Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Generatie van kanker cel klonen te visualiseren Telomere Repeat-bevattende RNA TERRA uitgedrukt uit een enkele Telomere in levende cellen

doi: 10.3791/58790 Published: January 17, 2019

Summary

Hier presenteren we een protocol voor het genereren van kanker cel klonen met een MS2 sequence tag op een enkele subtelomere. Deze aanpak, afhankelijk van het MS2-GFP-systeem, maakt de visualisatie van de endogene transcripten van Telomere herhalen-bevattende RNA (TERRA) uitgedrukt uit een enkele telomeer in levende cellen.

Abstract

Telomeren zijn getranscribeerd, die aanleiding geven tot Telomere herhalen-bevattende lang noncoding RNAs (TERRA), die zijn voorgesteld om te spelen belangrijke rollen in de telomeer biologie, met inbegrip van de heterochromatin formatie en telomeer lengte homeostase. Recente bevindingen bleek dat TERRA moleculen ook met interne chromosomale regio's communiceren te regelen van genexpressie in cellen van muis embryonale stamcellen (ES). In overeenstemming met dit bewijs, RNA fluorescentie in situ hybridisatie (RNA-vis) analyses hebben aangetoond dat alleen een subset van TERRA lokaliseren afschriften aan chromosoom uiteinden. Een beter begrip van de dynamiek van TERRA moleculen zal helpen bepalen hun functie en de mechanismen van de actie. Hier beschrijven we een methode om te etiketteren en visualiseren van single-telomeer TERRA afschriften in kankercellen met behulp van het MS2-GFP-systeem. Voor dit doel presenteren we een protocol voor het genereren van stabiele klonen, opdrachtregel de AGS menselijke maag kanker cel, met MS2 sequenties op een één subtelomere geïntegreerd. Transcriptie van TERRA van het MS2-gelabeld telomeer resulteert in de expressie van TERRA MS2-gelabelde moleculen die worden gevisualiseerd door live-cel fluorescentie microscopie op co expressie van een MS2 RNA-bindende eiwit gesmolten tot GFP (MS2-GFP). Deze aanpak kan onderzoekers bestuderen de dynamiek van single-telomeer TERRA moleculen in kankercellen, en het kan worden toegepast op andere cellijnen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De lange noncoding RNA TERRA is transcriptie van de subtélomérique regio van chromosomen en de transcriptie opbrengst naar de uiteinden van chromosomen, afgifte binnen de Telomere herhalen tract1,2. Om deze reden, TERRA Transcripten bestaan uit subtelomeric afkomstige sequenties aan hun 5'-eind en beëindigen met Telomere herhalingen (UUAGGG in Vertebraten)3. Belangrijke rollen zijn voorgesteld voor TERRA, met inbegrip van de heterochromatin formatie bij telomeren4,5, DNA replicatie6, bevordering van homologe recombinatie tussen chromosoom eindigt7,8 , 9, telomeer structuur10en telomeer lengte homeostase2,11,12,13te reguleren. Verder, TERRA afschriften communiceren met talrijke extratelomeric sites te reguleren van wijdverbreide genexpressie van muis embryonale stamcellen (ES) cellen14. In overeenstemming met dit bewijs, RNA fluorescentie in situ hybridisatie (RNA-vis) analyses hebben aangetoond dat alleen een subset van TERRA afschriften lokaliseren op telomeren1,2,15. Daarnaast is TERRA gemeld aan nucleaire aggregaten formulier lokaliseren op de X en Y chromosomen in2,16van de cellen van de muis. Deze bevindingen wijzen erop dat TERRA afschriften complexe dynamiek binnen de kern ondergaan. Inzicht in de dynamiek van TERRA moleculen zal helpen definiëren hun functie en de mechanismen van de actie.

Het MS2-GFP-systeem is wijd verbeid gebruikt om te visualiseren de molecules van RNA in levende cellen van verschillende organismen17,18. Dit systeem is eerder gebruikt voor tag en visualiseren van single-telomeer TERRA moleculen in S. cerevisiae12,19. Met behulp van dit systeem, werd onlangs aangetoond dat gist TERRA afschriften binnen het cytoplasma tijdens de post-diauxie shift fase lokaliseren, suggereren dat TERRA extranuclear functies20kan uitoefenen. Onlangs hebben we het MS2-GFP-systeem gebruikt om te studeren van single-telomeer TERRA afschriften van kanker cellen21. Voor dit doel, wij het uitgeven hulpmiddel van CRISPR/Cas9 genoom te integreren MS2 sequenties op een enkele telomeer (telomeer 15q, hierna Tel15q) in dienst en verkregen klonen uiten MS2-gelabeld endogene Tel15q TERRA (TERRA-MS2 klonen). Co uitdrukking van een GFP-gesmolten MS2 RNA-bindende eiwit (MS2-GFP) dat herkent en bindt MS2 RNA opeenvolgingen maakt visualisatie van single-telomeer TERRA afschriften in levende cellen21. Het doel van het protocol geïllustreerd hier is om te beschrijven in detail de stappen die nodig zijn voor de generatie van TERRA-MS2 klonen.

Voor het genereren van TERRA-MS2 klonen, een MS2 cassette is geïntegreerd in de regio subtélomérique telomeer 15q, stroomafwaarts van de TERRA promotor regio en transcriptie begin site. De MS2 cassette bevat een neomycine resistentie gen geflankeerd door lox-p sites, en zijn integratie op subtelomere 15q wordt uitgevoerd met behulp van het systeem CRISPR/Cas922. Nadat de transfectie van het MS2 cassette, enkele klonen zijn geselecteerd en subtélomérique integratie van de cassette wordt gecontroleerd door PCR, DNA sequencing en Southern blot. Positieve klonen zijn besmet met een adenovirus Cre-uiten ter opheffing van de markering van selectie in de cassette, waardoor alleen MS2 sequenties en een enkele lox-p-site op de subtelomere-15q. Expressie van TERRA MS2-gelabeld transcripties van Tel15q wordt gecontroleerd door RT-qPCR. Tot slot het MS2-GFP fusieproteïne wordt uitgedrukt in TERRA-MS2 klonen via retrovirale infectie om te visualiseren MS2-TERRA afschriften door fluorescentie microscopie. TERRA afschriften kunnen gemakkelijk worden gedetecteerd door RNA-vis en live-cel geschikt zijn met behulp van Telomere herhalen-specifieke sondes1,2,15,23. Deze benaderingen leveren belangrijke informatie over de lokalisatie van de totale bevolking van TERRA moleculen bij eencellige resolutie. De generatie van klonen met MS2 sequenties op een enkel subtelomere kunnen onderzoekers bestuderen de dynamiek van single-telomeer TERRA afschriften in levende cellen, die zal helpen bij het definiëren van de functie en de mechanismen van de actie van TERRA.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Selectie van resistente neomycine klonen

  1. AGS in Ham van F-12_K (Kaighn) medium aangevuld met 10% foetale boviene Serum (FBS), 2 mM L-glutamine, penicilline (0.5 eenheden per mL voedingsbodem) en streptomycine (0,2 µg per mL voedingsbodem) bij 37 ° C en 5% CO2cellen groeien. Transfect van de cellen aan een 50-60% samenvloeiing met de sgRNA/Cas9 uiten van vector en het MS2-cassette op een 1:10 molaire verhouding21.
    Opmerking: In een parallelle experiment, laten verifiëren van transfectie efficiëntie door een vector van GFP-uitdrukken (dat wil zeggen, Cas9-GFP vector) transfecting. Ten minste 60-70% transfectie efficiëntie moet worden bereikt.
  2. De volgende dag, vervang het kweken medium met medium dat neomycine op 0,7 µg Mo/mL eindconcentratie (selectieve medium).
    Opmerking: De cellen splitsen en ze zaaien in het selectieve medium overmorgen transfectie zal versnellen van het selectieproces. Alle niet-transfected cellen zal onmiddellijk sterven. Als transfectie is uitgevoerd in 6 goed platen, in welk geval elk putje op een 60% zou samenvloeiing bevatten ongeveer 0.7 x 106 cellen, de volgende dag die de cellen uit een enkele bron aan een 10 cm schotel met selectieve medium kunnen worden verdeeld.
  3. Houden van de cellen in het selectieve medium voor 7-10 dagen, middellange eenieder wijzigen of twee dagen, totdat één klonen zichtbaar zijn.
  4. Picken van cel klonen
    1. Bereiden een 96 goed plaat met 10 µL van 0,25% trypsine in elk putje.
      Opmerking: Twee opstellen 96 platen goed in het geval dat meer dan 96 klonen moeten worden gepickt.
    2. Met het gebruik van een Microscoop, Markeer de positie van elke kloon zichtbaar in de 10 cm schotel doordat een stip aan de onderkant van de schotel met behulp van een markering. Elke stip komt overeen met een kolonie worden gepickt.
    3. Vervang het kweken medium met net genoeg fosfaat gebufferde zoutoplossing (PBS) vormen een dunne film van vloeistof op het klonen en niet laat de cellen droog tijdens het picken van de kloon.
    4. Kies één kolonies met behulp van een precisiepipet 10 µL. Hechten de tip met 5 µL van trypsine naar de kolonie en langzaam laat de trypsine die gelokaliseerde op de kolonie blijven zal. Toestaan trypsine loskoppelen van de cellen voor 1 min en vervolgens schrapen de kolonie met de tip en het zuigen in de tip.
      Opmerking: Tijdens deze procedure, spiegelen de schotel een beetje aan de ene kant, dus om het volume van PBS rond de kolonie wordt geplukt, het pickproces helpen zal door het vermijden van de trypsine rond de kolonie te verdunnen. Met behulp van een kloon ring kan ook helpen het oppakken van één klonen.
    5. Plaats de cellen uit de kolonie in een putje van de 96 goed plaat met 10 µL van 0,25% trypsine.
    6. Incubeer 5 min bij kamertemperatuur, vul de put met 150 µL van selectieve medium (Ham van F - 12K (Kaighn) medium aangevuld met 10% FBS, 2 mM L-glutamine, penicilline (0.5 eenheden per mL voedingsbodem), streptomycine (0,2 µg per mL voedingsbodem) en bevattende neomycine op dan een concentratie van 0,7 µg/mL.
      Opmerking: Tijdens de incubatietijd andere klonen kunnen worden geplukt. Het is raadzaam om te plukken zo veel klonen mogelijk. De meer klonen worden geplukt hoe hoger de kans zal zijn om positieve degenen te identificeren.
    7. Zodra alle van de klonen zijn geplukt en in de 96 goed plaat overgebracht, zodat de cellen groeien voor een paar dagen in het selectieve medium Ham van F - 12K (Kaighn) medium aangevuld met 10% FBS, 2 mM L-glutamine, penicilline (0.5 eenheden per mL voedingsbodem), streptomycine (0,2 µg per mL van medium) en met Neomycine bij een concentratie van 0,7 µg Mo/mL bij 37 ° C en 5% CO2, tot het bereiken van de samenvloeiing van de 90%.
  5. Splitsing van klonen
    1. Bereiden drie 96 goed platen bedekt met gelatine door toe te voegen 100 µL van gelatine per putje, Incubeer gedurende 30 minuten bij kamertemperatuur, dan twee keer wassen met PBS. Deze platen zal worden gebruikt voor DNA-extractie (DNA plaat) en voor kloon bevriezing (bevriezing platen).
      Opmerking: Gelatine bevordert de bijlage van de cellen en het DNA in de putjes. In het bijzonder de gelatine coating zal het toestaan van het DNA te houden aan de onderkant van de putten tijdens de DNA-extractie en wassen van procedures (hieronder besproken). Tijdens de kloon-splitsing procedure is het raadzaam om het gebruik van een meerkanaalspipet.
    2. Zodra klonen 90% samenvloeiing bereiken, gecombineerd medium uit elk putje van de 96 goed plaat, wassen met PBS, Voeg 30 µL van 0,25% trypsine per putje en incubeer gedurende 5 minuten bij 37 ° C.
      Opmerking: Klonen zal groeien verschillende tarieven, die ook van het aantal cellen per kloon geplukt afhangen zal. Dus wordt deze stap uitgevoerd tijdens de verschillende dagen wanneer de verschillende klonen samenvloeiing van 90 bereikt %.
    3. Voeg 70 µL van selectieve medium per putje, cel klontjes door pipetteren op en neer in de putjes verstoren, dan 30 µL van de 100 µL naar de gelatinized DNA plaat gevuld met 120 µL van selectieve medium per µL van het goed en 30 aan de gelatinized bevriezing platen kant wit h 50 µL medium (zonder selectie).
    4. Plaats van de DNA-plaat in de incubator en laat de cellen om te groeien op 37 ° C en 5% CO2 tot 90% samenvloeiing.
    5. Toevoegen van 80 µL van ijskoude vers gemaakte 2 x bevriezing medium (80% FBS en 20% dimethylsulfoxide (DMSO)) aan elk putje van de bevriezing plaat, voeg parafilm (gespoten met 70% ethanol) op de top van de plaat zo aan elk putje zegel, plaats het deksel op de top en wikkel de plaat met aluminiumfolie. Plaats de bevriezing platen bij-80 ° C.
    6. Voeg 90 µL van selectieve medium per putje aan de oorspronkelijke 96 goed plaat met het klonen die zijn gesplitst en houd het in cultuur tot PCR screening van resultaten. Deze plaat zullen worden gebruikt als back-up-plaat.

2. screening van neomycine resistente klonen

  1. DNA-extractie van de 96 goed DNA plaat.
    1. Zodra de klonen gekweekt in de DNA-plaat 90% samenvloeiing bereiken, 2 keer wassen met PBS, dan lyse met 50 µL lysis-buffermengsel (10 mM Tris pH 7.5, 10 mM EDTA, 10 mM NaCl, 0,5% SDS en 1 mg/mL proteïnase K). De afdekplaat met parafilm, afdichten van elk putje, zet het deksel op, dek af met saran omslag, en bij 37 ° C's nachts.
    2. Voeg 100 µL van koude ethanol (Et-OH) / NaCl-oplossing (0,75 M NaCl in 100% ethanol) voor elk goed en neerslag gedurende 6 uur of 's nachts bij kamertemperatuur.
      Opmerking: Het protocol kan hier worden gepauzeerd.
    3. Verwijder de Et-OH/NaCl-oplossing door het omkeren van de plaat en 3 keer wassen met 200 µL van 70% ethanol per putje.
    4. Voeg 25 µL van RNAse A oplossing in gedestilleerd water en Incubeer bij 37 ° C gedurende 1 uur.
  2. 3 µL van genomic DNA voor PCR versterking gebruiken. Uitvoeren van PCR screening van de geselecteerde klonen gebruikend inleidingen binnen het neomycine resistentie gen en subtelomere 15q gloeien. PCR versterking wordt uitgevoerd met behulp van standaard polymerase enzymen en PCR protocollen21.
    Opmerking: PCR voorwaarden MS2 primers (MS2-subtel15q-primer-S en MS2 primer als) en inleidingen van de Klikfrequentie (CTR prime S en CTR primer als) zijn de volgende: 98 ° C gedurende 20 s als denaturatie stap en vervolgens 34 cycli bij 98 ° C 10 s, 58° C 20 s, 72 ° C 15 s , met behulp van polymerase enzym in een 25 µL reactie mix (Zie Tabel van materialen). Primer sequenties zijn aangegeven in tabel 1.
  3. Uitvoeren van PCR reacties op agarose gel en PCR banden positieve klonen met behulp van de standaard gel extractie procedures (Zie Tabel van materialen voor gel extractievloeistoffen) verkregen extract.
  4. Analyses van DNA sequencing van het PCR-product met gel-geëxtraheerde voor bevestiging van de aanwezigheid van de MS2 sequenties21uitvoeren.
    Opmerking: De sequencing analyses kunnen worden uitgevoerd met behulp van de inleidingen voor de screening van de PCR gebruikt.
  5. Zuidelijke vlek screening van positieve klonen van PCR
    1. De klonen positieve PCR en sequencing screening van de oorspronkelijke 96 goed plaat (de back-up-plaat) aan 6 goed platen in Ham van F - 12K (Kaighn) medium aangevuld met 10% FBS, 2 mM L-glutamine, penicilline (0.5 eenheden per mL voedingsbodem), streptomycine (0,2 µg per groeien mL voedingsbodem) en met Neomycine bij een concentratie van 0,7 µg Mo/mL bij 37 ° C 5% CO2.
      Opmerking: Als alternatief, als sommige van deze klonen verloren zijn, ontdooi ze uit een van de bevriezing platen (zie protocol 2.6).
    2. Zodra de klonen zijn aan 90% samenvloeiing in de 6 goed plaat, wassen van de cellen met PBS en voeg 250 µL van lysis buffer met 0,5 µg proteïnase K per putje.
    3. De cellen met behulp van een cel schraper Schraap en breng de lysate in een 1,5 mL-buis.
    4. Incubeer bij 37 ° C gedurende 16 uur.
    5. Voeg 1 mL ethanol 100%, schud krachtig en toestaan van het DNA te precipiteren van ten minste 2 uur of overnachting bij-20 ° C.
      Opmerking: Het protocol kan hier worden gepauzeerd.
    6. Spin bij 13.400 x g bij 4 ° C gedurende 10 minuten, verwijder het supernatant en wassen van de pellets met 70% ethanol. Laat de lucht van de pellets drogen bij kamertemperatuur. Ook gebruiken een vacuüm concentrator.
    7. Resuspendeer de DNA-pellets in 50 µL van gedistilleerd water met RNAse A en incubeer gedurende 1 uur bij 37 ° C.
    8. Het verteren van 5-10 µg genomic DNA via NcoI en BamHI restrictie-enzymen (twee onafhankelijke spijsvertering) in 100 µL reactie volume het broeden van de reacties van de spijsvertering bij 37 ° C's nachts.
    9. 4 µL van de spijsvertering op agarose gel (0,8% agarose) voor volledige spijsvertering bevestiging uitgevoerd.
    10. 1/10 volume van natrium acetaat 3 M oplossing pH 5.2 en 2 volumes van 100% ethanol toevoegen met de reacties van de spijsvertering beperking en incubeer ten minste 2 uur of overnachting bij-20 ° C te precipiteren DNA.
      Opmerking: Het protocol kan hier worden gepauzeerd.
    11. Centrifugeer bij 13.400 x g bij 4 ° C gedurende 20 min, gooi het supernatant en wassen van de pellets met 70% ethanol. Laat de korrels in de lucht droog bij kamertemperatuur. Ook gebruiken een vacuüm concentrator.
    12. Resuspendeer pellets in 20 µL van gedistilleerd water en laadt u het verteerd DNA op een agarose gel van 0,8%.
      Opmerking: Voor een betere resolutie van verteerd DNA, bereiden een gel ten minste 15 cm lang en 's nachts draaien op lage spanning (volt ̴30). De elektroforese ingesteld moet worden geoptimaliseerd.
    13. De volgende dag, vlek de gel met een DNA-etikettering agent, zoals ethidiumbromide op 1 µL/10 mL eindconcentratie, gedurende 30 minuten bij kamertemperatuur en neem een foto met een liniaal dichtbij de gel op een gel imaging instrument.
    14. De overdracht van DNA instelt met een nylon membraan en het uitvoeren van membraan kruising met een MS2 sequentie-specifieke sonde met behulp van standaardprocedures21.
    15. Ontdooi de klonen die positief op PCR, DNA sequencing en zuidelijke vlek uit een van de twee bevriezing platen (zie volgende stap).
  6. Ontdooien van klonen
    1. Bereiden van een tube van 15 mL met 5 mL voor de voorverwarmde Ham F - 12 K (Kaighn) medium aangevuld met 10% FBS, 2 mM L-glutamine, penicilline (0.5 eenheden per mL voedingsbodem) en streptomycine (0,2 µg per mL voedingsbodem) voor elke kloon worden ontdooid.
    2. Verwijder een van de bevriezing platen van-80 ° en voeg 100 µL voorverwarmde F12K compleet medium naar de goed met de positieve kloon worden ontdooid.
      Opmerking: Deze procedure moet snel worden uitgevoerd en de 96 goed plaat moet worden gelegd op droog ijs na elke kloon is ontdooid, zodat de andere klonen te blijven bevroren. Dit is vooral van belang als meerdere klonen moeten worden ontdooid van de dezelfde 96 goed plaat.
    3. De cellen overbrengen in de tube van 15 mL met 5 mL van medium en centrifugeer bij 800 x g gedurende 5 minuten bij kamertemperatuur.
    4. Het medium gecombineerd, resuspendeer de cellen in 500 µL voorverwarmde volledige F12K medium en elke kloon overbrengen in een enkel putje van een 12 goed plaat.
  7. Afschaffing van het neomycine resistentie gen van de cassette MS2 op subtelomere 15q geïntegreerd.
    1. Laat het klonen te groeien van een 12 goed plaat naar een 10 cm schotel in volledige F12K medium.
      Opmerking: Neomycine moet niet worden opgenomen in het medium tenzij anders aangegeven.
    2. Het adenovirus Cre-uiten aan de gekweekte cellen in een 10 cm schotel aan 70% samenvloeiing in 10 mL van volledige F12K medium toevoegen.
      Opmerking: Met behulp van een Cre-GFP waarin adenovirus kan evaluatie van de efficiëntie van de infectie, die 100% moet benaderen. De replicatie-defecte adenovirus zullen verloren gaan na enkele passages in cultuur.
    3. 48 uur na infectie, splitst u de cellen in drie 10 cm schotels. Twee gerechten zullen worden gebruikt voor verificatie van het neomycine gene wegnemen door negatieve selectie, groeiende cellen in neomycine-bevattende medium (eerst schotel), en door de zuidelijke vlek (tweede schotel).
    4. Cultuur van de derde schotel met de kloon voor cel invriezen en RNA extractie.

3. verificatie van de TERRA-MS2 Transcript expressie door RT-qPCR

  1. Na verificatie van neomycine gene verwijdering, totaal RNA extractie van TERRA-MS2 klonen met behulp van organische oplosmiddelen (fenol en guanidine isothiocynate oplossing)21uit te voeren.
    1. Resuspendeer de RNA geëxtraheerd uit een 10 cm schotel in 100 µL van diethyl pyrocarbonate (DEPC) water.
    2. 3 µL van RNA op gel in werking een denaturating (1% formaldehyde-bevattende) 1 x 3-(N-Morpholino) propanesulfonic zuur (MOPS) om na te gaan van concentratie en de integriteit van het RNA. Ook analyseren RNA concentratie met een spectrofotometer.
    3. Behandelen van 3 µg van RNA met DNAse mij using 1 eenheid van DNAse ik enzym in 60 µL definitieve reactie volume.
    4. Incubeer de reactie gedurende 1 uur bij 37 ° C.
  2. Reverse transcriptie reactie en qPCR analyses
    1. De volgende onderdelen toevoegen aan een nuclease-gratis microcentrifuge-buis: 2 µL van een specifieke primer bij 1 µM TERRA, 1 µL van dNTPs mix (elke 10 mM), 6 µL van DNAse ik behandelde RNA (overeenkomend met ̴300ng RNA). Stel het volume in op 13 µL met 4 µL van DEPC water.
      Opmerking: Voor elke RNA te analyseren, een tweede buis met dezelfde reagentia maar een referentie specifieke primer, in plaats van TERRA specifieke primer, moet worden opgesteld.
    2. Verwarm het mengsel tot 65 ° C gedurende 5 minuten en incubeer in ijs voor minstens 1 min.
    3. Verzamelen van de inhoud van de buizen door kort centrifugeren en voeg 4 µL van 5 X RT enzym Buffer, 1 µL 0,1 M dithiothreitol (DTT), 1 µL (4 eenheden) van RNAse remmer en 1 µL van reverse-transcriptase (Zie Tabel van materialen).
    4. Incubeer de monsters bij 42 ° C gedurende 60 min, gebruik dan 2 µL van de RT-reactie voor qPCR analyses.
  3. QPCR reactie mix in een eindvolume van 20 µL bestaande uit 10 µL van 2 x qPCR master mix, 2 µL van cDNA sjabloon, 1 µL van voorwaartse primer (10 µM), 1 µL van omgekeerde primer (10 µM), en 6 µL van water voor te bereiden.
  4. QPCR reactie in een thermocycler via standaardprotocollen21uitvoeren.

4. productie van een retrovirussen MS2-GFP uitdrukken

  1. Wilt genereren waarin retrovirus MS2-GFP, transfect 80% confluente phoenix verpakking cellen met een MS2-GFP fusieproteïne uitdrukken retrovirus vector (pBabe-MS2-GFP PURO) en een env gen uiting van vector (zoals pCMV-VSVG) met behulp van een molaire verhouding 4:1 van de twee vectoren.
  2. De volgende dag, door het kweken medium (DMEM aangevuld met 10% FBS, 2 mM L-glutamine en Pen/Strep) te vervangen door verse medium met 10mM natrium butyraat.
  3. Incubeer gedurende 8 uur bij 37 ° C, 5% CO2, dan vervangt het medium met verse kweken medium waar het virus verzameld worden zal.
  4. Na 48u, het retrovirus-bevattende medium van de phoenix cellen te verwijderen. Dit medium is direct inzetbaar voor infectie van TERRA-MS2 klonen, in welk geval Filtreer het medium door een 0,45 µm filter toevoegen polybrene (eindconcentratie is 30 µg/mL) en toe te voegen aan de cellen (in dit geval het protocol blijft bij stap 5). Als alternatief kan retrovirus in een tube van 50 mL falcon worden neergeslagen door toevoeging van 1/5th volume van 50% PEG-8000/900 mM NaCl-oplossing en 's nachts het broeden bij 4 ° C op een rotator-wiel.
  5. De volgende dag, pellet retrovirus deeltjes door centrifugeren bij 2.000 x g gedurende 30 min, verwijder supernatant en resuspendeer de pellet in F12K medium zonder serum.
    Opmerking: De virusdeeltjes kunnen worden resuspended in 1/100,th van het oorspronkelijke supernatant volume. Een infectie test moet worden verricht om te verifiëren of de minimale hoeveelheid retrovirus vereist om de cellen efficiënt te infecteren.

5. visualisatie van TERRA-MS2 afschriften in levende cellen

  1. Plaat TERRA-MS2 klonen en WT AGS cellen in glazen bodem gerechten. Op de dag van de infectie, voeg toe polybrene aan het medium (eindconcentratie is 30 µg/mL) en het MS2-GFP waarin retrovirus.
  2. Na 24 uur verwijderen van het virus-bevattende medium en toevoegen van verse medium zonder fenol-rood.
  3. Het analyseren van de cellen in een omgekeerde Microscoop met behulp van de instelling van de juiste Microscoop. Het imago van de cellen met een 100 X of 60 X doelstelling met grote numerieke diafragma (1.4 X) en het gebruik van een gevoelige camera (EMCCD). Een milieucontrole-systeem gebruiken om de monsters bij 37 ° C en 5% CO2 tijdens imaging.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figuur 1 geeft een overzicht van de experimentele strategie. De belangrijkste stappen van het protocol en een indicatief tijdschema voor de generatie van TERRA-MS2 klonen in AGS cellen worden weergegeven(figuur 1). Op dag 1, zijn meerdere putjes van een 6 goed plaat transfected met de MS2 cassette en sgRNA/Cas9 uiten van vectoren (afgebeeld in figuur 1B). Twee verschillende subtelomere-15q-specifieke gids RNA-sequenties zijn gekloond in de Cas9 nickase-uiten pX335 vector, het genereren van twee sgRNA-pX335-vectoren die mede transfected met het MS2-cassette. Een putje van de plaat kan met een GFP uiting van vector om te controleren of de efficiëntie van de transfectie zijn transfected. Op dag 2, zijn de cellen trypsinized en overgebracht uit een enkele bron naar een 10 cm schotel met selectieve medium. Op dag 3, moet medium worden gewijzigd als meest untransfected cellen dood zal zijn. Cellen worden gekweekt in selectie totdat klonen zijn zichtbaar en klaar om te worden gepickt. Gedurende deze tijd, de cellen niet moeten worden trypsinized en kweken medium mag worden gewijzigd elke 1-2 dagen voor de eerste week en dan elke 2-3 dagen daarna. Zodra één klonen zichtbaar zijn, worden ze geplukt en overgebracht in een 96 goed bord waar zij zijn toegestaan om te groeien tot het bereiken van 80-90% van de samenvloeiing. Op dit punt, zijn klonen verdeeld in 4 verschillende 96 goed platen, die zijn aangegeven in figuur 1 met een kleurcode. Zodra de klonen gekweekt in de DNA-plaat (groen) 80% samenvloeiing bereikt, ze zijn lysed en genomic DNA geëxtraheerd voor PCR screening; de klonen in de back-up-plaat (blauw) zal in cultuur worden bewaard tot de resultaten van de PCR screenen, terwijl de rode bevriezing platen zijn bevroren bij-80 ° C. Figuur 2 B toont representatieve resultaten van de screening van een PCR van neomycine-resistente klonen. Voor deze voorstelling twee reeksen inleidingen worden gebruikt: een primer paar (MS2 inleidingen) gloeien binnen de neomycine gen en subtelomere 15q volgorde wordt gebruikt om te controleren of de aanwezigheid van het MS2-cassette (een representatief beeld van de inleidingen lokalisatie weergegeven in Figuur 2A). Een tweede primer paar (CTR inleidingen) gloeien op een interne chromosomale regio wordt gebruikt om te controleren of de aanwezigheid van valse negatief klonen (primer sequenties zijn aangegeven in tabel 1). Negatieve klonen voor de integratie van de cassette moet de MS2 inleidingen versterking negatieve en positieve versterking van de CTR inleidingen. Technische problemen in genomic DNA-extractie, resulterend in de afwezigheid van genomic DNA of besmetting zou uitsluiten PCR versterking van MS2 en CTR primer reacties. In deze gevallen kunnen de klonen betrokken worden opnieuw gescreend door PCR op extractie van genomic DNA van de back-up-plaat. Banden MS2 inleidingen versterking van positieve klonen verkregen kunnen worden gel-geëxtraheerde en gesequenceerd met behulp van de MS2 primers, ter bevestiging van de aanwezigheid van tien MS2 sequenties.

De klonen die positief op PCR screening zijn gekweekt van de 96 goed back-plaat (de blauwe plaat in figuur 1) naar een 6 goed plaat, dan lysed voor genomic DNA-extractie en Southern blot analyses. Figuur 2 D toont beelden van de vertegenwoordiger van een gel (links) en gekruist met een radioactief gelabelde MS2 reeks specifieke sonde (rechts) van een screening van de zuidelijke vlek van positieve klonen van PCR membraan. Voor bevestiging van de integratie van de sequenties MS2 op subtelomere 15q, moet met twee verschillende enzymen van de beperking (NcoI en BamHI) in twee afzonderlijke spijsvertering reacties genomic DNA geëxtraheerd uit elke kloon worden verteerd. De NcoI en BamHI restrictie-enzymen zijn geschikt voor verificatie van de integratie van de cassette MS2 op subtelomere 15q. Andere enzymen kunnen ook worden gebruikt. De gel bevat een volledige spijsvertering van genomic DNA met behulp van het enzym van de beperking van de BamHI, zoals aangegeven door de aanwezigheid van een uitstrijkje. De resultaten van de zuidelijke vlek aangeven dat één kloon is positief voor de integratie van de cassette MS2 op subtelomere 15q terwijl verschillende klonen meerdere integratie evenementen van de cassette, tonen zoals aangegeven door de aanwezigheid van meerdere banden. Een positieve kloon moet worden geanalyseerd door een tweede zuidelijke vlek bij NcoI vertering van genomic DNA21. Een representatief beeld van een subtelomere 15q met de MS2 cassette en de positie van BamHI en NcoI restrictie-enzym-sites is afgebeeld in figuur 2C.

De klonen positieve PCR en Southern blot analyses zijn besmet met een Cre-GFP waarin adenovirus ter opheffing van het neomycine gen aanwezig in het MS2-cassette. Figuur 3 A toont een MS2-gelabeld subtelomere 15q vóór en na Cre expressie. Een afbeelding van een kloon positief voor de integratie van de cassette MS2 op subtelomere 15q besmet met een Cre-GFP waarin adenovirus is afgebeeld in figuur 3B. Voor een volledige verwijdering van het neomycine-gen in alle cellen, moet de efficiëntie van de infectie bereiken ongeveer 100%. Zoals blijkt uit figuur 3C, om te verifiëren of de afschaffing van het neomycine gen, worden Cre-GFP geïnfecteerde cellen gesplitst in drie platen na 48 uur van de infectie. Ene plaat zal worden gekweekt in aanwezigheid van neomycine. Alle cellen in deze plaat moeten sterven binnen 6-7-dagen. In een tweede plaat, zullen de cellen mogen opgroeien in volledige medium zonder selectie tot 80-90% samenkomst. Op dit punt, is de genomic DNA geëxtraheerd en geanalyseerd door Southern blot. De derde plaat is gekweekt in volledige medium dat de voorbereiding van bevroren voorraden van de kloon, en voor RNA extractie en RT-qPCR analyses van TERRA-MS2 transcript expressie. Figuur 3 D toont representatieve beelden van zuidelijke vlek analyses van een positieve kloon voor en na de Cre-GFP infectie. DNA agarose gel (afbeelding links) bevestigt de volledige spijsvertering van de genomic DNA met behulp van het enzym van de beperking van het NcoI. Zuidelijke vlekkenanalyse werd uitgevoerd met een radioactief gemerkte MS2-sequence specifieke sonde (afbeelding rechts). Deze analyse bevestigt het verwijderen van het neomycine gen. De aanwezigheid van een uitstrijkje in het Cre-GFP besmet monster bevestigt de Telomere integratie van het MS2-sequenties. De positie van de NcoI beperkingsplaatsen binnen de subtelomere 15q wordt weergegeven in figuur 3A.

Zodra de afschaffing van het neomycine resistentie gen is bevestigd, kunnen het klonen voor de expressie van TERRA-MS2 afschriften worden getest. Voor dit doel, is de totale RNA geëxtraheerd uit elke kloon en draaien op een denaturating MOPS gel te bevestigen zijn integriteit (figuur 4vanA). Ribosomaal RNA banden moet zichtbaar op 4700 bases (rRNA 28) en 1.900 baseert (rRNA 18S). Retrotranscription reactie wordt uitgevoerd met behulp van een Telomere herhalen-specifieke primer en verwijzing gen-specifieke primer (figuur 4B, boven) terwijl qPCR analyses van TERRA expressie worden uitgevoerd met behulp van twee reeksen inleidingen: een primer paar gloeien binnen het MS2-reeks en de volgorde van subtelomere 15q; een tweede paar inleidingen binnen de subtelomere 15q gloeien. Primer sequenties zijn aangegeven in tabel 1. De grafiek in figuur 4B gepresenteerd toont RT-qPCR analyses van TERRA expressie van AGS WT cellen en twee verschillende TERRA-MS2 klonen. Deze analyses bevestigen de expressie van TERRA-MS2 afschriften in de twee klonen op niveaus die vergelijkbaar met TERRA transcripties van subtelomere 15q in WT cellen uitgedrukt zijn. Deze gegevens wijzen erop dat de twee TERRA-MS2 klonen geselecteerd geschikt voor de analyses van TERRA-MS2 transcripties door levende cel imaging zijn.

Om te visualiseren TERRA-MS2 afschriften in levende cellen, zijn de geselecteerde klonen besmet met een retrovirussen het MS2-GFP fusieproteïne uitdrukken. Figuur 5 A ziet u de procedure voor het genereren van MS2-GFP waarin retrovirus, zoals beschreven in stap 4 van de protocol. AGS WT cellen en TERRA-MS2 klonen zijn besmet in glassbottom gerechten. Na 24 h van de infectie, worden cellen geanalyseerd door fluorescentie microscopie. De specificiteit van het signaal wordt bevestigd door de aanwezigheid van TERRA-MS2-GFP foci gedetecteerd in de kern van TERRA-MS2 klonen en niet in AGS WT cellen (figuur 5vanB). In een populatie van MS2-GFP uiting van cellen, heterogeniteit in termen van MS2-GFP niveaus onder cellen verwachting en cellen uiten van lage niveaus moeten worden gekozen voor de beeldvorming analyses. U kunt ook kunnen het MS2-GFP waarin cellen worden gesorteerd FACS voorafgaande microscopie analyses om te verzamelen van de populaties van cellen uiten van lage niveaus van GFP. We hebben al eerder gedetecteerd TERRA-MS2-GFP foci in 40% tot 60% van de cellen van AGS TERRA-MS2 klonen21. In deze cellen, waren een tot vier TERRA-MS2-GFP foci beeld per cel. TERRA-MS2-GFP foci tonen verschillende maten en dynamiek kunnen worden gedetecteerd21. TERRA-MS2 klonen kunnen worden gebruikt voor het bestuderen van de dynamiek van single-telomeer TERRA afschriften in levende cellen. Als voorbeeld van deze toepassing toont figuur 5C representatieve beelden uit microscopie analyses van een kloon van de TERRA-MS2 uiting geven aan het MS2-GFP fusieproteïne en de telomeer-bindend-proteïne die trf2 tot mCherry ter gesmolten Visualiseer MS2-gelabeld TERRA transcripties en telomeren in levende cellen. Met behulp van deze aanpak, hebben we eerder gezien dat TERRA-MS2-GFP foci mede lokaliseren met telomeren in 44% van de cellen, die aangeeft dat TERRA afschriften alleen Transient mede met chromosoom eindigt in AGS cellen21 lokaliseren.

Figure 1
Figuur 1 . Overzicht van de experimentele strategie en het indicatieve tijdschema voor de generatie van TERRA-MS2 klonen in AGS cellen. A) de procedure die wordt beschreven in het protocol en een indicatieve tijdlijn voor de selectie van TERRA-MS2 klonen worden weergegeven. Cellen zijn transfected in een 6 goed bord met de gelineariseerde MS2 cassette en sgRNA/Cas9 uiten van vectoren. Een kleurcode wordt gebruikt om te onderscheiden van de DNA-plaat, de back-up-plaat en de bevriezing platen vermeld in de sectie protocol. B) de MS2 cassette bestaat uit een 800 nt lange subtelomere 15q volgorde gevolgd door 10 herhalingen van de MS2 sequenties en een neomycine resistentie gen geflankeerd door lox-p sites en eindigt met een 300 nt lang Telomere herhalen tract aan de 3'-eind. sgRNA/Cas9 waarin vectoren werden gegenereerd door het klonen van subtelomere 15q-specifieke gids RNA opeenvolgingen in pX335 vector met behulp van de BbsI beperking site21,22. Twee verschillende sgRNA-pX335-vectoren zijn gegenereerd en de mix van een 1:1 van de twee vectoren werd gebruikt voor de transfectie. De sequenties van de sgRNAs worden aangegeven in tabel 1. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 . Representatieve beelden van PCR en Southern blot screening van neomycine resistente klonen. A) representatief beeld van subtelomere 15q met het MS2-cassette. De positie van de MS2 inleidingen (MS2-subtel15q-primer-S en MS2 primer als) gebruikt voor PCR screening wordt aangegeven. De loxP sites aanwezig binnen de cassette worden in rood weergegeven. B) representatief beeld van PCR screening van neomycine resistente klonen met behulp van twee set primers, MS2 inleidingen en inleidingen van de Klikfrequentie (CTR prime S en CTR primer als). C) representatief beeld van subtelomere 15q met het MS2-cassette. BamHI en NcoI beperkingsplaatsen en het MS2-sonde gebruikt voor de screening van de zuidelijke vlek worden weergegeven. D) links: 10 µg genomic DNA per kloon waren verteerd met BamHI and run op een agarose gel. Het beeld werd verworven na een overnachting op 30 volt uitgevoerd. Rechts: genomic DNA verteerd met enzym van de beperking van de BamHI werd overgebracht naar een positief geladen nylon membraan en gekruist met een radioactief gemerkte MS2 sequentie-specifieke sonde. Het rode kader geeft aan de verwachte omvang van de positieve band. De rode pijl geeft een positieve kloon. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 . Afschaffing van het neomycine resistentie gen en validatie experimenten. A) representatief beeld van subtelomere 15q met de cassette MS2 vóór en na Cre expressie. De MS2 specifieke sonde gebruikt voor analyses van de zuidelijke vlek en NcoI restrictie-enzym sites worden weergegeven. De loxP sites aanwezig binnen de cassette worden in rood weergegeven. B) fluorescentie microscopie analyse van een kloon van de TERRA-MS2 besmet met Cre-GFP waarin adenovirus. Representatieve afbeelding verkregen op een enkele brandvlak wordt getoond. MOI, multipliciteit van infectie, is de verhouding tussen het aantal virussen gebruikt voor de infectie en het aantal cellen van de gastheer. Schaal bar: 30 µm C) overzicht van de experimentele strategie gebruikt om te controleren of de opheffing van het neomycine gen. Cre-GFP besmette cellen worden gesplitst in drie platen na 48 uur na de infectie voor i) negatieve selectie, ii) zuidelijke vlek analyses en iii) opstelling van bevroren cel voorraden en RNA extractie. D) zuidelijke vlek analyses van een TERRA-MS2 kloon voor en na de Cre-GFP adenovirus infectie. 10 µg genomic DNA werden verteerd met het beperkingsenzym NcoI. Agarose gel bevestigt dat volledige spijsvertering wordt bereikt in beide klonen (links). Het verteerd genomic DNA werd overgebracht naar een positief geladen nylon membraan en gekruist met een MS2 sequentie-specifieke sonde. Volledige eliminatie van het neomycine gen wordt bevestigd door het ontbreken van de specifieke band. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4 . RT-qPCR analyses van Tel15q-TERRA en Tel15q-TERRA-MS2 afschriften expressie. A) representatief beeld van een MOPS gel tonen totale RNA AGS WT cellen en TERRA-MS2 klonen is onttrokken. Bands overeenkomt aan de RNAs ribosomaal 28 en 18S worden aangegeven. B) Top: een schematische voorstelling van het MS2-gelabeld subtelomere 15q uiting van TERRA afschriften. Inleidingen gebruikt voor TERRA retrotranscription (geel) en qPCR analyses van Tel15q-TERRA (blauw) en Tel15q-MS2 TERRA (rood) worden weergegeven. De site loxP wordt weergegeven in rood. Bodem: RT-qPCR analyses van Tel15q-TERRA en Tel15q-MS2 TERRA afschriften expressie in AGS WT cellen en TERRA-MS2 klonen. p < 0,05, ongepaarde t-test. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5 . Levende cel imaging analyses van TERRA-MS2 klonen. A) een overzicht van de procedure voor het produceren van een MS2-GFP waarin retrovirus, zoals beschreven in stap 4 van de protocol. Een schematische voorstelling van het MS2-gelabeld subtelomere 15q en TERRA transcripties erkend door het MS2-GFP fusieproteïne wordt weergegeven aan de rechterkant. B) vertegenwoordiger fluorescentie microscopie beeld van AGS WT en twee TERRA-MS2 klonen MS2-GFP uitdrukken. TERRA-MS2-GFP foci worden aangegeven met pijlen. Beelden werden verkregen met behulp van een draaiende schijf confocal microscoop uitgerust met een EMCCD camera. De beelden werden gevangen met behulp van een 100 X / 1,46 apochromat doel in een imaging zaal onderhouden bij 37 ° C met 5% CO2. Een 488 laser werd gebruikt als lichtbron. Schaal bar: 5 µm. C) levende cel imaging analyses van TERRA-MS2-GFP foci en TRF2-mCherry met het label telomeres. Een mede-localisatie evenement tussen een TERRA-MS2-GFP-focus en een enkele telomeer wordt weergegeven. Beelden werden verworven zoals in B, 488 en 520 lasers gebruiken als lichtbron. Een maximale projectie van een z-stack experiment tegelijk uitgevoerd één punt van time-lapse imaging experiment wordt weergegeven. Schaal bar: 5 µm. Klik hier voor een grotere versie van dit cijfer.

De naam van de primer Primer volgorde Toepassing
Ms2-subtel15q-primer-S TGCATTAAAGGGTCCAGTTG Ms2 primer vooruit gebruikt voor PCR screening van neomycine resistente klonen
Ms2 primer als CCTAACTGACACACATTCCACAGA Ms2 primer omgekeerde gebruikt voor PCR screening van neomycine resistente klonen
CTR primer S TGT ACG CCA ACA CAG TGC GS CTR primer vooruit gebruikt in PCR screening van neomycine resistente klonen
CTR primer als GCT GGA AGG TGG ACA GCG A CTR primer omgekeerde gebruikt in PCR screening van neomycine resistente klonen
Tel15q-S1 GCAGCGAGATTCTCCCAAGC Zin primer gebruikt voor het opsporen van Tel15q en Tel15q-MS2 TERRA expressie door qPCR
hTel15q-AS TAACCACATGAGCAATGTGGGTG Antisense primer gebruikt voor het opsporen van Tel15q en Tel15q-MS2 TERRA expressie door qPCR
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Antisense primer gebruikt voor het opsporen van Tel15q-MS2 TERRA expressie door qPCR
TERRA-RT-primer CCCTAACCCTAACCCTAACCCTAACCCTAA Primer gebruikt voor retrotranscription van TERRA afschriften
sgRNA1 TTGGGAGAATCTCGCTGGCC Volgorde van de korte handleiding RNA 1 gekloond in pX335 vector en gebruikt voor het directe Cas9 nickase enzymatische activiteit subtelomere 15q
sgRNA2 TGCATTAAAGGGTCCAGTTG Volgorde van de korte handleiding RNA 2 gekloond in pX335 vector en gebruikt voor het directe Cas9 nickase enzymatische activiteit subtelomere 15q

Tabel 1 : Lijst van de in deze studie gebruikt inleidingen. Een lijst van de inleidingen en de sequenties van de sgRNAs gebruikt in dit protocol worden geleverd. Sequenties zijn 5' naar 3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In dit artikel presenteren we een methode voor het genereren van menselijke kanker cel klonen met MS2 sequenties geïntegreerd binnen subtelomere 15q. Met behulp van deze klonen, worden de transcriptie van de subtelomere-15q MS2-gelabeld TERRA-moleculen gedetecteerd door fluorescentie microscopie door co uitdrukking van een fusieproteïne MS2-GFP. Deze aanpak kan onderzoekers bestuderen de dynamiek van TERRA uitgedrukt uit een eenpersoons telomeer in levende cellen21. In dit protocol, worden TERRA-MS2 klonen geselecteerd in de AGS cellijn, die een interessant modelsysteem te bestuderen van TERRA, aangezien TERRA expressie upregulated in menselijke maag kanker monsters24 isvertegenwoordigt. Echter, het protocol hier beschreven kan worden aangepast voor de selectie van TERRA-MS2 klonen in andere cellijnen. De integratie van de MS2 sequenties kan in principe worden bevorderd op een verschillend van telomere 15q subtelomere met behulp van een specifieke MS2 cassette en CRISPR strategie. In de methode die hier gepresenteerd, zijn een Cas9 nickase enzym en dubbele gids RNAs in dienst zijn teneinde de specificiteit van integratie22. Met behulp van deze strategie, een algemene 2-% van positieve klonen moeten zo worden geïdentificeerd in AGS cellen. Andere versies van het Cas9 enzym kunnen worden getest in de poging om het verhogen van het slagingspercentage van de klonen selectie25. Daarnaast zijn de volgende stappen van het protocol kritische rekening te houden om te maximaliseren van de efficiëntie van de kloon-selectie:

I) teneinde de kans op het selecteren van het TERRA-MS2 klonen, het is belangrijk om een hoge transfectie efficiëntie van de MS2 cassette en de CRISPR-vectoren te bereiken. Slecht transfected cellijnen zal waarschijnlijk nodig dat verschillende rondes van transfectie, kloon selectie en screening positief klonen selecteren.

II) het is belangrijk om te bepalen van de precieze concentratie van het neomycine te gebruiken voor de selectie van de klonen. Inderdaad, met behulp van een lage concentratie van het geneesmiddel zal leiden tot valse positieve klonen terwijl een hoge concentratie de identificatie van positieve klonen beletten kan. De concentratie van de neomycine aangegeven in dit protocol is dodelijk aan de AGS cellen binnen 6-7 dagen uit de toevoeging aan het kweken medium.

III) kloon plukken is een cruciale stap. Tijdens deze procedure is vereist dat de enige single klonen worden geplukt. Voor deze reden, kolonies die te dicht bij dat elkaar moet worden vermeden om te voorkomen dat mengen van verschillende klonen cellen, resulterend in de selectie van een gemengde bevolking van klonen die MS2 sequenties kan bevatten op meerdere genomic sites geïntegreerd. Deze gebeurtenissen moeten worden vastgesteld tijdens de zuidelijke vlek screening.

IV) de hoeveelheid genomic DNA geëxtraheerd uit een heuvels 96 goed DNA plaat (protocol 2) wordt geschat op ongeveer 5 µg en moet volstaan om het scherm elke kloon door PCR en Southern blotting met een enkele restrictie-enzym spijsvertering. Om te bevestigen de integratie van de cassette op de verwachte telomeer, zal het wel belangrijk dat het scherm elke kloon door zuidelijke vlek door het verteren van het genomic DNA met twee verschillende enzymen van de beperking. Voor dit doel, zoals aangegeven in het protocol, moeten de positieve op PCR screening klonen worden gekweekt in 6 goed platen. De hoeveelheid genomic DNA geëxtraheerd uit een put van een 6 goed plaat zal volstaan voor ten minste twee spijsvertering van de beperking nodig voor de zuidelijke vlek-analyses.

In het protocol beschreven hier, de MS2 sequenties zijn geïntegreerd in subtelomere 15q om een aantal redenen: ik) TERRA promotor regio en TERRA transcriptie start sites zijn geïdentificeerd op deze subtelomere26,27; II) TERRA-expressie aan vanaf subtelomere 15q is gevalideerd met behulp van in vitro technieken4,27,28,29,30; III) de subtélomérique regio van het chromosoom 15q sequenced heeft geweest en het bevat een unieke regio grenzend aan het Telomere herhalen darmstelsel dat voor de integratie van het MS2-cassette21kan worden gericht. PCR en Southern blot benaderingen zijn ontwikkeld om te bevestigen de interne integratie van de sequenties MS2 binnen subtelomere 15q in de TERRA-MS2 klonen. Het zou interessant zijn om uit te voeren ook DNA-vis experimenten op chromosoom spreads om te visualiseren de chromosomale lokalisatie van de MS2 sequenties in vaste metafase chromosomen. Echter, de lengte van de 10xMS2 sequenties (450 bp) legt het gebruik van zeer korte sondes in vergelijking tot de sondes die in het algemeen gebruikt in DNA-vis experimenten op chromosoom spreads (bacteriële kunstmatige chromosomen (Bac), cosmids of plasmiden)31. Deze technische uitdaging heeft ons verhinderd visualiseren de MS2 sequenties op chromosoom spreads, waarmee een beperking van het protocol. Een verdere beperking van de methode is de tijd en de inspanning die nodig is voor het selecteren van het TERRA-MS2 klonen. Daarnaast zijn specifieke laboratorium instellen en apparatuur voor het gebruik van virussen, radioactief materiaal en microscopie analyses vereist.

De hier beschreven methode kan worden uitgevoerd voor de generatie van TERRA-MS2 klonen in verschillende cellijnen ter vastlegging van de dynamiek van TERRA in verschillende biologische contexten, zoals tijdens telomeer dysfunctie of cellulaire senescentie, helpt ons te begrijpen de functie van TERRA in deze processen. Een interessante ontwikkeling van deze aanpak zullen de generatie van TERRA-MS2 klonen met TetO herhaalt geïntegreerde op een specifieke subtelomere, met inbegrip van de telomeer MS2-gelabeld. De expressie van een TetR eiwit gesmolten aan een fluorescente proteïne (dat wil zeggen, mCherry) zal toestaan visualisatie van dit bijzondere telomeer in levende cellen32. Op deze manier kunt onderzoek of menselijke TERRA afschriften lokaliseren en handelen in DIS op het TERRA transcriberen telomeer en chromosoom of in trans door verhuizing naar andere chromosomen. Deze vraag in de biologie van TERRA moet nog worden verduidelijkt.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren geen concurrerende financiële belangen

Acknowledgments

We zijn dankbaar voor het personeel van de geavanceerde imaging faciliteit van CIBIO bij de Universiteit van Trento en de BioOptics licht microscopie faciliteit op de Max F. Perutz laboratoria (MFPL) in Wenen. Het onderzoek leidt tot deze resultaten heeft financiering ontvangen van de Mahlke-Obermann-Stiftung en de zevendekaderprogramma voor onderzoek, technologische ontwikkeling en demonstratie van de Europese Unie onder de Subsidieovereenkomst geen 609431 bij EG. EG wordt ondersteund door een Rita Levi Montalcini fellowship van het Italiaanse ministerie van onderwijs, Universiteit en onderzoek (MIUR).

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Generatie van kanker cel klonen te visualiseren Telomere Repeat-bevattende RNA TERRA uitgedrukt uit een enkele Telomere in levende cellen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter