Here, we present a protocol for the development and the characterization of a zebrafish model of epilepsy resulting from the transient inhibition of the DEPDC5 gene.
Method Article
* These authors contributed equally
Here, we present a protocol for the development and the characterization of a zebrafish model of epilepsy resulting from the transient inhibition of the DEPDC5 gene.
Epilepsy represents one of the most common neurological disorders, affecting an estimated 50 million people worldwide. Recent advances in genetic research have uncovered a large spectrum of genes implicated in various forms of epilepsy, highlighting the heterogeneous nature of this disorder. Appropriate animal models are essential for investigating the pathological mechanisms triggered by genetic mutations implicated in epilepsy and for developing specialized, targeted therapies. In recent years, zebrafish has emerged as a valuable vertebrate organism for modeling epilepsies, with the use of both genetic manipulation and exposure to known epileptogenic drugs, such as pentylenetetrazole (PTZ), to identify novel anti-epileptic therapeutics. Deleterious mutations in the mTOR regulator DEPDC5 have been associated with various forms of focal epilepsies and knock-down of the zebrafish orthologue causes hyperactivity associated with spontaneous seizure-like episodes, as well as enhanced electrographic activity and characteristic turn wheel swimming. Here, we described the method involved in generating the DEPDC5 loss-of-function model and illustrate the protocol for assessing motor activity at 28 and 48 h post fertilization (hpf), as well as a method for recording field activity in the zebrafish optic tectum. An illustration of the effect of the epileptogenic drug PTZ on neuronal activity over time is also provided.
Due to its small size, oviparous development and transparency at early stages of development, zebrafish has emerged as a valuable vertebrate organism for modeling human diseases as diverse as cardiovascular, cancer or neurological disorders1,2. Zebrafish combines the advantages of a vertebrate, including the high conservation of organ architecture and genetic code, with the small size and ease of genetic manipulation of simpler model organisms, therefore facilitating both fundamental studies and translational applications. In particular, its amenability to high-throughput automated screening of behavior and fluorescent markers of cellular processes has made zebrafish a particularly attractive model for epilepsy research. This has been demonstrated by a high increase in the last decade of the number of publications featuring chemically-induced and/or genetic models of epilepsy3,4,5 and, more recently, reports of promising therapeutics obtained from chemical screens in these models6,7,8.
DEPDC5 is a member of the GATOR1 complex, a negative regulator of mTOR signaling9. Mutations in the DEPDC5 gene have been first discovered in 2013 in probands suffering from autosomal dominant focal epilepsies10,11, and have since been reported in a number of clinical conditions associated with focal epileptic manifestations and focal cortical dysplasia12. The large majority of reported mutations are predicted to cause the loss-of-function of the gene12, and this was formally demonstrated for a number of DEPDC5 mutated transcripts which are targeted by nonsense mediated mRNA decay12,13. In agreement, knock-down of the gene orthologue in zebrafish using antisense morpholino oligonucleotides (AMOs) results in a number of features that are common to epileptic models in this organism, including hyperactivity, turn wheel-like swimming, spontaneous seizures and enhanced neuronal activity14,15,16,17,18. Interestingly, treatment with rapamycin, an inhibitor of mTOR signaling, reversed the behavioral features of this model18, supporting the hypothesis that DEPDC5 loss-of-function can trigger epilepsy due to a misregulation of the mTOR pathway9,19.
Transient knock-down of gene expression in vivo using antisense oligonucleotides carrying the morpholino modification has been an invaluable tool for studying the role of specific genes, on par with si/shRNA-based techniques. Recently, AMO-based strategies have also found clinical applications, with a first AMO therapy receiving the FDA approval for the treatment of Duchenne muscular atrophy in 201620. While it was reported that in zebrafish the phenotype of acute AMO-based gene knock-down does not always correlate with the constitutive knock-out models21, this can be due at least in some instances to compensatory mechanisms engendered by constitutive genetic modifications22. However, the issue of specificity of the AMO-induced phenotype is an undisputable concern that has to be diligently addressed in studies using this technology23. In order to ensure the specificity of the AMO-based knock-down phenotype, several key controls are necessary. These include a dose-response curve that allows the selection of the lowest dose of AMO effective for gene knock-down, avoiding overall toxicity due to the introduction of an excess of genetic material. The use of a Mismatch AMO that does not target any particular region in the genome is also required for establishing an appropriate dose and in identifying a specific phenotype. A second AMO which targets a different region of the same gene, such as a splice-blocking AMO, is necessary to confirm that the phenotype is due to the knock-down of the target gene. Rescue of the knock-down phenotype with the cDNA of the gene, either the human orthologue or a codon-modified version of the zebrafish gene that cannot be targeted by the AMO, provides a strong argument in favor of the phenotype specificity. Lack of rescue with the same cDNA containing loss-of-function mutations (such as the introduction of an early stop codons) is a further proof in this direction.
Here, we present a method for generating a zebrafish DEPDC5 loss-of-function model and the protocol for behavioral phenotyping at 28 and 48 h post fertilization (hpf). At 28 hpf, DEPDC5 loss-of-function causes overall hyperactivity, as evidenced by enhanced coiling and twitching movements of the embryos within the chorion. An automated motion detection system can be used at this stage to quantify the overall activity per embryo. At 48 hpf, zebrafish exhibit stereotyped escape swimming in response to touch. In zebrafish with downregulated expression of DEPDC5, the swimming trajectory is significantly more tortuous than in controls, the fish exhibiting a “cork-screw” or “turn-wheel” like pattern, similar to other reported epilepsy models in this organism3,4. Electrophysiological recordings were obtained in the optic tectum in zebrafish larvae between 4-6 days post fertilization (dpf) and show a baseline increase in neuronal activity in the DEPDC5 knock-down animals. The advantage of this model is that it presents several phenotypic features at different time points, which can be useful in monitoring and assessing the efficacy of drug therapies during development.
Experimental procedures were approved by the National and Institutional Ethical Committees.
1. Transient Knock-down of DEPDC5 Gene in Zebrafish Embryo
2. Behavior Analysis
3. Electrophysiological Analysis
Figure 1 shows representative voltage traces of 4-6 dpf zebrafish larva extracellular field recordings in the case of two genetic conditions: Mismatch control and DEPDC5 knock-down. In the baseline period of the recording, DEPDC5 knock-down shows a higher occurrence of spontaneous events, while the Mismatch control displays very few fluctuations. These activity patterns are representative of the significant increase in neuronal activity due to loss-of-function of DEPDC5, as we have previously reported18. After PTZ application, both Mismatch control and DEPDC5 knock-down show an increased number of depolarization events. During the first period after PTZ application (10 – 60 min), a rate of 0.8 events per min is observed in both Mismatch control and DEPDC5 knock-down, where the majority of events are of high amplitude (>1 mV). During the latter response period (60 – 120 min after PTZ application), the rate of depolarization events increases to around 1 event per min, and the majority of the events are of low amplitude (≤1 mV).

Figure 1: Example traces of field recordings in the zebrafish larvae brain. (A) Overview of 180 min recording for a Mismatch control larva and a DEPDC5 Knock-down. First, spontaneous baseline activity was recorded, then PTZ was applied in bath (red bar). (B) Peri-stimulus time histograms of the depolarization events for Mismatch control and DEPDC5 knock-down. The events were classified as high amplitude (>1 mV - blue) and low amplitude (≤1 mV - black). (C-E) Example traces of the different periods of the recording: (C) spontaneous activity, (D) High amplitude events during the first period after PTZ application, (E) Low amplitude events during the latter period after PTZ application. Note that the script files to obtain these figures are provided as Supplementary File. Please click here to view a larger version of this figure.
Supplementary File: Script files for step 3.4. Please click here to view a larger version of this figure.
Epilepsy is a complex neurological disease, featuring a wide range of etiologies that are starting to be elucidated with the advent of genetic sequencing technologies25,26,27. Versatile animal models are essential for an efficient translational strategy that will yield both insights into the pathological mechanisms of genetically linked epilepsies, as well as targeted therapies for the distinct forms of this condition. Zebrafish models have been very effective at reproducing major features of epilepsy and providing reliable readouts for anti-epileptic drug screening5,28. Spontaneous seizures can be detected in genetically modified zebrafish15,29,30,31 and neurophysiological analysis in these models28 has confirmed the neuronal basis of the epileptic-like behavior32,33. Small-sized zebrafish larvae are amenable to chemical screens in 96-well format using automated detection of simple behavior, such as spontaneous swimming, which allows for rapid detection of potential therapeutics.
The DEPDC5 knock-down model presented here is obtained by injection of AMO into the zebrafish embryo to block gene expression during development. This model presents several keystone phenotypic features during different time points of larval development, which can be used as indicators of therapy efficiency during a chemical or genetic screening protocol. The AMO-mediated gene knock-down is a powerful technique, displaying advantages over chemically-induced seizure models, as it specifically targets the expression of a gene of interest, thus allowing the identification of the underlying pathogenic mechanisms triggered by a genetic mutation. Chemical inducers, which are nevertheless potent tools for drug screenings, can act through multiple cellular pathways that might not be always relevant to the genetic mutation under study. While AMO injection is in itself a simple technique when mastered by the experimenter, it also presents a number of limitations. The injections have to be performed at the one cell stage embryo; in our hands, injections at later stages greatly increased the variability of the phenotype. This limits the time available for injection; therefore, a strategy of generating eggs for injection in a time sequence is useful. We routinely use 4-5 crosses that we open at 15-20 min intervals, allowing the injection of one clutch before obtaining the next one. Further, care must be taken to assess the phenotype at the same time points between different experiments, as stereotyped behaviors evolve rapidly during the first days of development. The volume and concentration of AMOs must also be carefully controlled, as general toxicity due to injecting excessive amounts will mask the specific phenotype. The different controls presented in the introduction are essential for determining the right injection dose and the corresponding phenotype.
Field recordings of the larval zebrafish brain are a useful tool for investigating the deleterious effects of genetic mutations involved in different brain disorders on the global neuronal activity34. Depolarization events seen under these experimental conditions are an established method for assessing electrophysiological effects of drugs in different epileptic conditions15,35. However, the assessment of these effects has mostly been done qualitatively rather than quantitatively, and having a subjective observer as an actor in the analysis. Here, we develop an automatic detection strategy that can objectively quantify the rate of depolarizations, their amplitude and duration, and can evaluate the progress of these parameters across time, or with different genetic or pharmacologic interventions.
The representative results presented here show the expected field activity of the DEPDC5 knock-down genetic model in comparison to a Mismatch control in 4-6 dpf zebrafish, before and after the application of PTZ to introduce epileptiform-like electrographic activity. Previously, we have shown a significant increase in the basal activity of the DEPDC5 knockdown condition18. Here, we show that the response of these two conditions to PTZ, a chemical epileptiform activity inducer, has a similar trajectory in time, starting with a period of relatively low frequency, high amplitude depolarization events and continuing with a period of higher frequency, lower amplitude depolarization events. Field recording events have slow dynamics (frequencies of interest are in the range of 0.005-0.2 s-1), therefore both low-pass and high-pass filters are used in this protocol to isolate the events of interest. After eliminating the low frequency noise, the detection of depolarization events is performed using a simple threshold. Since the statistics of the signal are greatly affected by the presence of depolarization events, we could not use the standard deviation of the total signal to determine this threshold. The variability of the value of the standard deviation across datasets was greater than the observed recording noise levels. Therefore, after visual inspection of the traces, we used a fixed value of the threshold of 0.3 mV, in order to avoid the biasing induced by different levels of depolarization activity.
The described protocol provides a standardized and simple method for evaluating the motor behavior and the neuronal field activity, via extracellular current clamp voltage recording coupled with automatic detection of depolarization events in the optic tectum, to characterize epileptiform-like phenotypes in zebrafish models.
The authors have nothing to disclose.
We would like to thank the staff of the ICM electrophysiology platform where the neurophysiology experiments were performed. We also thank Anca Marian for technical help. SC was supported by the Trampoline Grant #21488. EK was supported by the AFM Grant #18469 and ERC Consolidator Grant (ALS-Networks). HC was supported by PhD awards from the Fondation pour la Recherche Médicale (PLP20141031462) and ARSLA. For AD and RM, this work was supported by three grants from the Romanian National Authority for Scientific Research and Innovation, CNCS-UEFISCDI (project numbers PN-III-P4-ID-PCE-2016-0010, PN-III-P2-2.1-PED-2016-0007, and COFUND-NEURON-NMDAR-PSY), a grant by the European Union’s Horizon 2020 research and innovation programme – grant agreement no. 668863-SyBil-AA, and a National Science Foundation grant NSF-IOS-1656830 funded by the US Government.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Agarose | Sigma-Aldrich, France | A9539 | |
| Aquarium salt | Instant Ocean, Blacksburg, VA | SS15-10 | |
| Borosilicate glass with filament | Sutter Instruments | BF100-50-10 | OD: 1.5mm, ID: 0.5 mm |
| CaCl2 | Sigma-Aldrich, France | C1016 | |
| Depdc5-atg antisense morpholino | GeneTools, OR, USA | N/A | sequence 5’- TGCCTTCATGGTGACCGTCATTTTA -3’ |
| Depdc5-mis antisense morpholino | GeneTools, OR, USA | N/A | sequence 5’- TGCgTTgATcGTGACCcTgATTTTA -3’ |
| Depdc5-splice antisense morpholino | GeneTools, OR, USA | N/A | sequence 5’- ACATTCCTGTTTCACCATAGATGAT -3’ |
| Digitizer | Molecular Devices, CA, USA | Digidata 1550 | |
| Fast Green Dye | Sigma-Aldrich, France | F7258 | Stock solution of 0.2% |
| Glass-bottom petri dishes | Ibidi, Germany | 81218 | |
| Glucose | Sigma-Aldrich, France | 68270 | |
| Grasshopper 2 camera | FLIR, BC, Canada | GRAS-03K2M-C | formerly Point Grey Research |
| HEPES | Sigma-Aldrich, France | H3375 | |
| Human wild-type DEPDC5 cDNA | Dharmacon, France | NM_001242897.1 | Accession: BC144291 Clone ID 905 |
| ImageJ software | NIH, USA | N/A | |
| KCl | Sigma-Aldrich, France | P9333 | |
| Matlab software | MathWorks, MA, USA | N/A | |
| MgCl2 | Sigma-Aldrich, France | M2670 | |
| NaCl | Sigma-Aldrich, France | S7653 | |
| NaOH | Sigma-Aldrich, France | 71687 | |
| Pancuronium bromide | Alomone Labs | P-130 | Stock solution of 60 mM in water |
| Parafilm | Sigma-Aldrich, France | P7793 | |
| Patch clamp amplifier | Molecular Devices, CA, USA | MultiClamp 700B | Computer-controled patch clamp amplifier |
| pClamp10 acquisition software | Molecular Devices | N/A | |
| Pentylenetetrazol (PTZ) | Sigma-Aldrich, France | P6500 | Stock solution of 300 mM (dissolved in recording solution) |
| Pipette puller | Narishige, Japan | PC-10 | |
| Pneumatic PicoPump | WPI, France | PV 820 | |
| Sylgard 184 kit | Sigma-Aldrich Intl. | 761036 | |
| Transfer plastic pipettes | Sigma-Aldrich, France | Z350605 | |
| Zebralab | Viewpoint, France | N/A |