Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

중재 Rad51 DNA 물가 교환 반응의 실시간 관찰

Published: February 13, 2019 doi: 10.3791/59073

Summary

형광 공명 에너지 전송 기반 실시간 관측 시스템 DNA의 물가 교환 반응 Rad51 중재 개발 되었다. 여기에 제시 된 프로토콜을 사용 하 여, 우리 반응 중간체 및 또한 반응의 효소 활동을 분석 하는 동안 제품에 그들의 변환의 형성을 감지할 수 있습니다.

Abstract

중재 Rad51 DNA 물가 교환 반응 동종 재결합의 중요 한 단계입니다. 이 반응에서 Rad51 단일 가닥 DNA (ssDNA)에 nucleoprotein 필 라 멘 트를 형성 하 고 이중 가닥 DNA (dsDNA) 비 특히 동종 시퀀스에 대 한 심문을 캡처합니다. 발생 한 후 homology, Rad51 DNA 가닥 exchange는 dsDNA의 보완 가닥으로는 ssDNA의 페어링 중재를 catalyzes. 이 반응은 매우 수많은 부속품 단백질에 비보에의해 규제 됩니다. 기존의 생 화 확 적인 분석 실험 검사 같은 액세서리 단백질에 생체 외에서의 역할을 성공적으로 고용 되었다는, 비록 중간 형성 및 최종 제품으로의 진행의 운동 분석으로 인해 도전 입증 된 반응 중간체의 불안정 하 고 일시적인 성격입니다. 솔루션, 형광 공명 에너지 전달 (무서 워)에 직접 반응 단계를 관찰 하기 위해-기반 실시간 관찰이이 반응의 설립 했다. 실시간 관측의 운동 분석 결과 중재 Rad51 DNA 물가 교환 반응 중간 3 가닥 DNA의 형성,이 중간의 성숙과에서 ssDNA의 릴리스 3 단계 반응 모델을 따르는 성숙한 중간입니다. Swi5-Sfr1 복잡 한 진핵생물에 보존 하는 부속품 단백질은 강하게이 반응의 두 번째 및 세 번째 단계를 향상 시킵니다. 여기 무서 워 기반 분석 우리는 재결합을 통해 부속품 단백질 Rad51 DNA 가닥 교환 활동을 자극 하는 분자 메커니즘을 밝히기 위해서 사용 합니다. 이 프로토콜의 기본 목표 단백질 Schizosaccharomyces pombe, 다른 종에서 작동 하는 특히 그들 동종 재결합의 분야에서 연구에 사용할 수 있는 기술의 레 퍼 토리를 강화 하는 것입니다 그래서 그는 여기에 소개 하는 발견의 진화 보존 결정 될 수 있다.

Introduction

동종 재결합 (HR)는 두 개의 다른 DNA 분자 사이 유전 정보의 더미를 촉진 한다. 인사는 두 가지 근본적인 생물학 현상에 대 한 필수: gametogenesis1 중 유전적 다양성의 생성 및 DNA 이중 가닥의 수리 (DSBs)2 유사 분열 동안 휴식. DSBs는 DNA 손상의 가장 심각한 형태 이며, 염색체에 파손을 구성. 잘못 된 수리 DSBs의 광범위 한 염색체 재배열 및 게놈 불안정성, 하 두 암3의 발생할 수 있습니다.

DNA 물가 교환 반응 시간의 중앙 단계입니다. Recombinases의 높은 보존된 RecA 형 가족의 구성원 인 Rad51 단백질은 진핵생물4,5에서이 반응을 catalyzes 주요 단백질이 이다. 이 반응에서 Rad51 단일 가닥 dna (ssDNA) DSB 끝의 nucleolytic 처리에 의해 생성 한다 형태 복잡 한 나선형 nucleoprotein 나 연 접 필 라 멘 트. 이 필 라 멘이 트 nonspecifically 동종 시퀀스에 대 한 검색을 그대로 이중 가닥 DNA (dsDNA)을 잡는 다. 필 라 멘 동종 시퀀스를 발견, 중간 세 가닥 DNA를 포함 하는 반응 형성 되 고 Rad51 필 라 멘 트가 구조6,,78내 물가 교환 중재. 이 반응을 효율적으로 달성 하기 위해 Rad51 BRCA1 그리고 BRCA2, 유 방 암 감수 성 유전자9,10의 제품 등 액세서리 단백질의 여러 종류를 요구 한다.

이해 어떻게 액세서리 요인 조절 Rad51 genomic 불안정성의 원인을 tumorigenesis 동안 잠복에 필수적인 단계입니다. 많은 연구에 연 접 필 라 멘 트 형성과 안정성11,12,13,,1415,16을 이러한 요인의 효과 함께 염려는 3 가닥 중간 및 최종 제품에 그것의 처리의 형성에 이러한 요인의 기여는 여전히 명확 하지 않다. 3 가닥 중급은 불안정 하 고 샘플의 deproteinization 등 일반적인 실험 조작에 의해 붕괴 하는 경향이 있기 때문에 기존의 생화학 실험을 통해 이러한 반응 단계를 관찰 하는 것은 매우 어려운 또는 전기 이동 법입니다.

이 문제를 해결 하려면 우리는 형광 공명 에너지 전달 (무서 워)를 사용 하 여 DNA 물가 교환 반응의 2 개의 이전 개발 된 실시간 관측 시스템 적응: DNA와 DNA 가닥 페어링 변위 분석17, 물가 18 (그림 1). 페어링 분석 결과, Rad51 형태 fluorescein와 연 접 필 라 멘 트 DNA 가닥에 amidite (FAM)-표시 된 ssDNA 다음 동종 카-x-rhodamine (ROX)-dsDNA 표시 시작 물가 교환 반응에 추가 됩니다. 필 라 멘 트를 이용한 표시 dsDNA를 잡는 다 고 3 가닥 중간을 형성, 두 fluorophores에 가까이 서 식구 들의 형광 방출 (그림 1A)를 이용한 침묵 이다. DNA 가닥 변위 분석 결과에서 연 접 필 라 멘 트에 레이블이 ssDNA 형성 식구 들과를 이용한 이중 표시 dsDNA와 incubated. 때 물가 교환 완료 ssDNA를 표시 하는 팸은 3 가닥에서 중간, 식구 들의 방출 식구 들 (그림 1B)를 이용한 근접에 더 이상 있기 때문에. 이 분석 실험 관찰 3 가닥 중간체 및 최종 제품에 그들의 처리의 형성 수 있도록 실시간 반응에 어떤 방해 없이.

우리 중재 Rad51 DNA 물가 교환 반응 3-단계 첫 번째 반응 중간 (C1)의 형성을 포함 하 여, 두 번째 중간에 첫 번째 중간의 전환 진행 발견이 실시간 관측 시스템을 사용 하 여, (C2), C219ssDNA의 릴리스. 우리는 또한 그 분열 효 모 (S. pombe) 발견 Swi5-Sfr1,이는 진화론 보존된 Rad51 액세서리 단백질 복잡 한13,16,20,,2122, 자극 C1-C2 전환 및 Rad5119ATP 가수분해에 의존 하는 방식으로 c 2에서 ssDNA의 릴리스.

이러한 결과 진화론 보전 된 여부 알 수 없는 남아 있습니다. 이 프로토콜은 희망 시간, S. pombe, 다른 유기 체에서 단백질으로 작동 하는 특히 그들의 분야에서 연구자는 범위를 결정 하는 이러한 기술을 적용 될 수 있습니다 함께 제공 됩니다 Rad51 구동의 분자 메커니즘 스트랜드 exchange이 보존 하 고 있다. 또한, 이러한 기술을 결정 하는 S. pombe Swi5-Sfr1의 역할에 매우 성공적인 입증 했다. 따라서, 합리적인 예측 이러한 기술을 다른 HR 액세서리 요인의 정확한 역할을 잠복 근무에 귀중 한 것 이다.

Protocol

1입니다. 단백질과 DNA 기판의 준비

  1. 이전에 보고 된13,21로 동질성 (Coomassie 얼룩에 의해 판단), S. pombe Rad51 및 Swi5 Sfr1 단백질 정화.
  2. 표 118에 나열 하는 oligonucleotide DNA 기판 준비.
    참고:는 oligonucleotides 구입 했다 ( 재료의 표참조) HPLC 학년에서 합성. 반응, oligonucleotides 페어링 DNA 가닥에 대 한 16FA(-), 16A (-) _40bp 및 16AR (+) _40bp은 필요. Oligonucleotides DNA 변위 분석 결과 대 한 16A(-), 16FA (-) _40bp 및 16AR (+) _40bp은 필수 (그림 1표 1). 이 프로토콜의 모든 DNA 농도 조각 뉴클레오티드 농도 반대로 농도를 참조 하십시오.
  3. 기증자 dsDNA를, 얇은-벽으로 PCR 튜브에 보완 가닥 아데닌 양의 어 닐 링 버퍼 (10 mM Tris HCl pH 7.5, 100 m m NaCl, 10 m m MgCl2) 혼합, 총 볼륨 이상 20 µ L. 큰 보장에 prechilled 금속 선반에이 혼합 얼음 (2 ° C에서 4 ° C 사이).
    참고: 페어링 분석 결과 대 한 oligonucleotides의 조합은 16A (-) _40bp 및 16AR (+) _40bp. 변위 분석 결과 대 한 anneal oligonucleotides 16FA (-) _40bp 및 16AR (+) _40bp.
  4. 5 분 동안 90 ° C에 어 닐 링 혼합물을가 열 하 고 PCR 기계를 사용 하 여 30 ° c 이상의 3 h 아래로 냉각. -20 ° c.에 단련 된 DNA를 저장

2. DNA 가닥 페어링 및 변위 분석

  1. 분석 결과 페어링 하는 DNA 물가 수행 합니다.
    1. 1.6 mL 반응 버퍼 A의 준비 (30 mM HEPES 코 pH 7.5, 1 m m dithiothreitol [DTT], 15 m m MgCl2, 0.25 mM ATP, 0.1 mg/mL 소 혈 청 알 부 민 [BSA], 그리고 0.0075% polyoxyethylenesorbitan monolaurate) 포함 하는 36 nM 16FA(-) 2.0 mL 마이크로 원심 분리기에 플라스틱 튜브 (폴 리 프로필 렌)와 전 5 분 동안 37 ° C에서 품 어.
    2. SsDNA Rad51 필 라 멘 트를 형성 하기 전 incubated 반응 버퍼에 1.5 µ M의 최종 농도에 Rad51 단백질을 추가 하 고 5 분 동안 37 ° C에서 품 어.
    3. Swi5-Sfr1 단백질 0.15 µ M의 최종 농도에 혼합물에 추가 하 고 추가 5 분 동안 37 ° C에서 품 어.
    4. 혼합물의 1.5 mL를가지고 1.0 x 1.0 cm 석 영 cuvette 포함 하는 자력으로 그것을 전송 하 고는 베트를 spectrofluorometer로 설정. 37 ° C를 분 광 광도 계의 peltier 온도 컨트롤러를 구성 하 고 삽입 된 샘플의 신속한 혼합 되도록 450 rpm는 자력을 설정 합니다.
    5. 525에 식구 들의 형광 방출 측정 시작 nm (대역폭: 20 nm) 493에 여기에 nm (대역폭: 1 nm). 매초 마다 데이터를 수집 합니다.
    6. 100에 대 한 측정을 시작한 후 s, 주사를 이용한 표시 된 기증자 dsDNA 36의 최종 농도에 방출 추가 30 분 1 s 간격에 측정 변화를 주사기를 사용 하 여 혼합에 nM.
  2. DNA 가닥 변위 시험을 수행 합니다.
    1. 1.6 mL 반응 버퍼 A의 준비 36 포함 된 nM 16A(-) 2.0 mL 마이크로 원심 분리기 플라스틱에서 튜브 및 전 5 분 동안 37 ° C에서 그것을 품 어.
    2. 2.1.2 단계에서 설명한 대로 37 ° C에서 Swi5 Sfr1 존재 ssDNA Rad51 필 라 멘 트를 형성 한다. 2.1.3 하 고입니다.
    3. 혼합물의 1.5 mL를가지고 하 고는 자력을 포함 하는 석 영 cuvette에 전송 단계 2.1.4에서에서 설명한 분 광 광도 계에 베트를 설정.
    4. 형광 방출 측정 시작 전후 100 s, 식구 들과를 이용한 표시 된 기증자 dsDNA 2.1.6 단계에서 설명한 대로 주사. 추가 30 분 1 s 간격 형광 방출에 변화를 측정 합니다.

3. 분석 실험 데이터를 페어링 및 변위 분석

  1. 예상 최대 무서 워 효율성.
    1. 16FA(-) 16AR와 단련을 준비 (+) _40bp 및 16FA (-) _40bp 16AR로 단련 된 (+) _40bp 1.3 및 1.4 단계에 설명 된 동일한 절차를 사용 하 여.
    2. 반응 버퍼 A의 130 μ 준비 36를 포함 하 중 16FA(-) nM, 16FA(-) 16AR와 단련 (+) _40bp, 16FA (-) _40bp 16AR로 단련 된 (+) _40bp 또는 16FA 0.2 x 1.0 cm 석 영 cuvette에 (-) _40bp.
    3. spectrofluorometer에는 베트를 설정 하 고 5 분 동안 37 ° C에서 품 어.
    4. 500에서 600으로의 형광 스펙트럼 측정 493에 여기에 nm nm.
    5. 식구 들의 방출에 이용한 FAM의 냉각 Rad51의 효과 테스트 하려면 혼합물에 1.5 μ M의 최종 농도에 Rad51를 추가 하 고 5 분 동안 37 ° C에서 품 어.
    6. 500에서 600으로의 형광 스펙트럼 측정 493에 여기에 nm nm.
    7. 최대의 무서 워 효율 (전자최대) 아래에서 설명 하는 수식을 사용 하 여 계산 합니다.
      E최대 = (525에서 형광 강도 dsDNA 식구 들와를 이용한 표시의 nm) / (525에서 형광 강도 팸의 nm ssDNA 표시)
  2. 변위 분석 결과에서 실험 데이터를 분석 합니다.
    1. 최종 제품의 변화 변위 분석 결과에서 관찰 하는 형광 변화를 변환, 아래에서 설명 하는 수식을 사용 하 여이 분석 결과에서 얻은 원시 실험 데이터를 정상화, F원시 가에서 형광 강도 원시 데이터와 F정규화 는 다음 수식으로 계산 하는 형광의 변화.
      정규화 된 F = ([F원시 시간에서 x]-[F원시 시간 0에]) / (([F원시 시간 0에] / E최대)-[F원시 시간 0에서])
      F원시 시간 0에는 첫 번째 5에 대 한 모니터링 평균 형광 (, 혼합 후에 injectant는 베트에 도입 하는 데 필요한 시간) 죽은 시간 후 s.
    2. Photobleaching 및 자발적인 변위의 영향을 제외 하려면 F정규화 된 F정규화 는이 분석 결과에서 최종 제품의 양을 변화 FD를 샘플에서 단백질 없이 뺍니다.
      FD = [F정규화 된 샘플의]-[F정규화 된 단백질 없이]
  3. 페어링 분석 결과에서 실험 데이터를 분석 합니다.
    1. 아래에서 설명 하는 수식을 사용 하 여 페어링 분석 결과에서 얻은 원시 실험 데이터를 정상화, F원시 는 원시 데이터를정규화 된 F 형광 강도 다음 수식으로 계산 하는 형광의 변화.
      정규화 된 F = (F원시 시간에서 x) / (F원시 시간 0에)
      F원시 시간 0에는 마지막 20에 대 한 모니터링 평균 형광 dsDNA 기판 주입 하 여 반응을 시작 하기 전에 s.
    2. 기판의 금액에서 변경으로 형광에 변화를 변환 photobleaching 및 자발적인 페어링의 효과 제외, F정규화 된 아래에서 설명 하는 방정식을 사용 하 여 샘플의 정상화, 여기서 FP 는 양의 변화 이 분석 결과에 있는 기질
      FP = 1-(([F정규화 단백질 없이]-[F정규화 된 샘플의]) / [1-E최대])
    3. DNA 가닥 exchange의 반응 속도 론을 검사, 분석 프로그램23 를 사용 하 여 연결 반응의 비 선형 마지막 광장 회귀 분석 수행 ( 재료의 표참조).
      1. FP의 시간 코스 데이터를 포함 하는.txt 형식으로 파일을 준비 합니다.
      2. 프로그램을 시작 하 고 프로그램의 창에 보조 코드 파일 에 스크립트를 붙여 넣습니다.
      3. 비-선형 마지막 광장 회귀 분석을 시작 합니다. 이 분석의 결과 같은 창에 표시 됩니다.

Representative Results

페어링 및 변위 분석 실험에서 실험 데이터를 효과적으로 분석 하기 위해 그것은 식구 들의 형광 방출에 변화 제품으로 DNA 기판의 변환에 해당 하는 방법을 정의 하는 데 필요한. 이를 위해, 형광 강도의 관련 범위를 결정 해야 합니다. 페어링 분석 결과 대 한 형광 방출 ssDNA 기판에 대응 하는, 16FA(-)의 16FA(-) 16AR와 단련의 방출 비교 (+)이이 반응 (그림 2A)의 최종 제품에 해당 _40bp. 이것은 최대 효율성을 무서 워 하 고 따라서 형광 강도 최대 감소 하는 것 이라고 예상 모든 ssDNA 기판 dsDNA 제품으로 변환 되었다. 변위 분석 결과, 16FA의 방출에 대 한 (-) _40bp 16AR로 단련 된 (+) 기판에 대응 하는, _40bp 16FA의 방출 비교 최종 제품 (그림 2B)에 해당 하는 (-) _40bp. 이 경우에, 식구 들의 형광 강도 최대 증가 dsDNA 기판의 모든 ssDNA 제품으로 변환 됩니다 있는 시나리오를 전달 합니다. S. pombe Rad51 팸 또는 두 분석 실험 (그림 2)를 이용한 FAM의 효율성 냉각의 형광 방출 영향을 주지 않았다. Oligonucleotides의 라벨 효율성에 최대 무서 워 효율 oligonucleotides의 각 새로운 준비 다시 측정 되어야 합니다.

DNA 가닥 페어링 및 변위 반응의 대표적인 데이터는 그림 3에 나와 있습니다. Rad51 Rad51 함께 본 상당한 변화에 비해 없이 식구 들의 방출에서 본 무시할 수 변화에 의해 공개 기판 DNAs와 photobleaching 사이 자발적인 반응의 효과 두 분석 실험에서 작고 했다 (그림 3A그림 3B)입니다. 그림 3A 또는 그림 3B에 표시 된 데이터를 바탕으로, 형광 변화 했다 변환 기판 (FP) 또는 최종 제품 (FD)의 금액 변경으로 각각 단계 3.2.2 또는 3.3.2 (에서 설명 하는 방정식을 사용 하 여 그림 3C 그리고 그림 3D).

페어링 반응 처음 3 가닥 중급 (C1)의 형성의 구성 된, 두 번째 중간에 첫 번째 중간의 전환 순차적 3 단계 반응 모델을 사용 하 여 시뮬레이션 했다 (C1 C2), 그리고 ssDNA의 출시 (D + E) 두 제품을 형성 하는 두 번째 중간에서 (그림 3E). 여부 시뮬레이션 사용 하 여 연속 3 단계 반응 모델 적합 실험 데이터, 실험 데이터의 분석 결과 이론적인 곡선으로는 시뮬레이션 페어링 DNA 가닥 사이의 오차를 테스트 하려면 (그림 3 층)을 계산 합니다. 또한, 페어링 반응과 순차적 2 단계 반응 모델을 사용 하 여 생성 한 이론적 곡선 사이의 오차 계산된 (그림 3G)도 있었다. 페어링 반응과 단계 모델에 대 한 오차는 페어링 반응 및 3 단계 모델에 대 한 오차는 이러한 편차를 표시 하지 않습니다 반면 초기 단계에서 체계적인 편차를 표시 합니다. 이 3 단계 모델 페어링 반응 시뮬레이션을 위한 2 단계 모델 보다 더 잘 맞는 임을 나타냅니다.

3 단계 모델은 변위 반응은 DNA 가닥 exchange의 후반 단계를 감지 하는 일치 여부를 테스트 하려면 페어링의 시뮬레이션에서 얻은 운동 매개 변수를 사용 하 여 변위 반응의 이론적인 곡선 생성 반응 에서처럼 그림 3C3D 그림 (그림 3 H) 에서처럼 변위 반응의 실험 데이터와 비교. 이론적인 곡선 적합 변위 분석 결과의 실험 데이터. 이러한 결과에서 우리는 3 단계 모델을 사용 하 여 시뮬레이션 중재 Rad51 DNA 물가 교환 반응을 합리적으로 평가할 수는 결론.

페어링 반응 Rad51와 Rad51의 부속품 단백질, Swi5-Sfr1 복합을 포함 하는 DNA 물가의 대표적인 데이터 그림 4A에 표시 됩니다. Swi5-Sfr1 복잡 한 강하게 Rad51의 페어링 활동을 자극. 에서 보듯이 Swi5 Sfr1의 부재, 페어링 반응 Swi5-Sfr1 (그림 4B)의 2 단계 모델 보다 3 단계 모델을 더 적합. 3 단계 모델을 사용 하 여 반응의 시뮬레이션을 통해 각 반응 단계 또는 Swi5 Sfr1 없이 반응 평형 상수 계산 했다. 반응의 평형 상수 Swi5 Sfr1 복잡 한 반응의 첫 번째 단계를 자극 하지 않는 표시 (그림 4C, 패널은)는 3 가닥 중간 형성, 하지만 강력 하 게 자극 C1-C2 ( 전환 그림 4C, 패널 b) C2 중급 (그림 4C, 패널 c)에서 ssDNA의 릴리스.

Figure 1
그림 1: 실험적인 디자인의 DNA 가닥 페어링 및 변위 분석. DNA의 설계도 물가 페어링 (A) 및 변위 (B) 분석 실험. 노란색 동그라미 Rad51 단위체를 나타냅니다. 그린 서클 "F" 포함 하 고 "R"를 포함 된 빨간색 원이 fluorescein amidite (FAM)와 카-X-rhodamine (ROX)를 각각 나타냅니다. 블랙 DNA 물가 시퀀스에 동일한 DNA 가닥을 파랑 보완. 얇은 블랙 라인 화살촉을 표 1에서 같이 각 oligonucleotide의 이름을 가리킵니다. 이 그림은 이토 외. 에서 적응 되었습니다. 19 및 수정. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 페어링 및 변위 분석 실험의 최대 무서 워 효율성의 측정. (A) 형광 스펙트럼 ssDNA 기판, 16FA(-), 사이 dsDNA 제품의 비교, 16FA(-) 16AR와 한 쌍 (+) _40bp, 페어링 분석 결과의. 파란색과 빨간색 라인은 각각 없이 Rad51, 기판의 형광 스펙트럼을 나타냅니다. 녹색과 보라색 라인 각각 없이 Rad51, 최종 제품의 형광 스펙트럼을 보여줍니다. (B) 비교 사이 dsDNA 기판, 16FA 형광 스펙트럼의 (-) _40bp 16AR와 한 쌍 (+) _40bp, 그리고 ssDNA 제품, 16FA 변위 분석 결과의 (-) _40bp. 파란색과 빨간색 라인은 각각 없이 Rad51, 최종 제품의 형광 스펙트럼을 나타냅니다. 녹색과 보라색 라인 각각 없이 Rad51, 기판의 형광 스펙트럼을 보여줍니다. 이 그림은 이토 외. 에서 적응 19 및 수정. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: Rad51 DNA 가닥 페어링 및 변위 반응 중재. (A) 또는 Rad51 없이 페어링 반응의 정규화 된 형광의 시간 과정. (B) 또는 Rad51 없이 변위 반응의 정규화 된 형광의 시간 과정. (C) Rad51와 페어링 반응에서 기판의 변경에의 시간 과정. (D) Rad51와 변위 반응에서 기판의 변경에의 시간 과정. 연속 3 단계 반응 모델의 회로도 (E) A 연 접 필 라 멘 트 및 기증자 dsDNA에 해당 하는 A와 B. C 1은 첫 번째 (미 숙) 3 가닥 중급에 해당합니다. C 2는 두 번째 (성숙) 3 가닥의 중간에 해당합니다. D와 E c 2에서 출시 하는 ssDNA를 heteroduplex에 해당 합니다. (FG) 분석 결과 이론적인 곡선 페어링 DNA 가닥의 실험 데이터 사이의 오차 (F) 3 단계 또는 2 단계 (G) 모델을 사용 하 여 시뮬레이션 하 여 얻은. (H) 빨간 점 Rad51 패널 디 블루에 선 최종 제품의 이론적인 곡선을 나타냅니다 표시와 변위 반응에서 실험 데이터를 나타냅니다. 이론적인 곡선 C패널에 표시 된 페어링 분석 결과에서 얻은 반응 속도 상수를 사용 하 여 시뮬레이션에 의해 생성 되었습니다. 이 그림은 이토 외. 에서 적응 19 및 수정. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: Swi5 Sfr1 자극 두 번째 및 세 번째 단계는 DNA의 물가 교환 반응. (A) 또는 Swi5 Sfr1 (S5S1) 없이 페어링 반응에서 기판의 변화의 시간 코스. Swi5-Sfr1와 분석 결과 (B) DNA 가닥 페어링의 실험 데이터 사이의 오차 그리고 이론적인 곡선 2 (파란 선) 단계 또는 3 단계 (레드 라인) 모델을 사용 하 여 시뮬레이션에 의해. (C) 페어링 반응 4A를 그림 에 표시 된 분석 프로그램23 를 사용 하 여 3 단계 모델에 의해 모의 했다 ( 재료의 표참조). 각 반응 단계, K1의 반응 평형 상수 (a), (b), K2 및 k 3 (c), 시뮬레이션에서 입수 했다. 이 그림은 이토 외. 에서 적응 19 및 수정. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Oligonucleotides DNA 가닥 페어링 분석 결과 대 한
16FA(-) 5'-[팸]-AAATGAACATAAAGTAAATAAGTATAAGGATAATACA
AAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA-3 '
16A (-) _40bp 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '-TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[]-3'
Oligonucleotides DNA 가닥 변위 분석 결과 대 한
16A(-) 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATA
AGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA-3 '
16FA (-) _40bp 5'-[팸]-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '-TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[]-3'

표 1: oligonucleotides DNA 가닥 페어링 및 변위 분석에 사용 되는 목록. (Fluorescein amidite, FAM;를 이용한 카-x-rhodamine) fluorophores의 위치에 표시 됩니다 어디에 적용, 괄호 광장.

Discussion

여기, 우리가 활용 무서 워 Rad51 구동 DNA 가닥 exchange 실시간으로 측정 하는 상세한 프로토콜을 설명 했습니다. 중요 한 것은, 이러한 측정 반응 속도의 결정에 대 한 수 있습니다. 위에 제공 된 설명을 게시 된 결과 재현 하는 충분 한 동안,이 섹션에서 설명 하는 여러 가지 한계점이 있다. 또한, DNA 가닥 exchange 공부에 대 한 무서 워 기반 방법론의 장단점 논의 됩니다, DNA 대사의 다른 측면을 공부 같은 기법에의 응용 프로그램과 함께.

모든 생물 재구성, 것과 같이 모든 반응 기판의 높은 순도 확인은 필수적 이다. 그것은 단백질 준비 Coomassie 얼룩에 의해 심판의 명백한 순수성을 기반으로 하는 오염 활동의 부재를 가정 하는 과실. 특히, nucleases 또는 helicases의 미 량의 존재 페어링 및 변위 분석 실험의 결과 영향을 크게 수 있습니다. 따라서, 우리는 강력 하 게 같은 활동에 대 한 단백질의 새로운 배치 정화 때마다 테스트 하시기 바랍니다. 또한, 그것은 네이티브 polyacrylamide 젤 전기 이동 법에 의해 합성된 DNA 기판의 순도 확인 하입니다. Oligonucleotides의 순도 보장 하는 많은 기업에 불구 하 고 우리는 종종 우리 자신의 합성된 DNA의 순도 배치 사이 다 수 테스트를 통해 발견.

그것은 석 영 큐 벳으로 실험을 실시 하는 경우 다음 두 가지 사항을 고려 하는 것이 중요입니다. 첫째, 어떤 단백질 nonspecifically 석 영 큐 벳을 묶는 경향이 있다. 이 대응 하기 위해 BSA와 polyoxyethylenesorbitan monolaurate 반응 버퍼에 포함 됩니다. 둘째, 온도 반응 속도 형광 강도에 과감 한 영향. 이 효과 최소화 하기 위해 석 영 cuvette 사용 하기 전에 37 ° C에 미리 incubated 이어야 한다.

기존의 생 화 확 적인 분석 실험 DNA 가닥 교환 공부에 매우 유용 되었습니다, 비록 그들은 몇 가지 단점이 있다. 전형적인 시간-과정 실험에서 반응을 특정 온도에서 incubated 하 고 aliquots는 원하는 timepoints에서 철회 되 고 세제와 종료 반응 효소 처리에 의해 deproteinized. 완료 되 면 시간 코스, 샘플 다음 DNA 기판 제품에서 분리 하는 전기를 받게 됩니다. 여기에 설명 된 방법의 주요 이점은 어떤 소요도 없이 반응의 실시간 관찰에 대 한 수 것입니다. 어떤 timepoint 반응 동안 반응 자체를 중단 하지 않고 검사할 수 이며 샘플 deproteinize 또는 전기 이동 법의 잠재적으로 파괴적인 힘에 따라 필요가 없습니다. 이것은 특히 관련 정한 DNA 구조를 모니터링 합니다.

기존의 분석 실험을 통해 이러한 강점에도 불구 하 고 여기 설명 하는 방법을 몇 가지 단점도 있다. 물가 교환 oligonucleotide DNA 기판의 사용 결과의 해석을 단순화, 하는 동안 그것은 같은 기판 셀에서 시간에 관련 된 DNA 기판 유사 하지 않는 기억 하는 것이 중요. 일부 기존의 분석 활용 플라스 미드 크기의 DNA 기판는 기지-쌍을 수 교환 에 비보반영 가능성이 높습니다. 또한, 기존의 분석의 하위 집합에 위상적 제한 된 원형 dsDNA 기판의 사용 수 적어도 부분적으로 생리 적 DNA에 긴장을 다시 만듭니다.

여기 설명 하는 방법 응용 프로그램 구동 Rad51 DNA 가닥 exchange의 분자 메커니즘을 해명 하기 시작 했다. 그럼에도 불구 하 고, 많은 흥미로운 질문 답변에 남아 있다. 감수 분열 동안 시간 Rad51와 Dmc1, 진핵생물24에서 감수 분열-특정 RecA 형 recombinase에서는 명확한 증거가 있다. 그러나, 이러한 두 recombinases 사이 주요 생 화 확 적인 다름의 부족은 당황 하 게 분야에서 연구 년. 또한, 재결합 액세서리 요인의 수많은 다른 그룹의 역할에 HR 분야에 연구의 초점 주제 되었습니다 수 있습니다. Elucidating Rad51 Dmc1의 생 화 학적 차이점, 뿐만 아니라 우리 조사 하 고 가까운 장래에 DNA 가닥 exchange의 활동에 다른 재조합 액세서리 요인의 효과 비교 하고자 합니다. 마지막으로, 그것은 여기에 설명 된 무서 워 기반 방법론의 DNA 가닥 exchange 연구에 국한 되지 않습니다 강조 하는 것이 중요. 상대적으로 작은 수정, 우리는 많은 종류의 기능적으로 다양 한 단백질 DNA 대사25,26,,2728에 관련 된 조사에서이 기술에 대 한 응용 프로그램을 구상. 여기에 설명 된 개발 제공할 것입니다 추가 옵션 많은 다른 분야에 속한 연구 노력 하겠습니다.

Disclosures

저자는 공개 없다.

Acknowledgments

이 작품에 의해 투자 되었다 연구비 과학 연구 (A) (18 H 03985)와 혁신적인 지역 (15 H 05974)에에 젊은 과학자 (B) (17 K 15061) 바, 하 고 대 한 과학 연구 (B) (18 H 02371) ht 과학 진흥 (일본 사회에서 JSP)입니다.

Materials

Name Company Catalog Number Comments
0.2 x 1.0 cm quartz cuvette Hellma Analytics 105-250-15-40
1.0 x 1.0 cm quartz cuvette Hellma Analytics 101-10-40
adenosine triphosphate (ATP) Sigma A2383
DynaFit BioKin, Ldt. DynaFit is a program to analyze kinetics of biochemical reactions.
Fluorescent labeled and non-labeled oligonucleotides Eurofins Genomics The sequences of oligos are listed in Table. 1.
Magnetic stirrer Aisis (Japan) CM1609
PCR machine TAKARA (Japan) TP600 TAKARA PCR Thermal Cycler Dice
Spectrofluorometer JASCO FP8300 Contains a peltier temperature controller and magnetic stirrer system
Syringe HAMILTON 1702RN 25ul SYR (22s/2"/2)

DOWNLOAD MATERIALS LIST

References

  1. Camerini-Otero, R. D., Hsieh, P. Homologous recombination proteins in prokaryotes and eukaryotes. Annual Review of Genetics. 29, (1), 509-552 (1995).
  2. Cromie, G. A., Connelly, J. C., Leach, D. R. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Molecular Cell. 8, (6), 1163-1174 (2001).
  3. Pierce, A. J., et al. Double-strand breaks and tumorigenesis. Trends in cell biology. 11, (11), S52-S59 (2001).
  4. Haber, J. E. Genome Stability. Garland Science. (2013).
  5. Kowalczykowski, S. C. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. Cold Spring Harbor perspectives in biology. 7, (11), a016410 (2015).
  6. Bianco, P. R., Tracy, R. B., Kowalczykowski, S. C. DNA strand exchange proteins: a biochemical and physical comparison. Frontiers in bioscience: a journal and virtual library. 3, D570-D603 (1998).
  7. Renkawitz, J., Lademann, C. A., Jentsch, S. Mechanisms and principles of homology search during recombination. Nature Reviews Molecular Cell Biology. 15, (6), 369-383 (2014).
  8. Greene, E. C. DNA Sequence Alignment during Homologous Recombination. The Journal of biological chemistry. 291, (22), 11572-11580 (2016).
  9. Sung, P., Krejci, L., Van Komen, S., Sehorn, M. G. Rad51 recombinase and recombination mediators. Journal of Biological Chemistry. 278, (44), 42729-42732 (2003).
  10. Prakash, R., Zhang, Y., Feng, W., Jasin, M. Homologous recombination and human health: the roles of BRCA1, BRCA2, and associated proteins. Cold Spring Harbor perspectives in biology. 7, (4), a016600 (2015).
  11. Sung, P. Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. Journal of Biological Chemistry. 272, (45), 28194-28197 (1997).
  12. Sung, P. Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes & Development. 11, (9), 1111-1121 (1997).
  13. Kurokawa, Y., Murayama, Y., Haruta-Takahashi, N., Urabe, I., Iwasaki, H. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators. PLoS biology. 6, (4), e88 (2008).
  14. Jensen, R. B., Carreira, A., Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature. 467, (7316), 678-683 (2010).
  15. Liu, J., et al. Rad51 paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation. Nature. 479, (7372), 245-248 (2011).
  16. Lu, C. -H., et al. Swi5-Sfr1 stimulates Rad51 recombinase filament assembly by modulating Rad51 dissociation. Proceedings of the National Academy of Sciences of the United States of America. (2018).
  17. Bazemore, L. R., Takahashi, M., Radding, C. M. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. Journal of Biological Chemistry. 272, (23), 14672-14682 (1997).
  18. Gupta, R. C., Bazemore, L. R., Golub, E. I., Radding, C. M. Activities of human recombination protein Rad51. Proceedings of the National Academy of Sciences. 94, (2), 463-468 (1997).
  19. Ito, K., Murayama, Y., Takahashi, M., Iwasaki, H. Two three-strand intermediates are processed during Rad51-driven DNA strand exchange. Nature Structural & Molecular Biology. 25, (1), 29-36 (2018).
  20. Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H., Iwasaki, H. Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proceedings of the National Academy of Sciences. 100, (26), 15770-15775 (2003).
  21. Haruta, N., et al. The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-mediated DNA strand exchange in vitro. Nature Structural & Molecular Biology. 13, (9), 823-830 (2006).
  22. Argunhan, B., Murayama, Y., Iwasaki, H. The differentiated and conserved roles of Swi5-Sfr1 in homologous recombination. FEBS Letters. 591, (14), 2035-2047 (2017).
  23. Kuzmic, P. Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase. Analytical biochemistry. 237, (2), 260-273 (1996).
  24. Brown, M. S., Bishop, D. K. DNA strand exchange and RecA homologs in meiosis. Cold Spring Harbor perspectives in biology. 7, (1), a016659 (2014).
  25. Rudert, W. A., et al. Double-labeled fluorescent probes for 5' nuclease assays: purification and performance evaluation. BioTechniques. 22, (6), 1140-1145 (1997).
  26. Xiao, J., Singleton, S. F. Elucidating a key intermediate in homologous DNA strand exchange: structural characterization of the RecA-triple-stranded DNA complex using fluorescence resonance energy transfer. Journal of Molecular Biology. 320, (3), 529-558 (2002).
  27. Grimme, J. M., et al. Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes. Nucleic Acids Research. 38, (9), 2917-2930 (2010).
  28. Algasaier, S. I., et al. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction. The Journal of biological chemistry. 291, (15), 8258-8268 (2016).
중재 Rad51 DNA 물가 교환 반응의 실시간 관찰
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).More

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter