Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Realtid Observation av DNA Strand Exchange reaktionen medieras av Rad51

Published: February 13, 2019 doi: 10.3791/59073

Summary

Fluorescens resonans energi överföring-baserade realtid observation system av DNA strand exchange reaktion medierad av Rad51 utvecklades. Med hjälp av protokollen som presenteras här, kan vi upptäcka bildandet av reaktion intermediärer och deras omvandling till produkter, samtidigt också analysera enzymatisk kineticsen av reaktionen.

Abstract

DNA strand exchange reaktionen medieras av Rad51 är ett kritiskt steg för homolog rekombination. I denna reaktion, Rad51 bildar en nucleoprotein glödlampa på enkelsträngat DNA (ssDNA) och fångar dubbelsträngat DNA (dsDNA) icke-specifikt för att förhöra den för en homolog serie. Efter att ha mött homologi, katalyserar Rad51 utbytet av DNA-strand för att medla hopkoppling av ssDNA med kompletterande delen av dsDNA. Denna reaktion är hårt reglerad av talrika accessary proteiner i vivo. Även om konventionella biokemiska analyser har framgångsrikt använts för att undersöka rollen som sådana tillbehör protein i vitro, kinetic analys av mellanliggande bildandet och dess progression i en slutprodukt bevisat utmanande på grund av instabil och övergående karaktär av reaktionen intermediärer. Att iaktta dessa reaktionen kliver direkt i lösning, fluorescens resonans energiöverföringen (bandet)-baserat realtids observation system av denna reaktion var etablerade. Kinetic analys av realtids observationer visar att DNA strand exchange reaktionen medieras av Rad51 lyder en tre steg reaktion modell som inbegriper bildandet av ett tredelat DNA mellanliggande, mognaden av denna mellanliggande, och frisläppandet av ssDNA från den mogna mellanliggande. Swi5-Sfr1 komplexet, ett accessary protein bevarad i Eukaryoter, ökar starkt i andra och tredje steg av denna reaktion. BANDET-baserade analyserna presenteras här göra det möjligt för oss att avslöja de molekylära mekanismerna genom vilka rekombination accessary proteiner stimulerar aktiviteten DNA strand utbyte av Rad51. Det huvudsakliga målet med detta protokoll är att öka repertoaren av tekniker tillgängliga för forskare i fältet för homolog rekombination, särskilt de som arbetar med proteiner från andra arter än Schizosaccharomyces pombe, så att den evolutionära bevarande av de resultat som presenteras häri kan bestämmas.

Introduction

Homolog rekombination (HR) underlättar den omflyttning av genetisk information mellan två olika DNA-molekyler. HR är viktigt för två grundläggande biologiska fenomen: generationen av genetisk mångfald under könscellsbildning1 och reparation av DNA dubbel-strand breaks (DSBs)2 under Mitos. DSBs är den allvarligaste formen av DNA-skador och utgör ett brott i kromosomen. Felaktig reparation av DSBs kan orsaka omfattande kromosomala rearrangements och genomisk instabilitet, som båda kännetecknar cancer3.

DNA strand exchange reaktion är den centrala fasen av HR. Proteinet Rad51, som är en medlem av familjen mycket RecA-typ rekombinaser, är det viktigaste proteinet som katalyserar reaktionen i Eukaryoter4,5. I denna reaktion, Rad51 binder till enkelsträngat DNA (ssDNA) genereras av nucleolytic behandling av DSB slutet och bildar en spiralformade nucleoprotein komplex kallas presynaptiska glödtråden. Detta glödtråden fångster intakt dubbelsträngat DNA (dsDNA) nonspecifically att söka för en homolog serie. När glödtråden finner en homolog sekvens, en reaktion som mellanliggande innehållande tre-strängat DNA bildas och Rad51 glödtråden förmedlar strand utbyte inom denna struktur6,7,8. För att åstadkomma denna reaktion effektivt, kräver Rad51 flera sorters tillbehör proteiner såsom BRCA1 och BRCA2, produkter av bröst cancer känslighet gener9,10.

Förståelse är hur tillbehör faktorer reglera Rad51 ett viktig steg i avslöja orsakerna till genomisk instabilitet under tumourigenesis. Även om mycket forskning handlar om effekterna av dessa faktorer på presynaptiska filament bildning och stabilitet11,12,13,14,15,16, den bidraget från dessa faktorer till bildandet av de tre-strand mellanliggande och bearbetningen till den slutliga produkten är fortfarande oklart. Observera följande reaktion genom konventionella biokemiska experiment är mycket svårt eftersom tredelat intermediären är instabil och benägna att kollapsa av gemensamma experimentella manipulationer som deproteinization av prover eller elektrofores.

För att lösa detta problem vi anpassat två tidigare utvecklade realtid observationssystem DNA strand exchange reaktion med fluorescens resonans energiöverföring (bandet): DNA strand kopplingen och DNA strand deplacement analyser17, 18 (figur 1). I av DNA-strängen ihopkoppling assay, Rad51 former en presynaptiska glödtråd med fluorescein läggs amidite (FAM) - märkt ssDNA och sedan homologa karboxi-x-rodamin (ROX) - märkt dsDNA för att inleda strand exchange reaktionen. När glödtråden fångar den ROX-märkt dsDNA och bildar de tre-strand mellanliggande, de två fluorophores kommer i närheten och fluorescens utsläpp av FAM är kylda av ROX (figur 1A). I DNA strand deplacement analysen inkuberas en presynaptiska glödtråd som bildats på omärkta ssDNA med FAM och ROX dubbel-märkt dsDNA. När strand exchange är avslutat och FAM märkt ssDNA frigörs från de tre-strand mellanliggande, utsläpp av FAM ökar eftersom FAM inte längre är i närheten av ROX (figur 1B). Dessa analyser göra det möjligt för oss att observera bildandet av tredelat intermediärer och deras behandling i slutprodukterna i realtid utan att eventuella störningar till reaktion.

Med denna realtid observationssystem, upptäckte vi att DNA strand exchange reaktionen medieras av Rad51 fortskrider i tre-steg inklusive bildandet av den första reaktionen mellanliggande (C1), övergången av första intermediären till en andra mellanliggande (C2), och frisättning av ssDNA från C219. Vi fann också att fission jäst (S. pombe) Swi5-Sfr1, som är en evolutionärt bevarade Rad51 tillbehör protein komplex13,16,20,21,22, stimulerar den C1-C2 övergår och frisättning av ssDNA från C2 på ett sätt som är beroende av ATP-hydrolys av Rad5119.

Huruvida dessa resultat är evolutionärt bevarade förblir okänd. Detta protokoll är försedd med hopp om att forskare inom HR, särskilt de som arbetar med proteiner från organismer än S. pombe, får tillämpa dessa tekniker för att avgöra i vilken utsträckning den molekylära mekanismen av Rad51-driven strand exchange är bevarad. Dessa tekniker har dessutom visat sig mycket framgångsrika i att fastställa rollen av S. pombe Swi5-Sfr1. Det är således en rationell förutsägelse att dessa tekniker kommer att vara ovärderliga i att avslöja de exakta rollerna andra HR tillbehör faktorer.

Protocol

1. beredning av proteiner och DNA-substrat

  1. Rena S. pombe Rad51 och Swi5-Sfr1 proteiner till homogenitet (bedömt av Coomassie färgning), som tidigare rapporterats13,21.
  2. Förbereda oligonukleotiden DNA-substrat anges i tabell 118.
    Obs: Oligonukleotider köptes (se Tabell av material) och syntetiseras på HPLC-kvalitet. För av DNA-strängen ihopkoppling reaktion, oligonukleotider 16FA(-), 16A (-) _40bp och 16AR (+) _40bp krävs. För DNA deplacement analysen, oligonukleotider 16A(-), 16FA (-) _40bp och 16AR (+) _40bp är obligatoriskt (figur 1 och tabell 1). Alla DNA koncentrationer i detta protokoll Se fragment koncentrationer i motsats till nukleotid koncentrationer.
  3. För att bilda givare dsDNA, blanda equimolar mängder kompletterande kardeler i en tunna PCR-rör med glödgning buffert (10 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2), säkerställa en total volym som är större än 20 µL. utföra denna blandning på en prechilled metall rack på Ice (mellan 2 ° C och 4 ° C).
    Obs: Kombinationen av oligonukleotider för hopkoppling analysen är 16A (-) _40bp och 16AR (+) _40bp. För förskjutning analysen, glödga oligonukleotider 16FA (-) _40bp och 16AR (+) _40bp.
  4. Värm glödgning blandningen vid 90 ° C i 5 min och svalna över 3 h till 30 ° C med hjälp av en PCR-maskin. Lagra glödgad DNA vid-20 ° C.

2. DNA Strand ihopparning och deplacement analyser

  1. Utföra DNA-strängen ihopkoppling assay.
    1. Bereda 1,6 mL reaktion buffert A (30 mM HEPES-KOH pH 7.5, 1 mM Ditiotreitol [DTT], 15 mM MgCl2, 0,25 mM ATP, 0,1 mg/mL bovint serumalbumin [BSA] och 0,0075% polyoxyethylenesorbitan lösning) som innehåller 36 nM 16FA(-) i en 2,0 mL mikro-centrifug plaströr (polypropen) och Preinkubera det vid 37 ° C i 5 min.
    2. Bilda Rad51-ssDNA filament, lägga Rad51 protein till en slutlig koncentration på 1,5 µM i förväg ruvade reaktion bufferten och inkubera det vid 37 ° C i 5 min.
    3. Lägga till Swi5-Sfr1 protein i blandningen till en slutlig koncentration på 0,15 µM och inkubera det vid 37 ° C i ytterligare 5 minuter.
    4. Ta 1,5 mL av blandningen och överför det till en 1.0 x 1,0 cm kvarts kyvetten innehållande en magnetisk omrörare och ställa in kyvetten i en spectrofluorometer. Konfigurera peltier tempereringsaggregatet spektrofotometerns till 37 ° C och Ställ magnetomröraren till 450 rpm att säkerställa snabba blandning av injicerade provet.
    5. Börja mäta fluorescens utsläpp av FAM på 525 nm (bandbredd: 20 nm) vid magnetiseringen på 493 nm (bandbredd: 1 nm). Samla in uppgifter varje sekund.
    6. Efter start mätning för 100 s, injicera ROX-märkt givare dsDNA till en slutlig koncentration av 36 nM i smeten med hjälp av en spruta och mäta förändringen i utsläpp med 1 s intervall i ytterligare 30 minuter.
  2. Utföra DNA strand deplacement assay.
    1. Bereda 1,6 mL reaktion buffert A som innehåller 36 nM 16A(-) i en 2,0 mL mikro-centrifug plast röret och Preinkubera det vid 37 ° C i 5 min.
    2. Bildar Rad51-ssDNA filament i närvaro av Swi5-Sfr1 vid 37 ° C, enligt beskrivningen i steg 2.1.2. och 2.1.3.
    3. Ta 1,5 mL av blandningen och överför till kvarts kyvetten innehållande en magnetisk omrörare och ställa in kyvetten i spektrofotometern, som beskrivs i steg 2.1.4.
    4. Börja mäta fluorescens utsläpp och efter 100 s, injicera FAM - och ROX-märkt givare dsDNA som beskrivs i steg 2.1.6. Mäta förändringen av fluorescens utsläpp med 1 s intervall i ytterligare 30 minuter.

3. analysera försöksdata från parningen och deplacement analyser

  1. Beräkna maximal bandet effektivitet.
    1. Förbereda 16FA(-) glödgas med 16AR (+) _40bp och 16FA (-) _40bp glödgas med 16AR (+) _40bp med hjälp av samma procedur som beskrivs i steg 1.3 och 1.4.
    2. Förbereda 130 μL av reaktion buffert A som innehåller 36 nM av antingen 16FA(-), 16FA(-) glödgas med 16AR (+) _40bp, 16FA (-) _40bp glödgas med 16AR (+) _40bp eller 16FA (-) _40bp i en 0,2 x 1,0 cm kvarts kyvetten.
    3. Ställa in kyvetten i spectrofluorometer och inkubera vid 37 ° C i 5 min.
    4. Mäta fluorescens spectra från 500 till 600 nm vid magnetiseringen på 493 nm.
    5. För att testa effekten av Rad51 på utsläpp av FAM och snabbkylning av FAM av ROX, lägga till Rad51 till en slutlig koncentration på 1,5 μM till blandningen och inkubera vid 37 ° C i 5 min.
    6. Mäta fluorescens spectra från 500 till 600 nm vid magnetiseringen på 493 nm.
    7. Beräkna maximal bandet effektivitet (Ehögsta) med hjälp av ekvation som beskrivs nedan:
      Ehögsta = (fluorescensintensiteten på 525 nm dsDNA märkt med både FAM och ROX) / (fluorescensintensiteten på 525 nm för FAM märkt ssDNA)
  2. Analysera försöksdata från deplacement-analysen.
    1. Att konvertera förändringen i fluorescens observeras i förskjutning analysen till förändringen av mängden slutprodukten, normalisera raw experimentella data som erhållits från denna analys med hjälp av ekvation som beskrivs nedan, där F är fluorescensintensiteten från rådata och Fnormaliserade är förändringen i fluorescens beräknas med följande ekvation.
      Fnormaliserade = ([F på tid x]-[F vid tidpunkt 0]) / (([F vid tidpunkt 0] / Ehögsta)-[F vid tidpunkt 0])
      F vid tidpunkt 0 är den genomsnittliga fluorescensen övervakas för de första 5 s efter dödtiden (dvsden tid som krävs för att blanda efter en injectant förs in i kyvetten).
    2. För att utesluta effekterna av fotoblekning och spontana deplacement, subtrahera Fnormaliserade utan protein från Fnormaliserade av provet få FD, som är förändringen av mängden slutprodukten i denna analys.
      FD = [Fnormaliserade av provet] - [Fnormaliserade utan protein]
  3. Analysera försöksdata från hopkoppling analysen.
    1. Normalisera raw experimentella data som erhållits från hopkoppling analysen med hjälp av ekvation som beskrivs nedan, där F är fluorescensintensiteten från rådata och Fnormaliserade är förändringen i fluorescens beräknas med följande ekvation.
      Fnormaliserade = (F på tid x) / (F vid tidpunkt 0)
      F vid tidpunkt 0 är den genomsnittliga fluorescensen övervakas för de senaste 20 s innan reaktionen genom att injicera dsDNA substratet.
    2. För att konvertera förändring i fluorescens in förändring i mängden substrat och utesluta effekterna av fotoblekning och spontana ihopkoppling, normalisera Fnormaliserade av provet med hjälp av ekvation som beskrivs nedan, där FP är förändringen av mängden underlaget i denna analys.
      FP = 1 - (([Fnormaliserade utan protein] - [Fnormaliserade av provet]) / [1-Ehögsta])
    3. För att undersöka reaktion kineticsen av utbytet av DNA-strand, utföra icke-linjära sista-square regressionsanalys av hopkoppling reaktionen med analys program23 (se Tabell för material).
      1. Förbereda en fil i TXT-format som innehåller tidsdata kurs FP.
      2. Starta programmet och klistra in skriptet i Kompletterande kodfil i ett fönster av programmet:
      3. Starta icke-linjär regressionsanalys sista-torget. Resultaten av denna analys kommer att visas i samma fönster.

Representative Results

För att effektivt analysera experimentella data från ihopparning och deplacement analyserna, är det nödvändigt att definiera hur en förändring i fluorescens utsläpp av FAM motsvarar en omvandling av DNA substrat till produkter. För att uppnå detta, måste de relevanta rad fluorescensintensiteten bestämmas. För ihopkoppling analysen, fluorescens utsläpp av 16FA(-), vilket motsvarar ssDNA substratet, jämförs med utsläpp av 16FA(-) glödgas med 16AR (+) _40bp, vilket motsvarar slutprodukterna av denna reaktion (figur 2A). Detta motsvarar efter maximal bandet effektivitet och därmed den största sänkningen fluorescensintensiteten som skulle förväntas om alla ssDNA substrat omvandlades till produktens dsDNA. För förskjutning analysen, utsläpp av 16FA (-) _40bp glödgas med 16AR (+) _40bp, vilket motsvarar substratet, jämförs med utsläpp av 16FA (-) _40bp, som motsvarar till den slutliga produkten (figur 2B). I detta fall förmedlar den maximala ökningen fluorescensintensiteten hos FAM ett scenario där alla dsDNA substratet omvandlas till ssDNA produkt. S. pombe Rad51 påverkade inte fluorescens utsläpp av FAM eller kylning effektivitet för FAM av ROX i båda analyser (figur 2). Maximal bandet effektivitet bör åter uppmätta med varje ny beredning av oligonukleotider som är beroende av oligonukleotider märkning effektivitet.

Representativa uppgifter av DNA strand ihopparning och deplacement reaktioner visas i figur 3. Effekterna av spontana reaktioner mellan substrat DNAs och fotoblekning var små i både analyser, som avslöjas av de försumbara förändringar ses i utsläpp av FAM utan Rad51 jämfört med de betydande förändringar som ses med Rad51 (figur 3A och Figur 3B). Baserat på de data som visas i figur 3A eller figur 3B, omvandlades förändringen i fluorescens till förändringen av mängden substrat (FPersson) eller slutprodukten (FD), respektive, med hjälp av ekvationer som beskrivs i steg 3.2.2 eller 3.3.2 ( Figur 3 c och figur 3D).

Ihopkoppling reaktionen simulerades med en sekventiell tre steg reaktion modell, bestående av bildandet av den första tredelat mellanliggande (C1), övergången av första intermediären till de andra mellanliggande (C1 till C2), och frisläppandet av ssDNA från den andra mellanliggande att bilda de två produkterna (D + E) (figur 3E). Att testa om simuleringen använder en sekventiell tre steg reaktion modell passform experimentella data, residualer mellan experimentella data av DNA strandar parkoppling analys och en teoretisk kurva som erhålls av simuleringen var beräknas (figur 3F). Dessutom var residualer mellan hopkoppling reaktionen och en teoretisk kurva som genererats med en sekventiell two-step reaktion modell också beräknat (figur 3 g). Residualerna för hopkoppling reaktionen och två-stegs modell visar en systematisk avvikelse i ett tidigt skede, medan residualerna för hopkoppling reaktionen och tre steg modellen inte visar en sådan avvikelse. Detta indikerar att den tre steg-modellen är en bättre passform än två-stegs modell för att simulera hopkoppling reaktionen.

För att testa om tre steg modellen är konsekvent med deplacement reaktionen som upptäcker det sent steget i utbytet av DNA-strand, genererade vi en teoretisk kurva deplacement reaktion med kinetiska parametrar erhålls från simulering av ihopparningen reaktion visas i figur 3 c och jämfört med experimentella data för förskjutning reaktion visas i figur 3D (figur 3 H). Teoretiska kurvan passar experimentella data deplacement analysens. Från dessa resultat, drar vi slutsatsen att simulering med hjälp av tre steg-modellen är kunna rimligen utvärdera DNA strand exchange reaktionen medieras av Rad51.

Representativa uppgifter av DNA strandar ihopkoppling reaktion som innehåller Rad51 och Swi5-Sfr1 komplexet, ett accessary protein av Rad51, visas i figur 4A. Swi5-Sfr1 komplexet stimuleras starkt aktiviteten hopkoppling av Rad51. Som sågs i avsaknad av Swi5-Sfr1, passa ihopkoppling reaktionen bättre tre steg modellen än två-stegs modell i närvaro av Swi5-Sfr1 (figur 4B). Genom simulering av reaktionen med tre steg-modellen, beräknades reaktion jämvikt konstanter för varje reaktion steg med eller utan Swi5-Sfr1. Reaktion jämvikt konstanterna anges att Swi5-Sfr1 komplexet inte stimulera det första reaktion steget (figur 4 c, panel en), där ett tredelat mellanliggande bildas, men starkt stimulerar C1-C2 övergår ( Figur 4 c, panel b) och frisläppandet av ssDNA från C2 intermediären (figur 4 c, panel c).

Figure 1
Figur 1: experimentell design DNA strand ihopparning och deplacement analyser. Scheman över DNA strand hopkoppling (A) och deplacement (B) analyser. Gula cirklar representerar Rad51 monomerer. Gröna cirklar som innehåller ”F” och röda cirklar som innehåller ”R” representerar fluorescein amidite (FAM) respektive karboxi-X-rodamin (ROX). Svart DNA-strängar är identiska i sekvens och kompletterande till blå DNA-strängar. Tunna svarta linjer med pilspetsar pekar på namnet på varje oligonukleotiden, som skildras i tabell 1. Denna siffra har anpassats från Ito et al. 19 och modifierade. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: mätningar av högsta bandet effektiviteten av ihopparning och deplacement analyserna. (A) jämförelse av fluorescens spektra mellan ssDNA substratet, 16FA(-) och produktens dsDNA, 16FA(-) parat med 16AR (+) _40bp, ihopkoppling analysens. Blå och röda linjerna representerar fluorescens spektra av substratet utan och med Rad51, respektive. Gröna och lila linjerna visar fluorescens spektra av den slutliga produkten utan och med Rad51, respektive. (B) jämförelse av fluorescens spektra mellan dsDNA substratet, 16FA (-) _40bp parat med 16AR (+) _40bp och ssDNA produkt, 16FA (-) _40bp, förskjutning analysens. Blå och röda linjerna representerar fluorescens spektra av den slutliga produkten utan och med Rad51, respektive. Gröna och lila linjerna visar fluorescens spektra av substratet utan och med Rad51, respektive. Denna siffra är anpassade från Ito et al. 19 och modifierade. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: DNA strand ihopparning och deplacement reaktioner medieras av Rad51. (A) tidsförloppet för de normaliserade fluorescensen hopkoppling reaktion med eller utan Rad51. (B) tidsförloppet för de normaliserade fluorescensen deplacement reaktion med eller utan Rad51. (C) Tidsförloppet för förändringen av mängden substrat i ihopkoppling reaktionen med Rad51. (D) tidsförloppet för förändringen av mängden substrat i förskjutning reaktionen med Rad51. (E) A Schematisk av sekventiell tre steg reaktion modell. A och B motsvarar den presynaptiska glödtråden och givare dsDNA. C1 motsvarar första (omogna) tredelat intermediären. C2 motsvarar den andra (äldre) tredelat mellanliggande. D och E motsvarar en heteroduplex och ssDNA släppt från C2. (F och G) residualer mellan experimentella data av DNA strandar parkoppling analys och en teoretisk kurva erhålls genom simulering med tre steg (F) eller två steg (G) modell. (H) röda prickar indikerar experimentella data deplacement reaktionen med Rad51 som visas i panelen D. blå linjen visar den teoretiska kurvan av slutprodukterna. Teoretiska kurvan genererades av simulering med hjälp av de reaktion konstanter erhållits från hopkoppling analysen visas i panelen C. Denna siffra är anpassade från Ito et al. 19 och modifierade. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: Swi5-Sfr1 stimulerar andra och tredje steg av DNA strand exchange reaktion. (A) tidsförloppet för förändringen av mängden substrat i ihopkoppling reaktionen med eller utan Swi5-Sfr1 (S5S1). (B) residualer mellan experimentella data av DNA strand ihopkopplingen assay med Swi5-Sfr1 och en teoretisk kurva erhålls genom simulering med hjälp av två steg (blå linje) eller tre steg (röda linjen) modell. (C) ihopkopplingen reaktion visas i figur 4A simulerades genom tre steg modellen med analys program23 (se Tabell för material). Varje reaktion steg, K1 reaktion jämvikt konstanter (en), K2 (b) och K3 (c), erhölls från simuleringen. Denna siffra är anpassade från Ito et al. 19 och modifierade. Klicka här för att se en större version av denna siffra.

Oligonukleotider för DNA-strängen ihopkoppling assay
16FA(-) 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACA
AAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 '
16a (-) _40bp 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3'
Oligonukleotider för DNA strand deplacement assay
16A(-) 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATA
AGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 '
16FA (-) _40bp 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3'

Tabell 1: en lista över oligonukleotider används i DNA strand ihopparning och deplacement analyserna. I tillämpliga fall, placerar av fluorophores (fluorescein amidite, FAM; karboxi-x-rodamin, ROX) anges i fyrkantiga parenteser.

Discussion

Här har vi beskrivit ett detaljerat protokoll som använder bandet för att mäta Rad51-driven DNA strand exchange i realtid. Ännu viktigare, möjliggör dessa mätningar bestämning av reaktionskinetik. Medan de beskrivningar som anges ovan är tillräckliga för att återge våra publicerade resultat, finns det flera kritiska punkter som kommer att beskrivas i det här avsnittet. Dessutom kommer fördelar och nackdelar av bandet-baserade metoder för att studera DNA strand exchange att diskuteras, tillsammans med tillämpning av sådana tekniker att studera andra aspekter av DNA ämnesomsättning.

Som med alla biokemiska reconstitutionsna, är det viktigt att se till att alla reaktion substrat av hög renhet. Det är vårdslöst att anta avsaknad av kontaminerande aktiviteter baserat enbart på uppenbara renheten av ett protein preparat bedöms av Coomassie färgning. I synnerhet kan förekomsten av spårmängder av nukleaser eller Helikas drastiskt påverka resultaten av analyserna ihopparning och förskjutning. Således att rekommenderar vi testa för sådana aktiviteter varje gång en ny sats av protein renas. Dessutom är det klokt att kontrollera renhet av syntetiskt DNA substrat med infödda polyakrylamid gelelektrofores. Trots många företag att garantera renheten av oligonukleotider, har vi ofta funnit genom våra egna tester att renhet av syntetiskt DNA kan variera mellan partier.

Det är viktigt att tänka på följande två punkter när genomföra experiment med kvarts kyvetter. För det första, vissa proteiner är benägna att binda kvarts kyvetter nonspecifically. För att motverka detta, BSA och polyoxyethylenesorbitan lösning ingår i reaktionen buffertar. För det andra, temperaturen har en dramatisk effekt på reaktion hastighet och fluorescens intensiteten. För att minimera denna effekt, bör kvarts kyvetten pre inkuberas vid 37 ° C före användning.

Även konventionella biokemiska analyser har varit enormt användbar i att studera DNA strand exchange, har de flera nackdelar. I en typisk tidsförlopp experiment, en reaktion är inkuberas vid en viss temperatur och alikvoter är återkallat vid önskade tidpunkter och har gjorts proteinfritt med behandling med rengöringsmedel och proteas att avsluta reaktionen. Efter avslutad tid-kursen genomgår sedan prover elektrofores att separera DNA substrat från produkter. Den stora fördelen med den metod som beskrivs här är att det tillåter för realtid observationen av reaktionen utan störningar. Någon tidpunkt under reaktionen kan inspekteras utan att störa reaktionen själv och det finns ingen anledning att deproteinize prover eller utsätta dem för potentiellt störande styrkorna av elektrofores. Detta är särskilt relevant när övervakning labila DNA strukturer.

Trots dessa styrkor över konventionella analyser har den metod som beskrivs här vissa nackdelar. Medan användningen av oligonukleotiden DNA substrat för strand exchange förenklar tolkningen av resultaten, är det viktigt att komma ihåg att sådana substrat inte liknar de DNA-substratesna som är inblandade i HR i cellen. Vissa konventionella analyser utnyttja plasmid-sized DNA-substrat, som är mer benägna att återspeglar antalet base-par som är utbytt i vivo. Dessutom kan användningen av topologically begränsad cirkulär dsDNA substrat i en delmängd av konventionella analyser åtminstone delvis återskapa spänningarna i fysiologiska DNA.

Tillämpningen av den metod som beskrivs här har börjat nysta molekylära mekanismer för Rad51-driven DNA strand exchange. Ändå finns det många intressanta frågor som återstår för att besvaras. Det finns tydliga bevis att HR under meios kräver både Rad51 och Dmc1, den meios-specifika RecA-typ recombinase i Eukaryoter24. Bristen på stora biokemiska skillnader mellan dessa två rekombinaser har dock förbryllat forskare inom området i år. Rollerna för många olika grupper av rekombination tillbehör faktorer har dessutom varit en fokal ämnet forskning inom HR. Förutom att belysa biokemiska skillnaderna mellan Rad51 och Dmc1, vi strävar efter att undersöka och jämföra effekterna av olika rekombination tillbehör faktorer på kinetiken för utbytet av DNA-strand i den närmaste framtiden. Slutligen är det viktigt att betona att den band-baserade metod som beskrivs här inte är begränsad till studier av DNA strand exchange. Med relativt små modifieringar föreställer vi många typer av applikationer för denna teknik utreda funktionellt olika proteinerna som är inblandade i DNA ämnesomsättning25,26,27,28. Vi hoppas att den utvecklingen som beskrivs här kommer att ge ytterligare alternativ till forskare som tillhör många olika discipliner.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Detta arbete finansierades av Grants-in-Aid för vetenskaplig forskning (A) (18H 03985) och på innovativa områden (15H 05974) till HI, för unga forskare (B) (17K 15061) British Airways, och för vetenskaplig forskning (B) (18H 02371) till HT från Japan Society för främjande av vetenskap ( JSPS).

Materials

Name Company Catalog Number Comments
0.2 x 1.0 cm quartz cuvette Hellma Analytics 105-250-15-40
1.0 x 1.0 cm quartz cuvette Hellma Analytics 101-10-40
adenosine triphosphate (ATP) Sigma A2383
DynaFit BioKin, Ldt. DynaFit is a program to analyze kinetics of biochemical reactions.
Fluorescent labeled and non-labeled oligonucleotides Eurofins Genomics The sequences of oligos are listed in Table. 1.
Magnetic stirrer Aisis (Japan) CM1609
PCR machine TAKARA (Japan) TP600 TAKARA PCR Thermal Cycler Dice
Spectrofluorometer JASCO FP8300 Contains a peltier temperature controller and magnetic stirrer system
Syringe HAMILTON 1702RN 25ul SYR (22s/2"/2)

DOWNLOAD MATERIALS LIST

References

  1. Camerini-Otero, R. D., Hsieh, P. Homologous recombination proteins in prokaryotes and eukaryotes. Annual Review of Genetics. 29, (1), 509-552 (1995).
  2. Cromie, G. A., Connelly, J. C., Leach, D. R. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Molecular Cell. 8, (6), 1163-1174 (2001).
  3. Pierce, A. J., et al. Double-strand breaks and tumorigenesis. Trends in cell biology. 11, (11), S52-S59 (2001).
  4. Haber, J. E. Genome Stability. Garland Science. (2013).
  5. Kowalczykowski, S. C. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. Cold Spring Harbor perspectives in biology. 7, (11), a016410 (2015).
  6. Bianco, P. R., Tracy, R. B., Kowalczykowski, S. C. DNA strand exchange proteins: a biochemical and physical comparison. Frontiers in bioscience: a journal and virtual library. 3, D570-D603 (1998).
  7. Renkawitz, J., Lademann, C. A., Jentsch, S. Mechanisms and principles of homology search during recombination. Nature Reviews Molecular Cell Biology. 15, (6), 369-383 (2014).
  8. Greene, E. C. DNA Sequence Alignment during Homologous Recombination. The Journal of biological chemistry. 291, (22), 11572-11580 (2016).
  9. Sung, P., Krejci, L., Van Komen, S., Sehorn, M. G. Rad51 recombinase and recombination mediators. Journal of Biological Chemistry. 278, (44), 42729-42732 (2003).
  10. Prakash, R., Zhang, Y., Feng, W., Jasin, M. Homologous recombination and human health: the roles of BRCA1, BRCA2, and associated proteins. Cold Spring Harbor perspectives in biology. 7, (4), a016600 (2015).
  11. Sung, P. Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. Journal of Biological Chemistry. 272, (45), 28194-28197 (1997).
  12. Sung, P. Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes & Development. 11, (9), 1111-1121 (1997).
  13. Kurokawa, Y., Murayama, Y., Haruta-Takahashi, N., Urabe, I., Iwasaki, H. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators. PLoS biology. 6, (4), e88 (2008).
  14. Jensen, R. B., Carreira, A., Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature. 467, (7316), 678-683 (2010).
  15. Liu, J., et al. Rad51 paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation. Nature. 479, (7372), 245-248 (2011).
  16. Lu, C. -H., et al. Swi5-Sfr1 stimulates Rad51 recombinase filament assembly by modulating Rad51 dissociation. Proceedings of the National Academy of Sciences of the United States of America. (2018).
  17. Bazemore, L. R., Takahashi, M., Radding, C. M. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. Journal of Biological Chemistry. 272, (23), 14672-14682 (1997).
  18. Gupta, R. C., Bazemore, L. R., Golub, E. I., Radding, C. M. Activities of human recombination protein Rad51. Proceedings of the National Academy of Sciences. 94, (2), 463-468 (1997).
  19. Ito, K., Murayama, Y., Takahashi, M., Iwasaki, H. Two three-strand intermediates are processed during Rad51-driven DNA strand exchange. Nature Structural & Molecular Biology. 25, (1), 29-36 (2018).
  20. Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H., Iwasaki, H. Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proceedings of the National Academy of Sciences. 100, (26), 15770-15775 (2003).
  21. Haruta, N., et al. The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-mediated DNA strand exchange in vitro. Nature Structural & Molecular Biology. 13, (9), 823-830 (2006).
  22. Argunhan, B., Murayama, Y., Iwasaki, H. The differentiated and conserved roles of Swi5-Sfr1 in homologous recombination. FEBS Letters. 591, (14), 2035-2047 (2017).
  23. Kuzmic, P. Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase. Analytical biochemistry. 237, (2), 260-273 (1996).
  24. Brown, M. S., Bishop, D. K. DNA strand exchange and RecA homologs in meiosis. Cold Spring Harbor perspectives in biology. 7, (1), a016659 (2014).
  25. Rudert, W. A., et al. Double-labeled fluorescent probes for 5' nuclease assays: purification and performance evaluation. BioTechniques. 22, (6), 1140-1145 (1997).
  26. Xiao, J., Singleton, S. F. Elucidating a key intermediate in homologous DNA strand exchange: structural characterization of the RecA-triple-stranded DNA complex using fluorescence resonance energy transfer. Journal of Molecular Biology. 320, (3), 529-558 (2002).
  27. Grimme, J. M., et al. Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes. Nucleic Acids Research. 38, (9), 2917-2930 (2010).
  28. Algasaier, S. I., et al. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction. The Journal of biological chemistry. 291, (15), 8258-8268 (2016).
Realtid Observation av DNA Strand Exchange reaktionen medieras av Rad51
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).More

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter