Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Real-time opvolgen van de DNA Strand Exchange reactie gemedieerd door Rad51

Published: February 13, 2019 doi: 10.3791/59073

Summary

Fluorescentie resonantie energie overdracht gebaseerde real-time opvolgen systemen van DNA strand uitwisseling reactie gemedieerd door Rad51 werden ontwikkeld. Met behulp van de protocollen die hier gepresenteerd, zijn wij kundig voor speurder van de vorming van reactie tussenproducten en hun omzetting in producten, terwijl ook het analyseren van de enzymatische kinetiek van de reactie.

Abstract

De DNA strand uitwisseling reactie gemedieerd door Rad51 is een cruciale stap van homologe recombinatie. In deze reactie, Rad51 vormt een nucleoproteïne gloeidraad op single-stranded DNA (ssDNA) en double-stranded DNA (dsDNA) niet-specifiek om het ondervragen van een homologe reeks vangt. Na het ontmoeten van homologie, katalyseert Rad51 DNA strand exchange voor het bemiddelen in paren rangschikken van de ssDNA met het complementaire deel van de dsDNA. Deze reactie is sterk gereguleerd door talrijke accessary eiwitten in vivo. Hoewel conventionele biochemische tests met succes hebben gewerkt aan de rol van zo'n accessoire eiwit in vitroonderzoeken, kinetische analyse van tussenliggende vorming en de progressie naar een eindproduct heeft bewezen uitdagend vanwege de unstable en voorbijgaande aard van de tussenproducten van de reactie. Te observeren reactie volgt rechtstreeks in oplossing, fluorescentie resonance energy transfer (FRET)-op basis van real-time opvolgen systemen van deze reactie waren vastgesteld. Kinetische analyse van real-time waarnemingen blijkt dat het DNA strand uitwisseling reactie gemedieerd door Rad51 gehoorzaamt aan een drie-stappen-reactie-model met betrekking tot de vorming van een tussenliggende drie fronten-DNA, rijping van deze intermediair en de release van ssDNA van de volwassen intermediair. Het Swi5-Sfr1-complex, een accessary eiwit geconserveerd in eukaryoten, verbetert sterk de stappen van het tweede en derde van deze reactie. De FRET gebaseerde testen hier gepresenteerde ons in staat stellen om te ontdekken de moleculaire mechanismen via welke recombinatie accessary eiwitten de DNA strand uitwisseling activiteit van Rad51 stimuleren. Het hoofddoel van dit protocol is ter verbetering van het repertoire van technieken beschikbaar aan onderzoekers op het gebied van homologe recombinatie, met name die werken met eiwitten van andere dieren dan Schizosaccharomyces pombe, zodat de evolutionaire instandhouding van de bevindingen hierin kan worden bepaald.

Introduction

Homologe recombinatie (HR) vergemakkelijkt het schuifelen van genetische informatie tussen twee verschillende DNA-moleculen. HR is essentieel voor twee fundamentele biologische fenomenen: de generatie van de genetische diversiteit tijdens geslachtscel1 en de reparatie van dubbel-bundel van DNA (DSBs)2 breekt tijdens de mitose. DSBs zijn de meest ernstige vorm van DNA-beschadiging en vormen een breuk in het chromosoom. Onjuiste reparatie van DSBs kan leiden tot uitgebreide chromosomale herschikkingen en de instabiliteit van het genoom, die beide stempels van kanker3.

De DNA strand uitwisseling reactie is de centrale fase van HR. Het Rad51-eiwit, dat deel van de zeer geconserveerde RecA-type familie van recombinases uitmaakt, is het belangrijkste eiwit dat deze reactie in eukaryoten4,5katalyseert. In deze reactie, Rad51 bindt aan single-stranded DNA (ssDNA) gegenereerd door nucleolytic bewerking van het einde van de DSB en vormen een spiraalvormige nucleoproteïne complex genoemd de presynaptische gloeidraad. Deze gloeidraad vangsten intact double-stranded DNA (dsDNA) nonspecifically om te zoeken naar een homologe reeks. Wanneer de gloeidraad een homologe reeks vindt, een reactie die tussenliggende met drie-stranded DNA wordt gevormd en de Rad51 gloeidraad bemiddelt strand uitwisseling binnen deze structuur6,7,8. Rad51 vereist om te bereiken deze reactie efficiënt, verschillende soorten accessoire eiwitten zoals BRCA1 en BRCA2, producten van borst kanker gevoeligheid genen9,10.

Begrip is hoe accessoire factoren Rad51 regelen een integrale stap in het blootleggen van de oorzaken van de instabiliteit van het genoom tijdens tumorvorming. Hoewel veel onderzoek over de effecten van deze factoren op presynaptische gloeidraad vorming en stabiliteit11,12,13,14,15,16 gaat, de bijdrage van deze factoren tot vorming van de drie fronten intermediaire en de verwerking ervan in het eindproduct is nog onduidelijk. Observeren reactie volgt via conventionele biochemische experimenten is zeer moeilijk, omdat de drie fronten intermediaire is instabiel en gevoelig voor samenvouwen door gemeenschappelijke experimentele manipulaties zoals deproteinization van monsters of elektroforese.

Om dit probleem te verhelpen, aangepast we twee eerder ontwikkelde real-time observatiesystemen voor de DNA strand uitwisseling reactie met behulp van fluorescentie resonance energy transfer (FRET): de DNA strand koppelen en DNA strand verplaatsing testen17, 18 (Figuur 1). In de bundel van DNA pairing assay, Rad51 vormen een presynaptische gloeidraad met fluoresceïne wordt amidite (FAM) - label ssDNA en vervolgens homologe carboxy-x-rhodamine (ROX) - dsDNA label toegevoegd aan het initiëren van het onderdeel exchange reactie. Wanneer de gloeidraad vangsten van de ROX-geëtiketteerden dsDNA en de drie fronten intermediair vormt, de twee fluorophores komen nabijheid en fluorescentie emissie van FAM is uitgeblust door ROX (figuur 1A). In het DNA strand displacement assay, is een presynaptische gloeidraad gevormd op labelloze ssDNA geïncubeerd met FAM en ROX double-gelabeld dsDNA. Bij het onderdeel exchange is voltooid en de FAM ssDNA het label wordt vrijgelaten uit de drie fronten middenniveau, de uitstoot van de verhogingen van de FAM omdat FAM is niet langer in de directe nabijheid van ROX (figuur 1B). Deze testen kunnen we observeren de vorming van drie fronten tussenproducten en de verwerking ervan in de eindproducten in real-time zonder enige verstoring van de reactie.

Met behulp van dit systeem real-time opvolgen, vonden we dat de DNA strand uitwisseling reactie gemedieerd door Rad51 in drie-stappen met inbegrip van de vorming van de eerste reactie tussenliggende (C1 verloopt), van de eerste tussentijdse overgang naar een tweede intermediair (C2), en de introductie van ssDNA van C219. We vonden ook dat kernsplijting gist (S. pombe) Swi5-Sfr1, oftewel een evolutionair geconserveerde Rad51 accessoire eiwit complex13,16,20,21,22, stimuleert de overstap van de C1-C2 en vrijlating van ssDNA van C2 op een wijze die is afhankelijk van de ATP-hydrolyse door Rad5119.

Deze bevindingen zijn of evolutionair bewaard blijft onbekend. Dit protocol wordt geleverd met de hoop dat onderzoekers op het gebied van HR, vooral degenen die werken met eiwitten van organismen met uitzondering van S. pombe, kunnen het toepassen van deze technieken om te bepalen van de mate waarin het moleculaire mechanisme van de Rad51-gedreven strand uitwisseling is bewaard. Bovendien, deze technieken hebben bewezen zeer succesvol bij het bepalen van de rol van S. pombe Swi5-Sfr1. Het is dus een rationele voorspelling dat deze technieken onschatbare waarde zijn zal bij het blootleggen van de precieze rol van andere HR accessoire factoren.

Protocol

1. bereiding van eiwitten en DNA substraten

  1. S. pombe Rad51 en Swi5-Sfr1 eiwitten aan homogeniteit (beoordeeld door Coomassie kleuring), als eerder gemeld13,21zuiveren.
  2. Oligonucleotide DNA substraten vermeld in tabel 118voor te bereiden.
    Opmerking: De oligonucleotides werden gekocht (Zie Tabel van materialen) en gesynthetiseerd op HPLC-kwaliteit. Voor de paring reactie, oligonucleotides bundel van DNA 16FA(-), 16A (-) _40bp en 16AR (+) _40bp zijn vereist. Voor de DNA displacement assay, oligonucleotides 16A(-), 16FA (-) _40bp en 16AR (+) _40bp zijn vereist (Figuur 1 en tabel 1). Alle concentraties van het DNA in dit protocol verwijzen naar het fragment van concentraties in tegenstelling tot de nucleotide concentraties.
  3. Om donor dsDNA, meng mengsel bedragen van complementaire strengen in een PCR dunwandige buis met onthardende buffer (10 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2), zorgen voor een totale volume groter is dan 20 µL. uitvoeren deze mixen op een prechilled metalen rek op ijs (tussen 2 ° C en 4 ° C).
    Opmerking: De combinatie van oligonucleotides voor de pairing assay zijn 16A (-) _40bp en 16AR (+) _40bp. Voor de displacement assay, anneal oligonucleotides 16FA (-) _40bp en 16AR (+) _40bp.
  4. Verwarm de onthardende mengsel bij 90 ° C gedurende 5 min en meer dan 3 h tot 30 ° C met behulp van een PCR-machine afkoelen. Winkel de ontharde DNA bij-20 ° C.

2. DNA Strand koppelen en verplaatsing Assays

  1. Bundel van DNA test in paren rangschikken uit te voeren.
    1. Bereiden van 1,6 mL reactie buffer A (30 mM HEPES-KOH pH 7.5, 1 mM dithiothreitol [DTT], 15 mM MgCl20,25 mM ATP, 0,1 mg/mL bovien serumalbumine [BSA] en 0.0075% polyoxyethylenesorbitan Propyleenglycolmonolauraat) met 36 nM 16FA(-) in een 2,0 mL micro-centrifuge kunststof buis (polypropyleen) en het vooraf Incubeer bij 37 ° C gedurende 5 minuten.
    2. Rad51-ssDNA door samensmelting van filamenten vormen, Rad51 eiwit toevoegen om een eindconcentratie van 1,5 µM in de buffer vooraf bebroede reactie en het incuberen bij 37 ° C gedurende 5 minuten.
    3. Swi5-Sfr1 eiwit toevoegen aan het mengsel een eindconcentratie van 0.15 µM en het Incubeer bij 37 ° C voor een verdere 5 min.
    4. Neem 1,5 mL van het mengsel en breng dit in een 1.0 x 1.0 cm kwarts Cuvet met een magnetische roerder en stel de cuvette in een spectrofluorometer. Configureer de peltier temperatuurregelaar van de spectrofotometer valt tot 37 ° C en de magneetroerder ingesteld op 450 rpm om ervoor te zorgen snelle mengen van het geïnjecteerde monster.
    5. Beginnen met het meten van de emissie van de fluorescentie van FAM op 525 nm (bandbreedte: 20 nm) na excitatie op 493 nm (bandbreedte: 1 nm). Verzamelen van gegevens elke seconde.
    6. Na het starten van de meting voor 100 s, injecteren ROX-geëtiketteerden donor dsDNA om een eindconcentratie van 36 nM in het mengsel met behulp van een spuit en meet de verandering in de emissie s tussenpozen 1 voor een verdere 30 min.
  2. Uitvoeren van DNA strand displacement assay.
    1. 1.6 mL reactie buffer A bereiden met 36 nM 16A(-) in een 2,0 mL micro-centrifuge plastic tube en het vooraf Incubeer bij 37 ° C gedurende 5 minuten.
    2. Vormen van filamenten van de Rad51-ssDNA in aanwezigheid van Swi5-Sfr1 bij 37 ° C, zoals beschreven in stappen 2.1.2. en 2.1.3.
    3. Nemen 1,5 mL van het mengsel en breng dit in de kwarts Cuvet met een magnetische roerder en stel de cuvette in de spectrofotometer, zoals beschreven in stap 2.1.4.
    4. Beginnen met het meten van de fluorescentie-emissie en na 100 s, injecteren van FAM - en ROX-geëtiketteerden donor dsDNA zoals beschreven in stap 2.1.6. Het meten van de verandering in de fluorescentie emissie s tussenpozen 1 voor een verdere 30 min.

3. het analyseren van experimentele gegevens van de koppeling en verplaatsing vitrotests

  1. Schatten maximumefficiency FRET.
    1. Bereiden van 16FA(-) gegloeid met 16AR (+) _40bp en 16FA (-) _40bp gegloeid met 16AR (+) _40bp met de hierboven beschreven procedure, beschreven in stap 1.3 en 1.4.
    2. Bereiden van 130 μL van reactie buffer A met 36 nM van beide 16FA(-), 16FA(-) gegloeid met 16AR (+) _40bp, 16FA (-) _40bp gegloeid met 16AR (+) _40bp of 16FA (-) _40bp in een cuvet van 0,2 x 1.0 cm kwarts.
    3. Stel de cuvette in het spectrofluorometer en Incubeer bij 37 ° C gedurende 5 minuten.
    4. Meten van de spectra van de fluorescentie van 500 tot 600 nm bij excitatie op 493 nm.
    5. Test het effect van Rad51 op de uitstoot van FAM en blussen van FAM door ROX Rad51 aan een eindconcentratie van 1,5 μM aan het mengsel toevoegen en Incubeer bij 37 ° C gedurende 5 minuten.
    6. Meten van de spectra van de fluorescentie van 500 tot 600 nm bij excitatie op 493 nm.
    7. Bereken FRET maximumefficiency (Emaximale) met behulp van de vergelijking die hieronder worden beschreven:
      Maximale E = (intensiteit van de fluorescentie op 525 dsDNA aangeduid met zowel FAM en ROX nm) / (intensiteit van de fluorescentie op 525 nm voor FAM label ssDNA)
  2. Analyseren van experimentele gegevens van de displacement assay.
    1. Zet de verandering in fluorescentie waargenomen in de bepaling van de verplaatsing aan de verandering in de hoeveelheid eindproduct, normaliseren rauwe experimentele gegevens verkregen uit deze test met behulp van de vergelijking die hieronder worden beschreven, waar Fraw is intensiteit van de fluorescentie van ruwe gegevens en Fgenormaliseerde is de verandering in de fluorescentie berekend met de volgende formule.
      Fgenormaliseerde = ([Fraw op moment x]-[Fraw op moment 0]) / (([Fraw op moment 0] / Emaximale)-[Fraw op moment 0])
      Fraw op moment 0 is de gemiddelde fluorescentie gecontroleerd voor de eerste 5 s na de dode tijd (dat wil zeggen, de tijd die nodig is voor het mengen van nadat een injectant is ingevoerd in de meetcel).
    2. Als u wilt uitsluiten van de effecten van photobleaching en spontane verplaatsing, aftrekken Fgenormaliseerde zonder eiwitten uit Fgenormaliseerde van het monster te verkrijgen FD, die is de verandering in de hoeveelheid eindproduct in deze test.
      FD = [Fgenormaliseerde van monster] - [Fgenormaliseerde zonder eiwitten]
  3. Analyseren van experimentele gegevens van de pairing assay.
    1. Normaliseren van ruwe experimentele gegevens verkregen uit de pairing bepaling met behulp van de vergelijking die hieronder worden beschreven, waar Fraw is de intensiteit van de fluorescentie van ruwe gegevens en Fgenormaliseerde is de verandering in de fluorescentie berekend met de volgende formule.
      Fgenormaliseerde = (Fraw op moment x) / (Fraw op moment 0)
      Fraw op moment 0 is de gemiddelde fluorescentie gecontroleerd voor de laatste 20 s voordat de reactie door het injecteren van het substraat dsDNA.
    2. Als u wilt converteren van verandering in fluorescentie in verandering in de hoeveelheid substraat en uitsluiten van de effecten van photobleaching en spontane pairing, normaliseren Fgenormaliseerde van monster met behulp van de vergelijking die hieronder worden beschreven, waar FP is de verandering in de hoeveelheid substraat in deze test.
      FP = 1 - (([Fgenormaliseerd zonder eiwitten] - [Fgenormaliseerde van monster]) / [1-Emaximale])
    3. Om te onderzoeken de reactiekinetiek van DNA strand uitwisseling, niet-lineaire van de laatste vierkante regressieanalyses van de pairing reactie met behulp van de analyse programma23 uit te voeren (Zie Tabel van materialen).
      1. Een bestand in .txt-indeling met daarin cursus tijdgegevens van FPvoorbereiden.
      2. Start het programma en het script in het Bestand met aanvullende Code plakken met een venster van het programma:
      3. Niet-lineaire laatste vierkante regressie-analyse starten De resultaten van deze analyse zal worden weergegeven in hetzelfde venster.

Representative Results

Om effectief analyseren de experimentele gegevens van de paring en verplaatsing tests, is het noodzakelijk om te definiëren hoe een verandering in de fluorescentie emissie van FAM correspondeert met een omzetting van DNA substraten in producten. Om dit te bereiken, moet het relevante bereik van de intensiteit van de fluorescentie worden bepaald. Voor de pairing assay, de uitstoot van de fluorescentie van 16FA(-), die overeenkomt met de ssDNA substraat, wordt vergeleken met de uitstoot van 16FA(-) gegloeid met 16AR (+) _40bp, die overeenkomt met de eindproducten van deze reactie (figuur 2A). Dit komt neer op het maximale efficiëntie van de FRET en vandaar de maximale verlaging van intensiteit van de fluorescentie die zou worden verwacht als alle ssDNA substraat werd omgebouwd tot het dsDNA product. Voor de displacement assay, de uitstoot van 16FA (-) _40bp gegloeid met 16AR (+) _40bp, die overeenkomt met het substraat, wordt vergeleken met de uitstoot van 16FA (-) _40bp, die overeenkomt met het eindproduct (figuur 2B). In dit geval, vervoert de maximale stijging van de intensiteit van de fluorescentie van FAM een scenario waarin alle van het substraat dsDNA wordt omgezet in ssDNA product. S. pombe Rad51 beïnvloedde niet fluorescentie emissie van FAM of blussen van efficiëntie van FAM door ROX in beide tests (Figuur 2). De maximale efficiëntie van de FRET moet opnieuw gemeten met elke nieuwe voorbereiding van oligonucleotides is afhankelijk van de labeling efficiëntie van oligonucleotides.

Representatieve gegevens van DNA strand in paren rangschikken en verplaatsing reacties zijn afgebeeld in Figuur 3. De effecten van spontane reacties tussen de ANI van het substraat en photobleaching waren klein in beide testen, zoals geopenbaard door het te verwaarlozen veranderingen gezien in de uitstoot van FAM zonder Rad51 ten opzichte van de ingrijpende veranderingen gezien met Rad51 (figuur 3A en Figuur 3B). Op basis van de gegevens in figuur 3A of 3B van de figuurweergegeven, werd de wijziging in de fluorescentie omgebouwd tot de wijziging in het bedrag van het substraat (FP) of eindproduct (FD), respectievelijk, met behulp van de vergelijkingen beschreven in stappen 3.2.2 of 3.3.2 ( Figuur 3 c en 3D figuur).

De pairing reactie werd gesimuleerd met behulp van een sequentiële drie-stappen-reactie-model, bestaande uit de vorming van de eerste drie fronten intermediaire (C1), overgang van de eerste tussenproduct in de tweede intermediair (C1-C2), en de vrijval van ssDNA vanaf de tweede intermediair tot het vormen van de twee producten (D + E) (figuur 3E). Om te testen of de simulatie met behulp van een sequentiële reactie van drie-stap model pasvorm de experimentele gegevens, storingswaarden tussen experimentele gegevens van de bundel van DNA test en een theoretische curve verkregen door middel van de simulatie in paren rangschikken werden berekend (figuur 3F). Daarnaast waren storingswaarden tussen de pairing reactie en een theoretische curve gegenereerd met behulp van een sequentiële tweestaps reactie model ook berekende (Figuur 3 g). De correcties voor de pairing-reactie en het in twee stappen model Toon een systematische afwijking in het beginstadium, overwegende dat de correcties voor de pairing-reactie en het model van drie-stap geen een dergelijke afwijking vertonen. Dit geeft aan dat de drie-stappen-model een betere pasvorm dan de twee stappen model is voor het simuleren van de pairing reactie.

Om te testen of het drie-stappen-model komt overeen met de verplaatsing reactie die de laat stap van DNA strand uitwisseling detecteert, we genereerden een theoretische curve van de reactie van de verplaatsing met behulp van de kinetische parameters verkregen simulatie van de koppeling reactie weergegeven in Figuur 3 c en vergeleken met de experimentele gegevens van de reactie van de verplaatsing weergegeven in figuur 3D (Figuur 3 H). De theoretische curve past de experimentele gegevens van de displacement assay. Uit deze resultaten concluderen we dat simulatie met het model van drie-stap kunnen redelijk evalueren de DNA strand uitwisseling reactie gemedieerd door Rad51.

Representatieve gegevens van de bundel van DNA pairing reactie met Rad51 en het Swi5-Sfr1-complex, een accessary eiwit van Rad51, worden weergegeven in figuur 4A. Het Swi5-Sfr1-complex sterk gestimuleerd de pairing activiteit van Rad51. Zoals we gezien hebben in het ontbreken van Swi5-Sfr1, aansluit de pairing reactie beter bij de drie stappen model dan het in twee stappen model in aanwezigheid van Swi5-Sfr1 (figuur 4B). Door middel van simulatie van de reactie met behulp van de drie-stappen-model, werden evenwichtsconstanten reactie van elke reactiestap met of zonder Swi5-Sfr1 berekend. De reactie evenwichtsconstanten aangegeven dat het Swi5-Sfr1-complex niet de eerste reactiestap stimuleert (figuur 4C, paneel een), waarin een intermediair drie fronten wordt gevormd, maar sterk stimuleert de overgang van de C1-C2 ( Figuur 4C, paneel b) en de vrijlating van de ssDNA van de C2-intermediaire (figuur 4C, deelvenster c).

Figure 1
Figuur 1: experimenteel design van DNA strand in paren rangschikken en verplaatsing testen. Schema van DNA strand pairing (A) en (B) verplaatsing testen. Gele cirkels vertegenwoordigen Rad51 monomeren. Groene cirkels met "F" en de rode cirkels met "R" fluoresceïne amidite (FAM) / carboxy-X-rhodamine (ROX), respectievelijk vertegenwoordigen. Black DNA-strengen zijn identiek in volgorde en complementaire DNA-strengen blauw. Dunne zwarte lijnen met pijlpunten wijs de naam van elke oligonucleotide, zoals afgebeeld in tabel 1. Dit percentage is aangepast van Ito et al. 19 en gewijzigd. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: metingen van de maximale FRET efficiëntie van de paring en verplaatsing testen. (A) vergelijking van fluorescentie spectra tussen het substraat ssDNA, 16FA(-), en het product dsDNA, 16FA(-) gecombineerd met 16AR (+) _40bp, van de pairing assay. Blauwe en rode lijnen geven de spectra van de fluorescentie van het substraat zonder en met Rad51, respectievelijk. Groene en paarse lijnen tonen de spectra van de fluorescentie van het eindproduct zonder en met Rad51, respectievelijk. (B) vergelijking van fluorescentie spectra tussen het dsDNA substraat, 16FA (-) _40bp gecombineerd met 16AR (+) _40bp, en ssDNA product, 16FA (-) _40bp, van de bepaling van de verplaatsing. Blauwe en rode lijnen geven de spectra van de fluorescentie van het eindproduct zonder en met Rad51, respectievelijk. Groene en paarse lijnen tonen de spectra van de fluorescentie van het substraat zonder en met Rad51, respectievelijk. Dit percentage is aangepast van Ito et al. 19 en gewijzigd. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: DNA strand in paren rangschikken en verplaatsing reacties gemedieerd door Rad51. (A) tijdsverloop van de genormaliseerde fluorescentie van de pairing reactie met of zonder Rad51. (B) tijdsverloop van de genormaliseerde fluorescentie van de reactie van de verplaatsing met of zonder Rad51. (C) Tijdsverloop van de verandering in de hoeveelheid substraat in de pairing-reactie met Rad51. (D) tijdsverloop van de verandering in de hoeveelheid substraat in de reactie van de verplaatsing met Rad51. (E) A schema van de sequentiële drie-stappen-reactie-model. A en B komen overeen met de presynaptische gloeidraad en donor dsDNA. C1 komt overeen met de eerste (onrijpe) drie fronten intermediair. C2 komt overeen met de tweede (volwassen) drie fronten intermediair. D en E corresponderen met een heteroduplex en ssDNA uitgebracht van C2. (F en G) storingswaarden tussen experimentele gegevens van de bundel van DNA pairing assay en een theoretische curve verkregen door middel van simulatie met behulp van drie-stap (F) of in twee fasen (G) model. (H) rode stippen geven experimentele gegevens uit de reactie van de verplaatsing met Rad51 weergegeven in het deelvenster D. blauwe lijn geeft aan de theoretische curve van de eindproducten. De theoretische curve werd gegenereerd door middel van simulatie met behulp van de reactie snelheidsconstanten de pairing assay weergegeven in het deelvenster Cverkregen. Dit percentage is aangepast van Ito et al. 19 en gewijzigd. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: Swi5-Sfr1 stimuleert de tweede en derde stappen van het DNA strand uitwisseling reactie. (A) tijdsverloop van de verandering in de hoeveelheid substraat in de pairing-reactie met of zonder Swi5-Sfr1 (S5S1). (B) storingswaarden tussen experimentele gegevens van de DNA-streng koppeling assay met Swi5-Sfr1 en een theoretische curve verkregen door simulatie met behulp van het in twee stappen (blauwe lijn) of drie-stap (rode lijn) model. (C) de koppeling reactie weergegeven in figuur 4A werd gesimuleerd door het model van de drie-stappen met behulp van de analyse programma23 (Zie Tabel van materialen). De reactie evenwichtsconstanten van elke reactiestap, K1 (een), (b) K2 en K3 (c), zijn verkregen van de simulatie. Dit percentage is aangepast van Ito et al. 19 en gewijzigd. Klik hier voor een grotere versie van dit cijfer.

Oligonucleotides voor DNA strand pairing assay
16FA(-) 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACA
AAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 '
16A (-) _40bp 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3'
Oligonucleotides voor DNA strand displacement assay
16A(-) 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATA
AGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 '
16FA (-) _40bp 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3'

Tabel 1: een lijst van oligonucleotides gebruikt in het DNA strand in paren rangschikken en verplaatsing testen. In voorkomend geval, de standpunten van fluorophores (fluoresceïne amidite, FAM; carboxy-x-rhodamine, ROX) zijn aangegeven in vierkante haakjes.

Discussion

Hier, hebben wij beschreven een gedetailleerd protocol dat gebruikmaakt van de FRET voor het meten van Rad51 gestuurde DNA strand uitwisseling in real time. Nog belangrijker is, toestaan dat deze metingen voor de bepaling van de reactiekinetiek. Terwijl de beschrijvingen hierboven volstaan om te reproduceren van onze gepubliceerde resultaten, zijn er verschillende kritische punten die in deze sectie worden beschreven. Bovendien, de voordelen en nadelen van FRET gebaseerde methodologieën voor de studie van DNA strand uitwisseling zal worden besproken, samen met de toepassing van dergelijke technieken te bestuderen van andere aspecten van DNA-metabolisme.

Net als bij alle biochemische nabootsing, is het van essentieel belang ervoor te zorgen dat alle reactie substraten van hoge zuiverheid. Het is nalatig op zich te nemen van de afwezigheid van verontreinigende activiteiten uitsluitend gebaseerd op de zichtbare zuiverheid van een eiwit-preparaat beoordeeld door Coomassie kleuring. In het bijzonder de aanwezigheid van sporen van nucleasen of helicasen kan drastisch invloed op de resultaten van de tests in paren rangschikken en verplaatsing. Dus raden we testen voor dergelijke activiteiten telkens die een nieuwe partij van eiwit wordt gezuiverd. Het is bovendien verstandig om de zuiverheid van gesynthetiseerd DNA substraten controleren door inheemse polyacrylamide gelelektroforese. Ondanks veel bedrijven de zuiverheid van oligonucleotides te garanderen, hebben we vaak gevonden door middel van onze eigen testen dat de zuiverheid van het gesynthetiseerd DNA tussen partijen variëren kan.

Het is belangrijk om te overwegen de volgende twee punten bij het uitvoeren van experimenten met quartz cuvettes. Ten eerste, sommige eiwitten zijn gevoelig voor kwarts cuvettes nonspecifically binden. Om dit tegen te, BSA en polyoxyethylenesorbitan Propyleenglycolmonolauraat zijn opgenomen in de reactie buffers. Ten tweede, temperatuur heeft een drastisch effect op de reactie snelheid en fluorescentie-intensiteit. Om dit effect te beperken, moet de kwarts cuvette vooraf bebroede bij 37 ° C vóór gebruik.

Hoewel conventionele biochemische tests enorm nuttig bij het bestuderen van DNA strand uitwisseling geweest, hebben zij verschillende nadelen. In een typische tijdsverloop experiment, worden een reactie bij een bepaalde temperatuur is geïncubeerd en aliquots ingetrokken op gewenste timepoints eiwitvrij gemaakt door behandeling met wasmiddel en protease tot beëindiging van de reactie. Na voltooiing van het tijdsverloop, worden monsters vervolgens onderworpen aan elektroforese te scheiden van DNA substraten van producten. Het grote voordeel van de hier beschreven methode is dat het mogelijk voor het real-time opvolgen van de reactie zonder verstoringen maakt. Elke timepoint tijdens de reactie kan worden gecontroleerd zonder onderbreking van de reactie zelf en er is geen behoefte aan deproteinize van monsters of onderwerpen aan het potentieel ontwrichtende krachten van elektroforese. Dit is vooral relevant bij labiele DNA monitoringsstructuren.

Ondanks deze sterke over conventionele testen heeft de hier beschreven methode enkele nadelen. Hoewel het gebruik van oligonucleotide DNA substraten voor strand uitwisseling interpretatie van de resultaten versimpelt, is het belangrijk om te onthouden dat dergelijke substraten niet doen lijken op de DNA-substraten die betrokken zijn bij HR in de cel. Sommige conventionele testen gebruiken plasmide-sized DNA substraten, die hebben meer kans om na te denken het aantal base-paren die zijn uitgewisseld in vivo. Bovendien kan het gebruik van topologisch beperkte circulaire dsDNA substraten in een subset van conventionele tests op zijn minst gedeeltelijk opnieuw de spanningen in de fysiologische DNA.

De toepassing van de hier beschreven methode is begonnen met het ontrafelen van de moleculaire mechanismen van Rad51 gestuurde DNA strand uitwisseling. Toch zijn er veel interessante vragen die nog moeten worden beantwoord. Er is duidelijk bewijs dat HR tijdens meiose zowel Rad51 als Dmc1, de meiose-specifieke RecA-type recombinase in eukaryoten24 vereist. Echter is het gebrek aan belangrijke biochemische verschillen tussen deze twee recombinases verbijsterd onderzoekers in het veld jaar. Bovendien is de rol van talrijke verschillende groepen van recombinatie accessoire factoren een focale onderwerp van onderzoek op het gebied van HR. Naast het ophelderen van de biochemische verschillen tussen Rad51 en Dmc1, wij streven ernaar om te onderzoeken en vergelijken van de effecten van verschillende recombinatie accessoire factoren op de kinetiek van DNA strand uitwisseling in de nabije toekomst. Tenslotte is het belangrijk te benadrukken dat de FRET gebaseerde methodiek die hier beschreven niet beperkt tot de studie van DNA strand uitwisseling is. Wij voorzien met relatief kleine aanpassingen, vele soorten van toepassingen voor deze techniek bij het onderzoeken van functioneel divers eiwitten die betrokken zijn in26,27,28, DNA metabolisme25,. Wij hopen dat de hier beschreven ontwikkelingen biedt verder mogelijkheden voor onderzoekers die behoren tot de vele verschillende disciplines.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd gefinancierd door Grants-in-Aid voor wetenschappelijk onderzoek (A) (18H 03985) en op innovatieve gebieden (15H 05974) HI, voor jonge wetenschappers (B) (17K 15061) aan BA, en voor wetenschappelijk onderzoek (B) (18H 02371) aan HT van de Society van Japan voor de promotie van wetenschap ( JSPS).

Materials

Name Company Catalog Number Comments
0.2 x 1.0 cm quartz cuvette Hellma Analytics 105-250-15-40
1.0 x 1.0 cm quartz cuvette Hellma Analytics 101-10-40
adenosine triphosphate (ATP) Sigma A2383
DynaFit BioKin, Ldt. DynaFit is a program to analyze kinetics of biochemical reactions.
Fluorescent labeled and non-labeled oligonucleotides Eurofins Genomics The sequences of oligos are listed in Table. 1.
Magnetic stirrer Aisis (Japan) CM1609
PCR machine TAKARA (Japan) TP600 TAKARA PCR Thermal Cycler Dice
Spectrofluorometer JASCO FP8300 Contains a peltier temperature controller and magnetic stirrer system
Syringe HAMILTON 1702RN 25ul SYR (22s/2"/2)

DOWNLOAD MATERIALS LIST

References

  1. Camerini-Otero, R. D., Hsieh, P. Homologous recombination proteins in prokaryotes and eukaryotes. Annual Review of Genetics. 29, (1), 509-552 (1995).
  2. Cromie, G. A., Connelly, J. C., Leach, D. R. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Molecular Cell. 8, (6), 1163-1174 (2001).
  3. Pierce, A. J., et al. Double-strand breaks and tumorigenesis. Trends in cell biology. 11, (11), S52-S59 (2001).
  4. Haber, J. E. Genome Stability. Garland Science. (2013).
  5. Kowalczykowski, S. C. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. Cold Spring Harbor perspectives in biology. 7, (11), a016410 (2015).
  6. Bianco, P. R., Tracy, R. B., Kowalczykowski, S. C. DNA strand exchange proteins: a biochemical and physical comparison. Frontiers in bioscience: a journal and virtual library. 3, D570-D603 (1998).
  7. Renkawitz, J., Lademann, C. A., Jentsch, S. Mechanisms and principles of homology search during recombination. Nature Reviews Molecular Cell Biology. 15, (6), 369-383 (2014).
  8. Greene, E. C. DNA Sequence Alignment during Homologous Recombination. The Journal of biological chemistry. 291, (22), 11572-11580 (2016).
  9. Sung, P., Krejci, L., Van Komen, S., Sehorn, M. G. Rad51 recombinase and recombination mediators. Journal of Biological Chemistry. 278, (44), 42729-42732 (2003).
  10. Prakash, R., Zhang, Y., Feng, W., Jasin, M. Homologous recombination and human health: the roles of BRCA1, BRCA2, and associated proteins. Cold Spring Harbor perspectives in biology. 7, (4), a016600 (2015).
  11. Sung, P. Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. Journal of Biological Chemistry. 272, (45), 28194-28197 (1997).
  12. Sung, P. Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes & Development. 11, (9), 1111-1121 (1997).
  13. Kurokawa, Y., Murayama, Y., Haruta-Takahashi, N., Urabe, I., Iwasaki, H. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators. PLoS biology. 6, (4), e88 (2008).
  14. Jensen, R. B., Carreira, A., Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature. 467, (7316), 678-683 (2010).
  15. Liu, J., et al. Rad51 paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation. Nature. 479, (7372), 245-248 (2011).
  16. Lu, C. -H., et al. Swi5-Sfr1 stimulates Rad51 recombinase filament assembly by modulating Rad51 dissociation. Proceedings of the National Academy of Sciences of the United States of America. (2018).
  17. Bazemore, L. R., Takahashi, M., Radding, C. M. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. Journal of Biological Chemistry. 272, (23), 14672-14682 (1997).
  18. Gupta, R. C., Bazemore, L. R., Golub, E. I., Radding, C. M. Activities of human recombination protein Rad51. Proceedings of the National Academy of Sciences. 94, (2), 463-468 (1997).
  19. Ito, K., Murayama, Y., Takahashi, M., Iwasaki, H. Two three-strand intermediates are processed during Rad51-driven DNA strand exchange. Nature Structural & Molecular Biology. 25, (1), 29-36 (2018).
  20. Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H., Iwasaki, H. Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proceedings of the National Academy of Sciences. 100, (26), 15770-15775 (2003).
  21. Haruta, N., et al. The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-mediated DNA strand exchange in vitro. Nature Structural & Molecular Biology. 13, (9), 823-830 (2006).
  22. Argunhan, B., Murayama, Y., Iwasaki, H. The differentiated and conserved roles of Swi5-Sfr1 in homologous recombination. FEBS Letters. 591, (14), 2035-2047 (2017).
  23. Kuzmic, P. Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase. Analytical biochemistry. 237, (2), 260-273 (1996).
  24. Brown, M. S., Bishop, D. K. DNA strand exchange and RecA homologs in meiosis. Cold Spring Harbor perspectives in biology. 7, (1), a016659 (2014).
  25. Rudert, W. A., et al. Double-labeled fluorescent probes for 5' nuclease assays: purification and performance evaluation. BioTechniques. 22, (6), 1140-1145 (1997).
  26. Xiao, J., Singleton, S. F. Elucidating a key intermediate in homologous DNA strand exchange: structural characterization of the RecA-triple-stranded DNA complex using fluorescence resonance energy transfer. Journal of Molecular Biology. 320, (3), 529-558 (2002).
  27. Grimme, J. M., et al. Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes. Nucleic Acids Research. 38, (9), 2917-2930 (2010).
  28. Algasaier, S. I., et al. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction. The Journal of biological chemistry. 291, (15), 8258-8268 (2016).
Real-time opvolgen van de DNA Strand Exchange reactie gemedieerd door Rad51
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).More

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter