Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Sanntid observasjon av DNA Strand Exchange reaksjonen formidlet av Rad51

Published: February 13, 2019 doi: 10.3791/59073

Summary

Fluorescens resonans energi overføring-basert sanntid observasjon systemer av DNA tråd exchange reaksjon formidlet av Rad51 ble utviklet. Bruker protokollene som presenteres her, er vi kjøpedyktig merker dannelsen av reaksjon intermediates og deres konvertering til produkter, mens også analysere den enzymatiske kinetics av reaksjonen.

Abstract

DNA strand exchange reaksjonen formidlet av Rad51 er et viktig skritt i homologe rekombinasjon. I denne reaksjonen, Rad51 danner en nucleoprotein filament på enkelt-strandet DNA (ssDNA) og fanger double-strandet DNA (dsDNA) ikke-spesielt å forhøre det om en homologe sekvens. Etter homologi, gir Rad51 DNA strand exchange for å megle sammenkoblingen av ssDNA med den utfyllende stranden av dsDNA. Denne reaksjonen er sterkt regulert av mange accessary proteiner i vivo. Selv om konvensjonelle biokjemiske analyser har vært vellykket ansatt å undersøke rollen av slike tilbehør protein i vitro, kinetisk analyse av mellomliggende formasjon og dens progresjon i et sluttprodukt har bevist utfordrende grunn den ustabil og forbigående art av reaksjonen intermediater. Å observere følgende reaksjon direkte i løsningen fluorescens resonans energioverføring (bånd)-basert sanntid observasjon systemer av dette ble etablert. Kinetisk analyse av sanntids observasjoner viser at DNA strand exchange reaksjonen formidlet av Rad51 følger en tretrinns reaksjon modell med dannelsen av en tre-strand DNA mellomliggende, modning av denne middels, og utgivelsen av ssDNA fra det modne mellomliggende. Swi5-Sfr1 komplekset, en accessary protein bevart i eukaryoter, forbedrer sterkt andre og tredje trinnene i denne reaksjonen. BÅND-baserte analyser presenteres her gir oss å avdekke molekylære mekanismer gjennom hvilke rekombinasjon accessary proteiner stimulere DNA strand exchange aktiviteten til Rad51. Hovedmålet med denne protokollen er å øke repertoaret teknikker tilgjengelig for forskere innen homologe rekombinasjon, spesielt de arbeider med proteiner fra arter enn Schizosaccharomyces pombe, slik at den evolusjonær bevaring av resultatene presenteres her kan bestemmes.

Introduction

Homologe rekombinasjon (HR) forenkler stokking av genetisk informasjon mellom to ulike DNA molekyler. HR er avgjørende for to grunnleggende biologisk fenomen: generasjonen av genetisk mangfold under gametogenesis1 og reparasjon av DNA dobbel-strand bryter (DSBs)2 under mitose. DSBs er den alvorligste formen for DNA skade og utgjør et brudd på kromosomet. Feil reparasjon av DSBs kan forårsake omfattende chromosomal rearrangements og genomisk ustabilitet, som er både kjennetegner kreft3.

DNA strand exchange reaksjonen er den sentrale fasen av HR. Rad51 protein, som er medlem av høyt konservert RecA-type familien til recombinases, er det viktigste proteinet som katalyserer denne reaksjonen i eukaryoter4,5. I denne reaksjonen, Rad51 binder til single-strandet DNA (ssDNA) generert av nucleolytic behandling av DSB slutten og former en spiralformede nucleoprotein kompleks kalt presynaptic filament. Dette fanger intakt double-strandet DNA (dsDNA) nonspecifically å søke etter en homologe sekvens. Når filament finner en homologe sekvens, en reaksjon mellomliggende inneholder tre-strandet DNA er dannet og Rad51 filament formidler strand exchange i denne strukturen6,7,8. For å oppnå denne reaksjonen effektivt, krever Rad51 flere typer tilbehør proteiner som BRCA1 og BRCA2, produkter av bryst kreft mottakelighet gener9,10.

Forstå er hvordan tilbehør faktorer regulere Rad51 et integrert skritt i å avdekke årsakene til genomisk ustabilitet under tumorigenesis. Selv om mye forskning er opptatt med effekten av disse faktorene på presynaptic filament dannelsen og stabiliteten11,12,13,14,15,16, den bidrag av disse faktorene å tre-strand middels og behandlingen i det endelige produktet er fortsatt uklart. Observere følgende reaksjon gjennom konvensjonelle biokjemiske eksperimenter er veldig vanskelig fordi det tre-strand mellomliggende er ustabil og utsatt for sammenbrudd av felles eksperimentelle manipulasjoner som deproteinization av prøver eller geleelektroforese.

Du løser dette problemet, vi tilpasset to tidligere utviklet sanntid observasjon systemer av DNA strand exchange reaksjonen bruker fluorescens resonans energioverføring (bånd): DNA strand sammenkoblingen og DNA tråd forskyvning analyser17, 18 (figur 1). I DNA strand sammenkobling analysen, Rad51 former en presynaptic filament med fluorescein legges amidite (FAM) - merket ssDNA og deretter homologe carboxy-x-rhodamine (ROX) - merket dsDNA for å starte strand exchange reaksjonen. Når filament fanger ROX-merket dsDNA og danner det tre-strand mellomliggende, de to fluorophores kommer i nærheten og fluorescens utslipp av FAM er slukket av ROX (figur 1A). I DNA strand forskyvning analysen, er en presynaptic filament dannet på umerket ssDNA ruges med FAM og ROX dobbel-merket dsDNA. Når strand exchange er fullført og FAM merket ssDNA frigjøres fra den tre-stranden middels, utslipp av FAM øker fordi FAM er ikke lenger i nærheten ROX (figur 1B). Disse analyser at vi skal observere dannelsen av tre-strand intermediates og deres behandling inn siste i sanntid uten forstyrrelser til reaksjonen.

Bruker denne sanntid observasjon, fant vi at DNA strand exchange reaksjonen formidlet av Rad51 fortsetter i tre-trinn inkludert dannelsen av den første reaksjonen mellomliggende (C1), overgang av første rensingen til en andre mellomliggende (C2), og utgivelsen av ssDNA C219. Vi fant også at fisjon gjær (S. pombe) Swi5-Sfr1, som er et evolusjonært bevarte Rad51 tilbehør protein kompleks13,16,20,21,22, stimulerer C1-C2 overgang og utgivelsen av ssDNA fra C2 på en måte som er avhengig av ATP-hydrolyse av Rad5119.

Om disse funnene er evolutionarily bevart er ukjent. Denne protokollen er utstyrt med håp om at forskere innen HR, spesielt de arbeider med proteiner fra organismer enn S. pombe, kan bruke disse teknikkene for å avgjøre hvilken grad molekylær mekanisme Rad51-drevet strand exchange er bevart. Videre har disse teknikkene vist svært vellykket i å bestemme rollen S. pombe Swi5-Sfr1. Dermed er det en rasjonell prediksjon at disse teknikkene vil være uvurderlig i å avdekke nøyaktig rollene til andre HR tilbehør faktorer.

Protocol

1. forberedelse av proteiner og DNA underlag

  1. Rense S. pombe Rad51 og Swi5-Sfr1 proteiner til homogenitet (bedømt av Coomassie flekker), som tidligere rapportert13,21.
  2. Forberede oligonucleotide DNA underlag oppført i tabell 118.
    Merk: Oligonucleotides ble kjøpt (se Tabell for materiale) og ved HPLC klasse. For den DNA stranden sammenkobling reaksjon, oligonucleotides 16FA(-), 16A (-) _40bp og 16AR (+) _40bp er nødvendig. For DNA forskyvning analysen, oligonucleotides 16A(-), 16FA (-) _40bp og 16AR (+) _40bp er nødvendig (figur 1 og tabell 1). Alle DNA konsentrasjonene i denne protokollen se fragmentere konsentrasjoner i motsetning til nukleotid konsentrasjoner.
  3. For å danne donor dsDNA, bland ekvimolare mengder komplementære tråder i et tynnvegget PCR rør med annealing buffer (10 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2), sikrer et samlet volum større enn 20 µL. utføre dette blande på en prechilled metall rack på Ice (mellom 2 ° C og 4 ° C).
    Merk: Kombinasjonen av oligonucleotides for tilkoblingsmodus analysen er 16A (-) _40bp og 16AR (+) _40bp. For forskyvning analysen, anneal oligonucleotides 16FA (-) _40bp og 16AR (+) _40bp.
  4. Varme annealing blandingen ved 90 ° C i 5 min og kjøle ned over 3 h 30 ° c bruker en PCR-maskin. Lagre glødet DNA på 20 ° C.

2. DNA Strand paring og forskyvning analyser

  1. Utføre DNA strand sammenkobling analysen.
    1. Forberede 1.6 mL reaksjon bufferen A (30 mM HEPES-KOH pH 7.5, 1 mM dithiothreitol [DTT] 15 mM MgCl2, 0,25 mM ATP, 0,1 mg/mL bovin serum albumin [BSA] og 0.0075% polyoxyethylenesorbitan monolaurate) som inneholder 36 nM 16FA(-) i en 2.0 mL mikro-sentrifuge plastrør (polypropylen) og pre Inkuber det ved 37 ° C i 5 minutter.
    2. Å danne Rad51-ssDNA filamenter, legge Rad51 protein til en siste konsentrasjon på 1,5 µM i pre inkubert reaksjon bufferen og ruge det ved 37 ° C i 5 minutter.
    3. Legge til Swi5-Sfr1 protein blandingen til en siste konsentrasjon av 0,15 µM og ruge det på 37 ° C for ytterligere 5 min.
    4. Ta 1,5 mL av blandingen og overføre den til 1.0 x 1,0 cm kvarts søppel som inneholder en magnetisk rørestang og sette cuvette i en spectrofluorometer. Konfigurere peltier temperatur kontrollør av spektrofotometer 37 ° c og sette det magnetisk rørestang til 450 rpm å sikre rask blanding av injisert prøven.
    5. Start måling fluorescens utslipp av FAM på 525 nm (båndbredde: 20 nm) på eksitasjon på 493 nm (båndbredde: 1 nm). Samle data hvert sekund.
    6. Etter igangsetting målene for 100 s, injisere ROX-merket donor dsDNA til en siste konsentrasjon av 36 nM i blandingen med en sprøyte og måler endringen i utslipp på 1 s intervaller for en ytterligere 30 min.
  2. Utføre DNA strand forskyvning analysen.
    1. Forberede 1.6 mL reaksjon bufferen A inneholder 36 nM 16A(-) i en 2.0 mL mikro-sentrifuge plast rør og pre Inkuber det ved 37 ° C i 5 minutter.
    2. Danner Rad51-ssDNA filamenter i nærvær av Swi5-Sfr1 på 37 ° C, som beskrevet i trinnene 2.1.2. og 2.1.3.
    3. Ta 1,5 mL av blandingen og overføre den til kvarts cuvette inneholder en magnetisk rørestang og sette cuvette spektrofotometer, som beskrevet i trinn 2.1.4.
    4. Start måling fluorescens utslipp og 100 s, injisere FAM - og ROX-merket donor dsDNA som beskrevet i trinn 2.1.6. Mål endringen i fluorescens utslipp på 1 s intervaller for en ytterligere 30 min.

3. analysere prøvedata fra sammenkoblingen og forskyvning analyser

  1. Anslå maksimal bånd effektivitet.
    1. Forberede 16FA(-) herdet med 16AR (+) _40bp og 16FA (-) _40bp herdet med 16AR (+) _40bp bruke den samme fremgangsmåten som er beskrevet i trinn 1.3 og 1.4.
    2. Forberede 130 μL reaksjon bufferen A inneholder 36 nM i enten 16FA(-), 16FA(-) herdet med 16AR (+) _40bp, 16FA (-) _40bp herdet med 16AR (+) _40bp eller 16FA (-) _40bp i 0,2 x 1,0 cm kvarts søppel.
    3. Angi cuvette i spectrofluorometer og ruge ved 37 ° C i 5 min.
    4. Måle fluorescens spectra fra 500 til 600 nm på eksitasjon på 493 nm.
    5. For å teste effekten av Rad51 på utslipp av FAM og slukker av FAM ved ROX, Legg Rad51 til en siste konsentrasjon på 1,5 μM til blandingen og ruge ved 37 ° C i 5 minutter.
    6. Måle fluorescens spectra fra 500 til 600 nm på eksitasjon på 493 nm.
    7. Beregne maksimal bånd effektivitet (Emaksimalt) ved hjelp av formelen som er beskrevet nedenfor:
      Emaksimalt = (fluorescens intensitet på 525 nm i dsDNA merket med både FAM og ROX) / (fluorescens intensitet på 525 nm i FAM merket ssDNA)
  2. Analysere prøvedata fra forskyvning analysen.
    1. Konvertere endringen i fluorescens observert i forskyvning analysen til endring i sluttproduktet, normalisere rå eksperimentelle data fra denne analysen ved hjelp av formelen som er beskrevet nedenfor, der F er fluorescens intensiteten fra rå data og Fnormalisert er endringen i fluorescens beregnet med følgende ligning.
      Fnormalisert = ([F gangen x]-[F gangen 0]) / (([F gangen 0] / Emaksimalt)-[F gangen 0])
      F gangen 0 er den gjennomsnittlige fluorescensen overvåkes for de første 5 s etter død (dvs.tiden som kreves for å blande etter en injectant føres inn i cuvette).
    2. Hvis du vil utelate effekten av photobleaching og spontan forskyvning, trekk Fnormalisert uten protein fra Fnormalisert av prøve å få FD, som er endringen endelige produktet i denne analysen.
      FD = [Fnormalisert av prøven] - [Fnormalisert uten protein]
  3. Analysere prøvedata fra paring analysen.
    1. Normalisere rå eksperimentelle data fra paring analysen ved hjelp av formelen som er beskrevet nedenfor, der F er fluorescens intensitet rådata og Fnormalisert er endringen i fluorescens beregnet med følgende ligning.
      Fnormalisert = (F gangen x) / (F gangen 0)
      F gangen 0 er den gjennomsnittlige fluorescensen overvåkes for de siste 20 før starte reaksjonen ved å injisere dsDNA underlaget.
    2. Å konvertere endring i fluorescens i endring i mengde substrat og ekskludere effekten av photobleaching og spontan sammenkobling, normalisere Fnormalisert av prøven ved hjelp av formelen som er beskrevet nedenfor, der FP er endringen i mengden underlaget i denne analysen.
      FP = 1 - (([Fnormalisert uten protein] - [Fnormalisert av prøven]) / [1-Emaksimalt])
    3. For å undersøke reaksjon kinetics DNA strand Exchange, utføre ikke-lineære siste-torget regresjonsanalyse av paring reaksjon med analyse program23 (se Tabell for materiale).
      1. Klargjøre filen i txt-format som inneholder tidsdata løpet av FP.
      2. Start programmet og lime inn skriptet i Supplerende filen i et vindu av programmet:
      3. Starte ikke-lineær regresjonsanalyse med siste-torget. Resultatene av denne analysen vil vises i vinduet.

Representative Results

For å effektivt analysere eksperimentelle data fra sammenkoblingen og forskyvning analyser, er det nødvendig å definere hvordan en endring i fluorescens utslipp av FAM tilsvarer en konvertering av DNA underlag til produkter. For å oppnå dette, må det relevante utvalget av fluorescens intensitet bestemmes. For sammenkobling analysen, fluorescens utslipp av 16FA(-), som tilsvarer ssDNA underlaget, sammenlignes med utslipp av 16FA(-) herdet med 16AR (+) _40bp, som samsvarer med de siste produktene i denne reaksjonen (figur 2A). Dette tilsvarer maksimalt bånd effektiviteten og dermed maksimal reduksjon i fluorescens intensitet som ville forventes hvis alle ssDNA underlaget ble konvertert til dsDNA produktet. For forskyvning analysen, utslipp av 16FA (-) _40bp herdet med 16AR (+) _40bp, som tilsvarer underlaget, sammenlignes med utslipp av 16FA (-) _40bp, som tilsvarer det endelige produktet (figur 2B). I dette tilfellet formidler den høyeste økningen i fluorescens intensiteten av FAM et scenario der alle dsDNA underlaget konverteres til ssDNA produktet. S. pombe Rad51 ikke påvirke fluorescens utslipp av FAM eller slukke effektiviteten av FAM ved ROX i begge analyser (figur 2). Maksimal bånd effektiviteten skal re måles med hver ny utarbeidelse av oligonucleotides som det er avhengig av merking effektiviteten av oligonucleotides.

Representant data DNA strand sammenkoblingen og forskyvning reaksjoner er vist i Figur 3. Effekten av spontane reaksjoner mellom substrat DNAs og photobleaching var små i begge analyser, som åpenbart av ubetydelig endringer sett i utslipp av FAM uten Rad51 sammenlignet med betydelige endringene sett med Rad51 (figur 3A og Figur 3B). Basert på dataene i figur 3A eller figur 3B, ble endringen i fluorescens omgjort til endringen i underlaget (FP) eller endelige produktet (FD), henholdsvis bruker ligningene beskrevet i trinnene 3.2.2 eller 3.3.2 ( Figur 3 c og figur 3D).

Paring reaksjonen var simulert benytter en sekvensiell tretrinns reaksjon modell, bestående av dannelsen av den første tre-strand middels (C1), overgang av første rensingen i det andre mellomliggende (C1 til C2), og utgivelsen av ssDNA fra det andre mellomliggende til de to produktene (D + E) (figur 3E). Å teste om simuleringen bruker en sekvensiell tretrinns reaksjon modellen passer eksperimentelle data rest mellom eksperimentelle data av DNA strand paring analysen og en teoretisk kurve ved simuleringen ble beregnet (figur 3F). I tillegg var rest mellom paring reaksjonen og en teoretisk kurve generert ved hjelp av en sekvensiell totrinns reaksjon modell også beregnet (Figur 3 g). Resterende for tilkoblingsmodus reaksjonen og to-trinns modellen viser en systematisk avvik i tidlig utviklingsfase, mens resterende for tilkoblingsmodus reaksjonen og tretrinns modellen ikke viser slike et avvik. Dette indikerer at tretrinns modellen er en bedre passform enn totrinns modellen for å simulere paring reaksjonen.

For å teste om tretrinns modellen er i samsvar med forskyvning reaksjonen som oppdager sent trinnet DNA strand Exchange, generert vi en teoretisk kurve av forskyvning reaksjonen bruker kinetisk parameterne fra simulering av sammenkoblingen reaksjon vises i Figur 3 c og sammenlignet den med eksperimentelle data av forskyvning reaksjonen vist i figur 3D (Figur 3 H). Den teoretiske Kurvetilpasning eksperimentelle data av forskyvning analysen. Fra disse resultatene vi konkludere med at simulering med tretrinns modellen er kjøpedyktig rimelig vurdere DNA strand exchange reaksjonen formidlet av Rad51.

Representant data DNA strand sammenkobling reaksjon med Rad51 og Swi5-Sfr1 komplekset, en accessary protein av Rad51, er vist i figur 4A. Swi5-Sfr1 komplekset stimulert sterkt paring aktiviteten til Rad51. Ble sett i fravær av Swi5-Sfr1, anfall sammenkobling reaksjonen bedre tretrinns modellen enn i two-step modellen i nærvær av Swi5-Sfr1 (figur 4B). Gjennom simulering av reaksjonen med tretrinns modellen, ble reaksjon likevekt konstanter av steg reaksjon med eller uten Swi5-Sfr1 beregnet. Reaksjon likevekt konstantene indikerte at Swi5-Sfr1 komplekset ikke stimulerer første reaksjon trinn (figur 4C, panel en), som en tre-strand mellomliggende dannes, men sterkt stimulerer C1-C2 overgang ( Figur 4C, panelet b) og utgivelsen av ssDNA fra C2 middels (figur 4C, panelet c).

Figure 1
Figur 1: eksperimentell design av DNA tråd sammenkoblingen og forskyvning analyser. Skjematisk av DNA tråd paring (A) og forskyvning (B) søk. Gule sirkler representerer Rad51 monomerer. Grønne sirkler med "F" og røde sirkler som inneholder "R" representerer fluorescein amidite (FAM) og carboxy-X-rhodamine (ROX), henholdsvis. Svart DNA tilnærmingene er identiske i rekkefølge og utfyllende til blå DNA tilnærmingene. Tynne svarte linjer med pilspisser peker til navnet på hver oligonucleotide, som vist i tabell 1. Dette tallet er tilpasset fra Ito et al. 19 og modifisert. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: mål for maksimal bånd effektiviteten av sammenkoblingen og forskyvning analyser. (A) sammenligning til fluorescens spectra mellom ssDNA underlaget, 16FA(-) og dsDNA produktet 16FA(-) sammen med 16AR (+) _40bp, til paring analysen. Blå og røde linjene representerer fluorescens spektra av underlaget uten og med Rad51, henholdsvis. Grønn og lilla linjene viser fluorescens spektra av det endelige produktet uten og med Rad51, henholdsvis. (B) sammenligning til fluorescens spectra mellom dsDNA underlaget, 16FA (-) _40bp sammen med 16AR (+) _40bp, og ssDNA produkt, 16FA (-) _40bp, til fortrengning analysen. Blå og røde linjene representerer fluorescens spektra av det endelige produktet uten og med Rad51, henholdsvis. Grønn og lilla linjene viser fluorescens spektra av underlaget uten og med Rad51, henholdsvis. Dette tallet er tilpasset fra Ito et al. 19 og modifisert. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: DNA strand sammenkoblingen og forskyvning reaksjoner formidlet av Rad51. (A) tid selvfølgelig den normaliserte fluorescensen av paring reaksjon med eller uten Rad51. (B) tid selvfølgelig den normaliserte fluorescensen av forskyvning reaksjon med eller uten Rad51. (C) Gang løpet av endringen i underlaget i tilkoblingsmodus reaksjon med Rad51. (D) gang løpet av endringen i underlaget i forskyvning reaksjon med Rad51. (E) A skjematisk av sekvensiell tretrinns reaksjon modellen. A og B tilsvarer den presynaptic filament og donor dsDNA. C1 tilsvarer det første (umodne) tre-strand mellomliggende. C2 tilsvarer det andre (modne) tre-strand mellomliggende. D og E tilsvarer en heteroduplex og ssDNA fra C2. (F og G) Rest mellom eksperimentelle data av DNA strand paring analysen og en teoretisk kurve innhentet av simulering hjelp av tretrinns (F) eller totrinns (G) modell. (H) røde prikkene angir eksperimentelle data fra forskyvning reaksjon med Rad51 vises i panelet D. blå linjen angir teoretisk kurven av de endelige produktene. Teoretisk kurven ble generert av simulering bruker reaksjon hastighet konstantene fra paring analysen vises i panelet C. Dette tallet er tilpasset fra Ito et al. 19 og modifisert. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: Swi5-Sfr1 stimulerer andre og tredje trinn av DNA tråd exchange reaksjon. (A) gang løpet av endringen i underlaget i tilkoblingsmodus reaksjonen med eller uten Swi5-Sfr1 (S5S1). (B) Rest mellom eksperimentelle data av DNA strand sammenkoblingen analysen med Swi5-Sfr1 og en teoretisk kurve innhentet av simulering totrinns (blå linjen) eller tre-trinns (rød linje) modell. (C) sammenkoblingen reaksjon vist i figur 4A ble etterlignet av tretrinns modellen med analyse program23 (se Tabell for materiale). Reaksjon likevekt konstantene i hvert reaksjon trinn 1 (en), K2 (b) og K3 (c), Hentet fra simuleringen. Dette tallet er tilpasset fra Ito et al. 19 og modifisert. Klikk her for å se en større versjon av dette tallet.

Oligonucleotides for DNA strand sammenkobling analysen
16FA(-) 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACA
AAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 "
16A (-) _40bp 5-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3 "
16AR (+) _40bp 5 "- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3"
Oligonucleotides for DNA strand forskyvning analysen
16A(-) 5-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATA
AGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 "
16FA (-) _40bp 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3
16AR (+) _40bp 5 "- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3"

Tabell 1: en liste over oligonucleotides i DNA strand sammenkoblingen og forskyvning analyser. Eventuelt plasseringen av fluorophores (fluorescein amidite, FAM, carboxy-x-rhodamine, ROX) angis i firkant parenteser.

Discussion

Her har vi beskrev en detaljert protokoll som benytter bånd for å måle Rad51-drevet DNA strand exchange i sanntid. Viktigere, kan disse målingene for fastsettelse av reaksjon kinetics. Beskrivelsene ovenfor er tilstrekkelig til å reprodusere publiserte resultatene, finnes det flere kritiske punkter som beskrives i denne delen. Videre vil fordeler og ulemper av bånd-baserte metoder for å studere DNA strand exchange bli diskutert, sammen med anvendelse av teknikker å studere andre aspekter av DNA metabolisme.

Som med alle biokjemiske reconstitutions, er at alle reaksjon underlag er høy renhetsgrad viktig. Det er uaktsom å anta fravær av forurensende aktiviteter basert utelukkende på tilsynelatende renheten av en protein forberedelse av Coomassie flekker. Spesielt kan tilstedeværelsen av sporstoffer mengder nucleases eller helicases drastisk påvirker resultatene av sammenkoblingen og forskyvning analyser. Derfor anbefaler vi sterkt at testing for slike aktiviteter hver gang en ny gruppe med protein er renset. Videre er det klokt å sjekke renheten av syntetisk DNA underlag av innfødte polyakrylamid gel geleelektroforese. Til tross for mange selskaper garanterer renheten av oligonucleotides, har vi ofte funnet gjennom vår egen testing at renhet av syntetisk DNA kan variere mellom bunker.

Det er viktig å vurdere de følgende to punktene når gjennomføre eksperimenter med kvarts cuvettes. Først er noen proteiner liggende å binde kvarts cuvettes nonspecifically. Mot dette BSA og polyoxyethylenesorbitan monolaurate er inkludert i reaksjon bufferne. Dernest har temperatur en drastisk effekt på reaksjonen fart og fluorescens intensiteten. For å minimere denne effekten, skal kvarts-cuvette pre inkubert på 37 ° C før bruk.

Selv om konvensjonelle biokjemiske analyser har vært svært nyttig i å studere DNA strand exchange, har de flere ulemper. I et typisk tid-retters eksperiment, en reaksjon er ruges på en viss temperatur og dele er trukket på ønsket timepoints og deproteinized av behandling med vaskemiddel og protease avslutte reaksjonen. Ved ferdigstillelse av tid-kurset utsatt prøver deretter for geleelektroforese skille DNA underlag fra produkter. Den store fordelen med metoden som er beskrevet her er at det tillater for sanntids observasjon av reaksjonen uten forstyrrelser. Noen timepoint under reaksjonen kan inspiseres uten at selve reaksjonen og det er ikke nødvendig å deproteinize prøver eller gitt dem til potensielt forstyrrende styrkene til geleelektroforese. Dette gjelder særlig når du overvåker labil DNA-strukturer.

Til tross for disse styrker over konvensjonelle analyser har metoden beskrevet her noen ulemper. Mens bruken av oligonucleotide DNA underlag for strand exchange forenkler tolkning av resultatene, er det viktig å huske at slike underlag ikke ligner DNA substrater involvert i HR i cellen. Noen konvensjonelle analyser benytte plasmider størrelse DNA underlag, som er mer sannsynlig å gjenspeile antallet av base-parene som er utvekslet i vivo. Videre kan bruk av topologisk begrenset sirkulære dsDNA underlag i et delsett av konvensjonelle analyser delvis opprette spenningene i fysiologiske DNA.

Bruk av metoden beskrevet her har begynte å rakne molekylære mekanismer Rad51-drevet DNA strand Exchange. Likevel er det mange interessante spørsmål som gjenstår å bli besvart. Det er klare bevis for at HR under meiose krever både Rad51 og Dmc1, meiose-spesifikke RecA-type recombinase i eukaryoter24. Men har mangel på biokjemiske hovedforskjellene mellom disse to recombinases forvirret forskere innen i år. Videre rollene til mange forskjellige grupper av rekombinasjon tilbehør faktorer har vært et fokus emne forskning innen HR. I tillegg til Klargjørende biokjemiske forskjellene mellom Rad51 og Dmc1, vi tar sikte på å undersøke og sammenligne effekten av ulike rekombinasjon tilbehør faktorer på the kinetics av DNA strand exchange i nærmeste fremtid. Endelig, er det viktig å understreke at bånd-baserte metodikk beskrevet her ikke er begrenset til studier av DNA strand exchange. Med relativt små modifikasjoner ser vi mange typer programmer for denne teknikken i gransker funksjonelt ulike proteiner involvert i DNA, metabolisme,25,,26,,27,,28. Vi håper utviklingen beskrevet her vil gi ytterligere muligheter for forskere tilhører mange forskjellige disipliner.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Dette arbeidet ble finansiert av Grants-in-Aid for vitenskapelig forskning (A) (18H 03985) og nyskapende områder (15H 05974) til Hei, unge forskere (B) (17K 15061) til BA og for vitenskapelig forskning (B) (18H 02371) til HT fra Japan Society for fremme av vitenskap ( JSP).

Materials

Name Company Catalog Number Comments
0.2 x 1.0 cm quartz cuvette Hellma Analytics 105-250-15-40
1.0 x 1.0 cm quartz cuvette Hellma Analytics 101-10-40
adenosine triphosphate (ATP) Sigma A2383
DynaFit BioKin, Ldt. DynaFit is a program to analyze kinetics of biochemical reactions.
Fluorescent labeled and non-labeled oligonucleotides Eurofins Genomics The sequences of oligos are listed in Table. 1.
Magnetic stirrer Aisis (Japan) CM1609
PCR machine TAKARA (Japan) TP600 TAKARA PCR Thermal Cycler Dice
Spectrofluorometer JASCO FP8300 Contains a peltier temperature controller and magnetic stirrer system
Syringe HAMILTON 1702RN 25ul SYR (22s/2"/2)

DOWNLOAD MATERIALS LIST

References

  1. Camerini-Otero, R. D., Hsieh, P. Homologous recombination proteins in prokaryotes and eukaryotes. Annual Review of Genetics. 29, (1), 509-552 (1995).
  2. Cromie, G. A., Connelly, J. C., Leach, D. R. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Molecular Cell. 8, (6), 1163-1174 (2001).
  3. Pierce, A. J., et al. Double-strand breaks and tumorigenesis. Trends in cell biology. 11, (11), S52-S59 (2001).
  4. Haber, J. E. Genome Stability. Garland Science. (2013).
  5. Kowalczykowski, S. C. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. Cold Spring Harbor perspectives in biology. 7, (11), a016410 (2015).
  6. Bianco, P. R., Tracy, R. B., Kowalczykowski, S. C. DNA strand exchange proteins: a biochemical and physical comparison. Frontiers in bioscience: a journal and virtual library. 3, D570-D603 (1998).
  7. Renkawitz, J., Lademann, C. A., Jentsch, S. Mechanisms and principles of homology search during recombination. Nature Reviews Molecular Cell Biology. 15, (6), 369-383 (2014).
  8. Greene, E. C. DNA Sequence Alignment during Homologous Recombination. The Journal of biological chemistry. 291, (22), 11572-11580 (2016).
  9. Sung, P., Krejci, L., Van Komen, S., Sehorn, M. G. Rad51 recombinase and recombination mediators. Journal of Biological Chemistry. 278, (44), 42729-42732 (2003).
  10. Prakash, R., Zhang, Y., Feng, W., Jasin, M. Homologous recombination and human health: the roles of BRCA1, BRCA2, and associated proteins. Cold Spring Harbor perspectives in biology. 7, (4), a016600 (2015).
  11. Sung, P. Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. Journal of Biological Chemistry. 272, (45), 28194-28197 (1997).
  12. Sung, P. Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes & Development. 11, (9), 1111-1121 (1997).
  13. Kurokawa, Y., Murayama, Y., Haruta-Takahashi, N., Urabe, I., Iwasaki, H. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators. PLoS biology. 6, (4), e88 (2008).
  14. Jensen, R. B., Carreira, A., Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature. 467, (7316), 678-683 (2010).
  15. Liu, J., et al. Rad51 paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation. Nature. 479, (7372), 245-248 (2011).
  16. Lu, C. -H., et al. Swi5-Sfr1 stimulates Rad51 recombinase filament assembly by modulating Rad51 dissociation. Proceedings of the National Academy of Sciences of the United States of America. (2018).
  17. Bazemore, L. R., Takahashi, M., Radding, C. M. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. Journal of Biological Chemistry. 272, (23), 14672-14682 (1997).
  18. Gupta, R. C., Bazemore, L. R., Golub, E. I., Radding, C. M. Activities of human recombination protein Rad51. Proceedings of the National Academy of Sciences. 94, (2), 463-468 (1997).
  19. Ito, K., Murayama, Y., Takahashi, M., Iwasaki, H. Two three-strand intermediates are processed during Rad51-driven DNA strand exchange. Nature Structural & Molecular Biology. 25, (1), 29-36 (2018).
  20. Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H., Iwasaki, H. Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proceedings of the National Academy of Sciences. 100, (26), 15770-15775 (2003).
  21. Haruta, N., et al. The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-mediated DNA strand exchange in vitro. Nature Structural & Molecular Biology. 13, (9), 823-830 (2006).
  22. Argunhan, B., Murayama, Y., Iwasaki, H. The differentiated and conserved roles of Swi5-Sfr1 in homologous recombination. FEBS Letters. 591, (14), 2035-2047 (2017).
  23. Kuzmic, P. Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase. Analytical biochemistry. 237, (2), 260-273 (1996).
  24. Brown, M. S., Bishop, D. K. DNA strand exchange and RecA homologs in meiosis. Cold Spring Harbor perspectives in biology. 7, (1), a016659 (2014).
  25. Rudert, W. A., et al. Double-labeled fluorescent probes for 5' nuclease assays: purification and performance evaluation. BioTechniques. 22, (6), 1140-1145 (1997).
  26. Xiao, J., Singleton, S. F. Elucidating a key intermediate in homologous DNA strand exchange: structural characterization of the RecA-triple-stranded DNA complex using fluorescence resonance energy transfer. Journal of Molecular Biology. 320, (3), 529-558 (2002).
  27. Grimme, J. M., et al. Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes. Nucleic Acids Research. 38, (9), 2917-2930 (2010).
  28. Algasaier, S. I., et al. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction. The Journal of biological chemistry. 291, (15), 8258-8268 (2016).
Sanntid observasjon av DNA Strand Exchange reaksjonen formidlet av Rad51
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).More

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter