Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Echtzeit-Beobachtung der DNA-Strang Exchange Reaktion vermittelt durch Rad51

Published: February 13, 2019 doi: 10.3791/59073

Summary

Fluoreszenz Resonanz Energie Transfer-basierte Echtzeit-Beobachtung, dass Systeme der DNA Strang Austausch Reaktion vermittelt durch Rad51 wurden entwickelt. Mithilfe der hier vorgestellten Protokolle, sind wir in der Lage, die Bildung von Zwischenprodukten Reaktion und ihre Umsetzung in Produkte, bei der Analyse auch die enzymatischen Kinetics der Reaktion zu erkennen.

Abstract

Die DNA-Strang Austausch Reaktion vermittelt durch Rad51 ist ein entscheidender Schritt der homologen Rekombination. In dieser Reaktion Rad51 bildet ein Nucleoprotein Filament auf einzelsträngiger DNA (SsDNA) und fängt doppelsträngige DNA (DsDNA) unspezifisch, um es für eine homologe Sequenz zu befragen. Nach der Begegnung mit Homologie, katalysiert Rad51 DNA-Strang Austausch, Paarung von der SsDNA mit der komplementäre Strang der DsDNA zu vermitteln. Diese Reaktion ist stark durch zahlreiche accessary Proteine in Vivoreguliert. Obwohl konventionelle biochemische Tests erfolgreich eingesetzt worden, haben um die Rolle der solches Zubehör Protein in Vitrountersuchen, kinetische Analyse der mittleren Bildung und ihr Fortschreiten in ein Endprodukt erweist Herausforderung aufgrund der instabil und vorübergehender Natur der Reaktion Zwischenprodukte. Diese Reaktionsschritte direkt in Lösung, Fluoreszenz Resonanz Energietransfer (FRET) zu beobachten-basierte Echtzeit-Beobachtung Systeme dieser Reaktion wurden gegründet. Kinetische Analyse des Echtzeit-Beobachtung zeigt, dass die DNA-Strang Austausch Reaktion von Rad51 vermittelt ein dreistufiges Reaktionsmodell mit der Bildung eines drei-Strang DNA-Mittelstufe, Reifung der dieses Zwischenprodukt und die Freisetzung von SsDNA vom gehorcht die Reife Mittelstufe. Der Swi5-Sfr1-Komplex, ein accessary Protein konserviert in den Eukaryotes, fördert stark die zweite und dritte Schritt dieser Reaktion. Die Bund-basierte Assays, die hier vorgestellten ermöglichen uns aufzudecken die molekularen Mechanismen, durch die Rekombination accessary Proteine der DNA-Strang Austausch von Rad51 der Konjunktur. Das primäre Ziel dieses Protokolls ist es, das Repertoire an Techniken zur Verfügung, um Forscher auf dem Gebiet der homologen Rekombination, besonders diejenigen, die mit Proteinen von anderen Arten als Schizosaccharomyces Pombe, erhöhen damit die evolutionäre Erhaltung der enthaltenen Feststellungen kann ermittelt werden.

Introduction

Homologe Rekombination (HR) erleichtert das Schlurfen der genetischen Informationen zwischen zwei verschiedene DNA-Moleküle. HR ist essentiell für zwei grundlegende biologische Phänomene: die Generation der genetischen Vielfalt während der Gametogenese1 und die Reparatur von DNA-Doppel-Strang (DSB)2 bricht während der Mitose. DSB sind die schwerste Form von DNA-Schäden und eine Bruch in das Chromosom. Fehlerhafte Reparatur von DSB kann dazu führen, dass umfangreiche chromosomale Rearrangements und genomische Instabilität, die welche beide Krebs3zeichnen.

Die DNA-Strang Austausch Reaktion ist die zentrale Phase der HR. Das Rad51 Protein, das die hoch konservierte RecA-Schriftfamilie von Rekombinasen angehört, ist das zentrale Protein, das diese Reaktion in Eukaryoten4,5katalysiert. In dieser Reaktion Rad51 bindet an einzelsträngiger DNA (SsDNA) durch Nucleolytic Verarbeitung von DSB Ende erzeugt und Formen eine spiralförmige Nucleoprotein Komplex bezeichnet die präsynaptischen Filament. Dieser Faden fängt intakt doppelsträngige DNA (DsDNA) nonspecifically, für eine homologe Sequenz zu suchen. Wenn der Glühfaden eine homologe Sequenz findet, eine Reaktion Mittelstufe mit drei-Stranded DNA gebildet und das Rad51 Filament vermittelt Strang Austausch innerhalb dieser Struktur6,7,8. Um diese Reaktion effizient zu erreichen, erfordert Rad51 mehrere Arten von Zubehör Proteine wie BRCA1 und BRCA2, Produkte von Brust Krebs Anfälligkeit Gene9,10.

Verständnis, wie Zubehör Faktoren Rad51 regulieren, ist ein wesentlicher Schritt bei der Aufdeckung der Ursachen von genomische Instabilität während der Tumorgenese. Obwohl ein Großteil der Forschung mit den Auswirkungen dieser Faktoren auf präsynaptischen Fadenbildung und Stabilität11,12,13,14,15,16, geht die Beitrag dieser Faktoren zur Bildung der drei-Punkte-Programm-zwischen- und seine Verarbeitung zum Endprodukt ist noch unklar. Diese Reaktionsschritte durch konventionelle biochemische Experimente zu beobachten ist sehr schwierig, denn die drei-Punkte-Programm Zwischenprodukt ist instabil und neigen zu reduzieren durch gemeinsame experimentelle Manipulationen wie Proteinfällung Proben oder Elektrophorese.

Um dieses Problem zu überwinden, wir haben zwei Beobachtungssysteme der zuvor entwickelten Echtzeit-der DNA-Strang Austausch Reaktion mit Fluoreszenz Resonanz Energietransfer (FRET) angepasst: die DNA-Strang Paarung und DNA-Strang Verschiebung Assays17, 18 (Abbildung 1). In der DNA-Strang Paarung Assay, Rad51 Formen einer präsynaptischen Filament mit Fluorescein wird Amidite (FAM) - mit der Bezeichnung SsDNA und dann homologe Carboxy-X-Rhodamin (ROX) - mit der Bezeichnung DsDNA hinzugefügt, die Strangreaktion Austausch initiieren. Wenn der Faden die ROX-Label DsDNA fängt und die drei-Punkte-Programm-Mittelstufe bildet, zwei Fluorophore kommen in der Nähe und Fluoreszenzemission von FAM wird abgeschreckt von ROX (Abbildung 1A). In der DNA-Strang Verschiebung Assay wird eine präsynaptischen Filament am unbeschrifteten SsDNA gebildet mit FAM und ROX Doppel beschriftet DsDNA inkubiert. Wenn Strang Austausch abgeschlossen ist und die FAM SsDNA gekennzeichnet ist von der drei-Punkte-Programm veröffentlicht zwischen-, die Emission von FAM erhöht weil FAM nicht mehr in unmittelbarer Nähe zum ROX (Abbildung 1 b). Diese Tests ermöglichen es uns, die Bildung von drei-Punkte-Programm Zwischenprodukte und deren Verarbeitung in Endprodukte in beobachten ohne Störungen mit der Reaktion in Echtzeit.

Mit diesem Beobachtungssystem Echtzeit-, fanden wir, dass die DNA-Strang Austausch von Rad51 vermittelt in drei Stufen einschließlich der Bildung der ersten Reaktion Mittelstufe (C1), Übergang der ersten Zwischenprodukt in einer zweiten Zwischenprodukt Reaktion (C2) und Freisetzung von SsDNA aus C219. Wir fanden auch, dass Spalthefe (S. Pombe) Swi5-Sfr1, die eine evolutionär konservierte Rad51 Zubehör Protein Komplex13,16,20,21,22, stimuliert die C1-C2 Übergang und Freisetzung von SsDNA aus C2 in einer Weise, die ATP-Hydrolyse von Rad5119abhängt.

Es bleibt unbekannt, ob diese Erkenntnisse evolutionär konserviert sind. Dieses Protokoll ist vorgesehen, mit der Hoffnung, dass Forscher auf dem Gebiet der HR, vor allem diejenigen, die Proteine aus anderen Organismen als S. Pombe, arbeiten diese Techniken um festzustellen, inwieweit die anfallen können der molekulare Mechanismus der Rad51 getrieben Strang Austausch wird geschont. Darüber hinaus haben diese Techniken bei der Bestimmung der Rolle von S. Pombe Swi5-Sfr1 sehr bewährt. So ist es eine rationale Vorhersage, dass diese Techniken bei der Aufdeckung der präzise Rollen anderer HR Zubehör Faktoren von unschätzbarem Wert sein werden.

Protocol

1. Vorbereitung von Proteinen und DNA-Substrate

  1. Reinigen Sie S. Pombe Rad51 und Swi5-Sfr1 Proteine zur Homogenität (beurteilt von Coomassie-Färbung), wie bereits berichtet13,21.
  2. Bereiten Sie Oligonukleotid DNA-Substrate in Tabelle 118aufgeführt.
    Hinweis: Die Oligonukleotide wurden gekauft (siehe Tabelle der Materialien) und in der HPLC Besoldungsgruppe synthetisiert. Für den DNA-Strang Paarung Reaktion, Oligonukleotide 16FA(-), 16A (-) _40bp und 16AR (+) _40bp sind erforderlich. Für die DNA-Verschiebung-Assay, Oligonukleotide 16A(-), 16FA (-) _40bp und 16AR (+) _40bp sind erforderlich (Abbildung 1 und Tabelle 1). Alle DNA-Konzentrationen in diesem Protokoll finden Sie unter Konzentrationen im Gegensatz zu Nukleotid-Konzentrationen zu fragmentieren.
  3. Um Spender DsDNA bilden, äquimolaren Mengen an komplementäre Stränge in einem dünnwandigen PCR-Röhrchen mit Glühen-Puffer (10 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2) mischen, gewährleisten ein Volumen von insgesamt mehr als 20 µL. führen Sie diese Mischung auf einem prechilled Metallgestell auf Eis (zwischen 2 ° C und 4 ° C).
    Hinweis: Die Kombination von Oligonukleotiden zum pairing Test sind 16A (-) _40bp und 16AR (+) _40bp. Für die Verschiebung-Assay, Tempern Oligonukleotide 16FA (-) _40bp und 16AR (+) _40bp.
  4. Das Glühen Gemisch bei 90 ° C für 5 min erhitzen und abkühlen über 3 h bis 30 ° C mit einer PCR-Maschine. Speichern der geglühten DNS bei-20 ° C.

(2) DNA-Strang Paarung und Verdrängung Assays

  1. Durchführen Sie DNA-Strang Paarung Test.
    1. Bereiten Sie 1,6 mL Reaktion Puffer A (30 mM HEPES-KOH pH 7,5, 1 mM Dithiothreitol [DVB], 15 mM MgCl20,25 mM ATP, Rinderserumalbumin [BSA] 0,1 mg/mL und 0,0075 % Polyoxyethylenesorbitan Monolaurate) mit 36 nM 16FA(-) in einer 2,0 mL Mikro-Zentrifuge Kunststoffrohr (Polypropylen) und inkubieren Sie es vorab bei 37 ° C für 5 Minuten.
    2. Um Rad51 SsDNA Filamente zu bilden, eine Endkonzentration von 1,5 µM im Voraus inkubierten Reaktion Puffer Rad51 Protein hinzu und bei 37 ° C für 5 min inkubieren.
    3. Die Mischung auf eine Endkonzentration von 0,15 µM Swi5-Sfr1 Eiweiß hinzufügen und bei 37 ° C für weitere 5 min inkubieren.
    4. 1,5 mL des Gemisches und transfer in ein 1,0 x 1,0 cm-Quarz-Küvette mit einem Magnetrührer und stellen die Küvette in einem Spectrofluorometer. Konfigurieren des peltier Temperaturreglers des Spektralphotometers auf 37 ° C und den Magnetrührer bis 450 u/min zu gewährleisten schnelle Vermischung der injizierten Probe.
    5. Starten der Messung der Fluoreszenzemission von FAM bei 525 nm (Bandbreite: 20 nm) bei Erregung auf 493 nm (Bandbreite: 1 nm). Sammeln von Daten pro Sekunde.
    6. Nach dem Start der Messung für 100 s, injizieren ROX-Label Spender DsDNA, eine Endkonzentration von 36 nM in der Mischung mit einer Spritze und messen die Änderung in Emission bei 1 s-Intervallen für weitere 30 min.
  2. Durchführen Sie DNA-Strang Verschiebung Test.
    1. Bereiten Sie 1,6 mL Reaktion Puffer A mit 36 nM 16A(-) in einem Mikro-Zentrifuge Kunststoff-2,0 mL tube und es vorab bei 37 ° C für 5 min inkubieren.
    2. Rad51 SsDNA Filamente in Gegenwart von Swi5-Sfr1 bei 37 ° C zu bilden, wie 2.1.2 beschrieben. und 2.1.3.
    3. Nehmen Sie 1,5 mL der Mischung und in die Quarz-Küvetten mit einem Magnetrührer übertragen Sie und Spektralphotometer, eingelassen Sie die Küvette, wie in Schritt 2.1.4 beschrieben.
    4. Messung der Fluoreszenzemission beginnen und nach 100 s, FAM und ROX beschriftet Spender DsDNA zu injizieren, wie in Schritt 2.1.6 beschrieben. Die Veränderung der Fluoreszenzemission in 1 s-Intervallen für weitere 30 min zu messen.

3. Analyse experimentellere Daten aus der Paarung und Verdrängung Assays

  1. Schätzen Sie maximale FRET-Effizienz.
    1. Bereiten Sie 16FA(-) mit 16AR geglüht (+) _40bp und 16FA (-) _40bp mit 16AR geglüht (+) _40bp mit dem gleichen Verfahren beschriebenen Schritte 1.3 und 1.4.
    2. Bereiten Sie 130 μL der Reaktion Puffer A mit 36 nM entweder 16FA(-), 16FA(-) mit 16AR geglüht (+) _40bp, 16FA (-) _40bp mit 16AR geglüht (+) _40bp oder 16FA (-) _40bp in einem 0,2 x 1,0 cm-Quarz-Küvette.
    3. Die Küvette in die Spectrofluorometer gesetzt und bei 37 ° C für 5 min inkubieren.
    4. Messung der Fluoreszenz-Spektren von 500 bis 600 nm auf Anregung auf 493 nm.
    5. Um die Wirkung von Rad51 auf die Emission von FAM und abschrecken der FAM von ROX zu testen, Rad51, eine Endkonzentration von 1,5 μm zur Mischung hinzufügen und bei 37 ° C für 5 min inkubieren.
    6. Messung der Fluoreszenz-Spektren von 500 bis 600 nm auf Anregung auf 493 nm.
    7. Berechnen Sie die maximale FRET-Effizienz (Emaximale) unter Verwendung der Gleichung beschrieben:
      Emaximale = (Fluoreszenz-Intensität bei 525 nm DsDNA beschriftet mit FAM und ROX) / (Fluoreszenz-Intensität bei 525 nm von FAM beschriftet SsDNA)
  2. Experimentelle Daten aus der Verschiebung Test analysieren.
    1. Die Änderung in Fluoreszenz beobachtet in der Hubraum-Assay, die Veränderung der Endprodukt konvertieren, normalisieren rohe experimentelle Daten aus diesem Test unter Verwendung der Gleichung beschrieben, ist wo Froh Fluoreszenzintensität von Rohdaten und Fnormalisierte ist die Veränderung der Fluoreszenz durch die folgende Gleichung berechnet.
      Fnormalisierte = ([Froh zum Zeitpunkt X]-[Froh zum Zeitpunkt 0]) / (([Froh zum Zeitpunkt 0] / Emaximale)-[Froh zum Zeitpunkt 0])
      Froh zum Zeitpunkt 0 ist die durchschnittliche Fluoreszenz überwacht für die ersten 5 s nach der Totzeit (d. h., der Zeitaufwand für das Mischen nach einem Eindüsungsluft in die Küvette eingeführt wird).
    2. Um die Auswirkungen von Immunofluoreszenz und spontane Verdrängung auszuschließen, subtrahieren Sie Fnormalisierte ohne Protein aus Fnormalisierte der Probe FD, zu erhalten, ist die Veränderung der Endprodukt in diesem Test.
      FD = [Fnormalisierte Probe] - [Fnormalisierte ohne Protein]
  3. Experimentelle Daten aus der Paarung Test analysieren.
    1. Normalisieren, rohe experimentelle Daten aus der Paarung Test unter Verwendung der Gleichung beschrieben, wo Froh Fluoreszenzintensität von Rohdaten und Fnormalisierte ist die Veränderung der Fluoreszenz durch die folgende Gleichung berechnet.
      Fnormalisierte = (Froh zum Zeitpunkt X) / (Froh zum Zeitpunkt 0)
      Froh zum Zeitpunkt 0 ist die durchschnittliche Fluoreszenz überwacht für die letzten 20 s vor der Einleitung der Reaktions durch die Injektion der DsDNA-Substrat.
    2. Um konvertieren Änderung Fluoreszenz Wandels in Substratmenge und die Auswirkungen der Immunofluoreszenz und spontane Paarung ausschließen, normalisieren Fnormalisierte Probe unter Verwendung der Gleichung beschrieben, wo FP ist die Änderung der Höhe der Substrat in diesem Test.
      FP = 1 - (([Fnormalisiert , ohne Protein] - [Fnormalisierte Probe]) / [1-Emaximale])
    3. Um die Reaktionskinetik der DNA-Strang Austausch zu untersuchen, führen eine nichtlineare Last-Quadrat Regressionsanalyse der Paarung Reaktion mit der Analyse Programm23 (siehe Tabelle der Materialien).
      1. Bereiten Sie eine Datei im txt-Format mit Zeit Kursdaten des F-P.
      2. Starten Sie das Programm und fügen Sie das Skript in der Zusätzliche Code-Datei in ein Fenster des Programms:
      3. Starten Sie nicht-lineare Regressionsanalyse letzten Platz. Die Ergebnisse dieser Analyse werden im selben Fenster angezeigt.

Representative Results

Um den experimentellen Daten aus der Paarung und Vertreibung Assays effektiv zu analysieren, ist es notwendig zu definieren, wie eine Änderung der Fluoreszenzemission von FAM eine Umwandlung der DNA-Substrate in Produkte entspricht. Um dies zu erreichen, muss die relevanten Bereich der Fluoreszenzintensität ermittelt werden. Für das pairing-Assay, der Fluoreszenz-Emission des 16FA(-), das entspricht dem SsDNA Substrat ist im Vergleich mit der Emission von 16FA(-) mit 16AR geglüht (+) _40bp, die Endprodukte der Reaktion (Abbildung 2A) entspricht. Dies entspricht der maximalen FRET-Effizienz und damit die maximale Reduzierung Fluoreszenzintensität würde, die erwartet werden, wenn alle SsDNA Substrat in die DsDNA-Produkt umgewandelt wurde. Für die Verschiebung-Assay, die Emission von 16FA (-) _40bp mit 16AR geglüht (+) _40bp, die das Substrat entspricht, ist im Vergleich mit der Emission von 16FA (-) _40bp, die bis zum fertigen Produkt (Abb. 2 b) entspricht. In diesem Fall vermittelt die maximale Erhöhung der Fluoreszenzintensität von FAM ein Szenario, in dem alle die DsDNA-Substrat in SsDNA Produkt umgewandelt wird. S. Pombe Rad51 beeinflusste nicht Fluoreszenzemission FAM oder abschrecken Effizienz der FAM von ROX in beiden Tests (Abbildung 2). Die maximale FRET-Effizienz sollte mit jeder neuen Zubereitung von Oligonukleotiden erneut gemessen werden, da es die Kennzeichnung Effizienz der Oligonukleotide abhängig ist.

Repräsentative Daten von DNA-Strang Paarung und Vertreibung Reaktionen sind in Abbildung 3dargestellt. Die Auswirkungen der spontanen Reaktionen zwischen Substrat DNAs und Immunofluoreszenz waren klein in beiden Tests die vernachlässigbaren Änderungen gesehen in der Emission von FAM ohne Rad51 im Vergleich zu den wesentlichen Veränderungen gesehen mit Rad51 ergab (Abb. 3A und Abb. 3 b). Basierend auf den Daten, die in Abbildung 3A oder 3 b Abbildunggezeigt, war die Veränderung der Fluoreszenz in die Veränderung der Menge an Substrat (FP) oder Endprodukt (FD), bzw. umgerechnet die Gleichungen beschrieben Schritte 3.2.2 oder 3.3.2 ( Abbildung 3 und Abbildung 3D).

Die Paarung Reaktion wurde simuliert mit einem sequentiellen drei-Stufen Reaktionsmodell, bestehend aus der Bildung der ersten drei-Punkte-Programm fortgeschrittene (C1), Übergang der ersten Zwischenprodukt in der zweiten Zwischenprodukt (C1, C2), und die Freisetzung von SsDNA ab der zweiten Mittelstufe, die beiden Produkte (D + E) zu bilden (Abbildung 3E). Zu testen, ob die Simulation mit einer sequentiellen drei-Stufen-Reaktion Modellanpassung die experimentellen Daten, Residuen zwischen experimentellen Daten von den DNA-Strang Paarung Assay und eine theoretische Kurve durch die Simulation erhalten wurden berechnet (Abbildung 3F). Darüber hinaus wurden die Residuen zwischen die Paarung Reaktion und eine theoretische Kurve erzeugt mit einem sequentiellen zweistufige Reaktionsmodell auch berechnete (Abbildung 3). Die Residuen für die Paarung Reaktion und das zweistufige Modell zeigen eine systematische Abweichung in der frühen Phase, während die Residuen für die Paarung Reaktion und die drei-Stufen-Modell nicht solch eine Abweichung zeigen. Dies bedeutet, dass die drei-Stufen-Modell besser geeignet als das zweistufige Modell zur Simulation der Paarung Reaktion ist.

Um zu testen ob das drei-Stufen-Modell der Verdrängung Reaktion entspricht, die den späten Schritt der DNA-Strang Exchange erkennt, erzielten wir eine theoretische Kurve der Verschiebung Reaktion mit Hilfe der kinetischen Parameter Simulation der Paarung entnommen Reaktion in Abbildung 3 dargestellt und verglichen sie mit den experimentellen Daten der Verschiebung Reaktion in Abbildung 3D (Abbildung 3 H) gezeigt. Die theoretische Kurve passen die experimentellen Daten die Hubraum-Assay. Aus diesen Ergebnissen schließen wir, dass Simulation mit dem drei-Stufen-Modell die DNA-Strang Austausch Reaktion vermittelt durch Rad51 einigermaßen beurteilen.

Repräsentative Daten von den DNA-Strang Paarung Reaktion mit Rad51 und der Swi5-Sfr1-Komplex, ein accessary Protein Rad51, entnehmen Sie bitte Abbildung 4A. Der Swi5-Sfr1-Komplex stimuliert stark die Paarung Aktivität von Rad51. Wie bei fehlender Swi5-Sfr1 gesehen wurde, passen die Paarung Reaktion besser die drei-Stufen-Modell als das zweistufige Modell in Gegenwart von Swi5-Sfr1 (Abbildung 4 b). Durch Simulation der Reaktion mit dem drei-Stufen-Modell wurden Reaktion Gleichgewicht konstanten von jedem Reaktionsschritt mit oder ohne Swi5-Sfr1 berechnet. Die Reaktion Gleichgewicht konstanten angegeben, dass der Swi5-Sfr1-Komplex nicht die ersten Reaktionsschritt anregt (Abbildung 4, Panel eine), in dem ein drei-Punkte-Programm-Zwischenprodukt gebildet, aber stark stimuliert, C1-C2 ( Übergang Abbildung 4, Panel-b) und die Freisetzung von SsDNA aus C2 Mittelstufe (Abbildung 4, Gruppe c).

Figure 1
Abbildung 1: experimentelles Design DNA-Strang Paarung und Vertreibung Assays. Schaltpläne der DNA Strang (A) dargelegt und Verdrängung (B) Proben. Gelbe Kreise repräsentieren Rad51 Monomere. Grüne Kreise mit "F" und rote Kreise, die mit "R" vertreten Fluorescein Amidite (FAM) und Carboxy-X-Rhodamin (ROX), beziehungsweise. Schwarz DNA-Stränge sind identisch in der Reihenfolge und komplementären DNA-Stränge blau. Dünne schwarze Linien mit Pfeilspitzen zeigen Sie auf den Namen des jedes Oligonukleotid, wie in Tabelle 1dargestellt. Diese Zahl wurde angepasst von Ito Et al. 19 und modifiziert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Messung der maximalen FRET-Effizienz von der Paarung und Vertreibung Assays. (A) Vergleich der Fluoreszenz Spektren zwischen SsDNA Substrat, 16FA(-) und die DsDNA-Produkt, 16FA(-) gepaart mit 16AR (+) _40bp, von der Paarung Assay. Blaue und rote Linien repräsentieren die Fluoreszenz-Spektren des Substrats ohne und mit Rad51. Grüne und violette Linien zeigen die Fluoreszenz-Spektren des Endproduktes ohne und mit Rad51, beziehungsweise. (B) Vergleich der Fluoreszenz Spektren zwischen DsDNA-Substrat, 16FA (-) _40bp gepaart mit 16AR (+) _40bp und SsDNA Produkt 16FA (-) _40bp, den Hubraum-Assay. Blaue und rote Linien repräsentieren die Fluoreszenz-Spektren des Endproduktes ohne und mit Rad51. Grüne und violette Linien zeigen die Fluoreszenz-Spektren des Substrats ohne und mit Rad51, beziehungsweise. Diese Zahl ist von Ito Et al. 19 und modifiziert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: DNA-Strang Paarung und Vertreibung Reaktionen vermittelt durch Rad51. (A) zeitlicher Verlauf der normalisierten Fluoreszenz der Paarung Reaktion mit oder ohne Rad51. (B) zeitlicher Verlauf der normalisierten Fluoreszenz der Verschiebung Reaktion mit oder ohne Rad51. (C) Zeitlicher Verlauf der Änderung in der Höhe von Substrat bei der Paarung Reaktion mit Rad51. (D) zeitlicher Verlauf der Änderung in der Höhe von Substrat in den Hubraum-Reaktion mit Rad51. (E) ein Schaltplan des Modells sequentiellen drei-Stufen-Reaktion. A und B entsprechen den präsynaptischen Filament und Spender DsDNA. C1 entspricht der ersten (unreif) drei-Punkte-Programm-Mittelstufe. C2 entspricht der zweiten (Reifen) drei-Punkte-Programm-Mittelstufe. D und E entsprechen einem Heteroduplex und SsDNA C2 befreit. (F und G) Residuen zwischen experimentellen Daten von den DNA-Strang Paarung Assay und eine theoretische Kurve durch Simulation mit den drei Schritten (F) oder in zwei Schritten (G) Modell erhalten. (H) rote Punkte zeigen experimentelle Daten aus der Verdrängung Reaktion mit Rad51 gezeigt im Bedienfeld "D. blaue Linie zeigt die theoretische Kurve der Endprodukte. Die theoretische Kurve wurde durch Simulation mit Hilfe der Reaktion Geschwindigkeitskonstanten gewonnenen Paarung Assays gezeigt im Bedienfeld " C" generiert. Diese Zahl ist von Ito Et al. 19 und modifiziert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Swi5-Sfr1 regt die zweite und dritte Schritte der DNA Strang Austausch Reaktion. (A) zeitlicher Verlauf der Änderung in der Höhe von Substrat bei der Paarung Reaktion mit oder ohne Swi5-Sfr1 (S5S1). (B) Residuen zwischen experimentellen Daten der DNA-Strang Paarung assay mit Swi5-Sfr1 und eine theoretische Kurve durch Simulation mit dem zweistufigen (blaue Linie) oder dreistufige (rote Linie) Modell. (C) die Paarung Reaktion gezeigt in Abbildung 4A wurde durch das drei-Stufen-Modell mit Analyse Programm23 simuliert (siehe Tabelle der Materialien). Die Reaktion Gleichgewicht konstanten von jedem Reaktionsschritt, K1 (ein), K2 (b) und K3 (c), stammen aus der Simulation. Diese Zahl ist von Ito Et al. 19 und modifiziert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Oligonukleotide für DNA-Strang Paarung assay
16FA(-) 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACA
AAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA-3 "
16A (-) _40bp 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3 "
16AR (+) _40bp 5 "- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX]-3"
Oligonukleotide für DNA-Strang Verschiebung assay
16A(-) 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATA
AGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA-3 "
16FA (-) _40bp 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 "- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX]-3"

Tabelle 1: eine Liste von Oligonukleotiden, die in der DNA-Strang Paarung und Vertreibung Assays verwendet. Gegebenenfalls werden die Positionen der Fluorophore (Fluorescein Amidite, FAM; Carboxy-X-Rhodamin, ROX) angegeben, in Klammern Quadrat.

Discussion

Hier haben wir ein detailliertes Protokoll beschrieben, das Bund um Rad51 getrieben DNA Strang Austausch in Echtzeit zu messen verwendet. Wichtig ist, können diese Messungen zur Bestimmung der Reaktionskinetik. Während die oben angegebenen Beschreibungen ausreichen, um unsere veröffentlichten Ergebnisse zu reproduzieren sind, gibt es einige kritische Punkte, die in diesem Abschnitt beschrieben werden. Darüber hinaus werden die vor- und Nachteile von FRET-basierte Methoden zur Untersuchung von DNA-Strang Austausch, zusammen mit der Anwendung solcher Techniken, andere Aspekte des DNA Metabolismus diskutiert werden.

Wie bei allen biochemischen Nachbildungen, ist es wichtig, sicherzustellen, dass alle Reaktion Substrate von hoher Reinheit. Es ist fahrlässig, das Fehlen von kontaminierenden Aktivitäten basiert ausschließlich auf die scheinbare Reinheit einer Protein-Zubereitung von Coomassie-Färbung beurteilt zu übernehmen. Insbesondere kann das Vorhandensein von Spuren von Nukleasen oder Helicases drastische Auswirkungen auf die Ergebnisse von der Paarung und Vertreibung Assays. Daher empfehlen wir dringend, Tests für solche Aktivitäten jedes Mal, wenn eine neue Charge von Protein gereinigt wird. Darüber hinaus ist es ratsam, die Reinheit der synthetisierten DNA-Substrate durch native Polyacrylamid Gelelektrophorese zu überprüfen. Trotz vieler Unternehmen garantiert die Reinheit des Oligonucleotides fanden wir oft durch unsere eigenen Tests, dass die Reinheit der synthetisierten DNA zwischen den einzelnen Chargen variieren kann.

Es ist wichtig, die beiden folgenden Punkte zu berücksichtigen, bei der Durchführung von Experimenten mit Quarz-Küvetten. Erstens sind einige Proteine anfällig für Quarz-Küvetten nonspecifically binden. Um dem entgegenzuwirken, BSA und Polyoxyethylenesorbitan Monolaurate gehören die Reaktion-Puffer. Zweitens hat die Temperatur einen drastischen Effekt auf die Reaktion Geschwindigkeit und Fluoreszenz-Intensität. Um diesen Effekt zu minimieren, sollte die Quarz-Küvette Pre inkubierten bei 37 ° C vor dem Gebrauch.

Obwohl konventionelle biochemische Tests äußerst nützlich bei der Untersuchung der DNA-Strang Austausch gewesen sind, haben sie einige Nachteile. In einem typischen Zeitverlauf Experiment eine Reaktion wird bei einer bestimmten Temperatur inkubiert und Aliquote sind an gewünschten Zeitpunkten zurückgezogen und deproteinized durch Behandlung mit Reinigungsmittel und Protease, die Reaktion zu kündigen. Nach Abschluss des Studiengangs Zeit unterliegen Proben dann Elektrophorese, DNA-Substrate von Produkten zu trennen. Der große Vorteil des hier beschriebenen Verfahrens ist, dass es für die Echtzeit-Beobachtung der Reaktion ohne Störung. Jede Timepoint während der Reaktion kann ohne Unterbrechung die Reaktion selbst kontrolliert werden und es gibt keine Notwendigkeit, deproteinize Proben oder zu den potenziell gefährlichen Kräften der Elektrophorese zu unterwerfen. Dies ist besonders relevant, wenn labile DNA-Strukturen zu überwachen.

Trotz dieser Stärken über konventionellen Assays muss die hier beschriebene Methode einige Nachteile. Die Verwendung von Oligonukleotid DNA-Substrate für Strang Austausch Interpretation der Ergebnisse erleichtert, zwar ist es wichtig zu bedenken, dass solche Substrate nicht DNA-Substrate in der Zelle beteiligt HR ähneln. Einige herkömmliche Tests nutzen Plasmid-Größe DNA-Substrate, die sind eher zu reflektieren, dass die Zahl der Basenpaare, die in Vivoausgetauscht. Darüber hinaus kann die Verwendung von topologisch eingeschränkte zirkuläre DsDNA Substrate in einer Teilmenge von konventionellen Assays zumindest teilweise die Spannungen in der physiologischen DNA neu.

Die Anwendung des hier beschriebenen Verfahrens hat damit begonnen, die molekularen Mechanismen der Rad51 getrieben DNA Strang Austausch zu entwirren. Dennoch gibt es viele interessante Fragen, die noch beantwortet werden. Es gibt eindeutige Beweise, dass HR während der Meiose Rad51 und Dmc1, die Meiose-spezifische RecA-Typ Rekombinase in Eukaryoten24erfordert. Jedoch hat der Mangel an wichtigen biochemischen Unterschiede zwischen diesen beiden Rekombinasen Forscher auf dem Gebiet seit Jahren verblüfft. Darüber hinaus die Rolle der zahlreichen unterschiedlichen Gruppen von Rekombination Zubehör Faktoren wurde ein Schwerpunkt-Thema der Forschung auf dem Gebiet des hohen Vertreters. Neben der Aufklärung die biochemische Unterschiede zwischen Rad51 und Dmc1, wollen wir untersuchen und vergleichen die Auswirkungen der verschiedenen Rekombination Zubehör Faktoren auf die Kinetik der DNA-Strang-Austausch in der unmittelbaren Zukunft. Zu guter Letzt ist es wichtig zu betonen, dass der Bund basierenden Methodik, die hier beschriebenen nicht auf die Untersuchung der DNA-Strang Austausch beschränkt ist. Mit relativ geringfügigen Änderungen stellen wir viele Arten von Anwendungen für diese Technik bei der Untersuchung von funktionell unterschiedlichen Proteinen, die in DNA Metabolismus25,26,27,28. Wir hoffen, dass die hier beschriebenen Entwicklungen weitere Optionen für Forscher aus vielen verschiedenen Disziplinen.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Diese Arbeit wurde von Grants-in-Aid für wissenschaftliche Forschung (A) (18 H 03985) und Innovative Bereiche (15 H 05974), HI, für den wissenschaftlichen Nachwuchs (B) (17 K 15061) BA und für wissenschaftliche Forschung (B) (18 H 02371) HT von der Japan Society for Promotion of Science (finanziert JSPS).

Materials

Name Company Catalog Number Comments
0.2 x 1.0 cm quartz cuvette Hellma Analytics 105-250-15-40
1.0 x 1.0 cm quartz cuvette Hellma Analytics 101-10-40
adenosine triphosphate (ATP) Sigma A2383
DynaFit BioKin, Ldt. DynaFit is a program to analyze kinetics of biochemical reactions.
Fluorescent labeled and non-labeled oligonucleotides Eurofins Genomics The sequences of oligos are listed in Table. 1.
Magnetic stirrer Aisis (Japan) CM1609
PCR machine TAKARA (Japan) TP600 TAKARA PCR Thermal Cycler Dice
Spectrofluorometer JASCO FP8300 Contains a peltier temperature controller and magnetic stirrer system
Syringe HAMILTON 1702RN 25ul SYR (22s/2"/2)

DOWNLOAD MATERIALS LIST

References

  1. Camerini-Otero, R. D., Hsieh, P. Homologous recombination proteins in prokaryotes and eukaryotes. Annual Review of Genetics. 29, (1), 509-552 (1995).
  2. Cromie, G. A., Connelly, J. C., Leach, D. R. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Molecular Cell. 8, (6), 1163-1174 (2001).
  3. Pierce, A. J., et al. Double-strand breaks and tumorigenesis. Trends in cell biology. 11, (11), S52-S59 (2001).
  4. Haber, J. E. Genome Stability. Garland Science. (2013).
  5. Kowalczykowski, S. C. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. Cold Spring Harbor perspectives in biology. 7, (11), a016410 (2015).
  6. Bianco, P. R., Tracy, R. B., Kowalczykowski, S. C. DNA strand exchange proteins: a biochemical and physical comparison. Frontiers in bioscience: a journal and virtual library. 3, D570-D603 (1998).
  7. Renkawitz, J., Lademann, C. A., Jentsch, S. Mechanisms and principles of homology search during recombination. Nature Reviews Molecular Cell Biology. 15, (6), 369-383 (2014).
  8. Greene, E. C. DNA Sequence Alignment during Homologous Recombination. The Journal of biological chemistry. 291, (22), 11572-11580 (2016).
  9. Sung, P., Krejci, L., Van Komen, S., Sehorn, M. G. Rad51 recombinase and recombination mediators. Journal of Biological Chemistry. 278, (44), 42729-42732 (2003).
  10. Prakash, R., Zhang, Y., Feng, W., Jasin, M. Homologous recombination and human health: the roles of BRCA1, BRCA2, and associated proteins. Cold Spring Harbor perspectives in biology. 7, (4), a016600 (2015).
  11. Sung, P. Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. Journal of Biological Chemistry. 272, (45), 28194-28197 (1997).
  12. Sung, P. Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes & Development. 11, (9), 1111-1121 (1997).
  13. Kurokawa, Y., Murayama, Y., Haruta-Takahashi, N., Urabe, I., Iwasaki, H. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators. PLoS biology. 6, (4), e88 (2008).
  14. Jensen, R. B., Carreira, A., Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature. 467, (7316), 678-683 (2010).
  15. Liu, J., et al. Rad51 paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation. Nature. 479, (7372), 245-248 (2011).
  16. Lu, C. -H., et al. Swi5-Sfr1 stimulates Rad51 recombinase filament assembly by modulating Rad51 dissociation. Proceedings of the National Academy of Sciences of the United States of America. (2018).
  17. Bazemore, L. R., Takahashi, M., Radding, C. M. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. Journal of Biological Chemistry. 272, (23), 14672-14682 (1997).
  18. Gupta, R. C., Bazemore, L. R., Golub, E. I., Radding, C. M. Activities of human recombination protein Rad51. Proceedings of the National Academy of Sciences. 94, (2), 463-468 (1997).
  19. Ito, K., Murayama, Y., Takahashi, M., Iwasaki, H. Two three-strand intermediates are processed during Rad51-driven DNA strand exchange. Nature Structural & Molecular Biology. 25, (1), 29-36 (2018).
  20. Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H., Iwasaki, H. Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proceedings of the National Academy of Sciences. 100, (26), 15770-15775 (2003).
  21. Haruta, N., et al. The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-mediated DNA strand exchange in vitro. Nature Structural & Molecular Biology. 13, (9), 823-830 (2006).
  22. Argunhan, B., Murayama, Y., Iwasaki, H. The differentiated and conserved roles of Swi5-Sfr1 in homologous recombination. FEBS Letters. 591, (14), 2035-2047 (2017).
  23. Kuzmic, P. Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase. Analytical biochemistry. 237, (2), 260-273 (1996).
  24. Brown, M. S., Bishop, D. K. DNA strand exchange and RecA homologs in meiosis. Cold Spring Harbor perspectives in biology. 7, (1), a016659 (2014).
  25. Rudert, W. A., et al. Double-labeled fluorescent probes for 5' nuclease assays: purification and performance evaluation. BioTechniques. 22, (6), 1140-1145 (1997).
  26. Xiao, J., Singleton, S. F. Elucidating a key intermediate in homologous DNA strand exchange: structural characterization of the RecA-triple-stranded DNA complex using fluorescence resonance energy transfer. Journal of Molecular Biology. 320, (3), 529-558 (2002).
  27. Grimme, J. M., et al. Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes. Nucleic Acids Research. 38, (9), 2917-2930 (2010).
  28. Algasaier, S. I., et al. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction. The Journal of biological chemistry. 291, (15), 8258-8268 (2016).
Echtzeit-Beobachtung der DNA-Strang Exchange Reaktion vermittelt durch Rad51
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).More

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter