 2,5 кое/г SE клеток и инкубировали в BPW при 37 ° C для 2 h. последовательности данного образца не обеспечивают достаточного охвата SE генома разрешить серотип предсказание. В сравнении все другие образцы с 4 ч или более обогащения были успешно serotyped от quasimetagenomic последовательности данных (не показан).

После виртуализации, мы рекомендуем использование Кракен16 для идентификации сальмонелл читает для дополнительного анализа, биоинформатики. CFSAN SNP трубопровод17 и18 SeqSero может использоваться для SNP ввода и типирования предсказание от сырой последовательности чтений, соответственно.

Этот метод quasimetagenomic имеет несколько ограничений. Во-первых концентрации ДНК и чистота продуктов IMS-MDA, измеряется fluorospectrometer должны использоваться только как предварительный показатель надлежащего пробоподготовки. Благодаря высокой эффективности MDA следовые количества ввода ДНК может быть усилена достаточно весь геном последовательности19. Таким образом высокое качество и количество образцов ДНК еще может быть создан, даже если обогащения культуры или IMS не удается эффективно сконцентрироваться сальмонеллы клеток. Дополнительный анализ ПЦР в реальном времени обеспечивает более целенаправленной и информативным оценки процесса подготовки всей выборки. Во-вторых, трудно для культуры сальмонеллы клеток, таких как жизнеспособной но бактерий nonculturable (VBNC)20, не может расти во время обогащение культуры. Таким образом эти клетки не могут быть обнаружены путем нашего метода.

В целом по сравнению с традиционными методами, наш метод подготовки образца и квази metogenomic последовательности подхода позволяют значительное сокращение аналитической поворот от сальмонеллы-загрязненных продуктов питания и экологических образцов надежные подтипов сальмонеллы загрязнения. В дополнение к сальмонеллыэтот метод имеет потенциал быть прикладной для быстрого и согласованного обнаружения и подтипов других пищевых патогенов.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что они не имеют никаких финансовых интересов.

Acknowledgments

Авторы хотели бы поблагодарить Марк Харрисон и Гвен Hirsch университета Грузии за любезно бактериальный штамм и другой поддержки для этого исследования.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
Квази метагеномных анализ <em>сальмонеллы</em> от пищевых продуктов и экологические пробы
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter