A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Manipulation of Gene Function in Mexican Cavefish

9.3K views

DOI:

10.3791/59093

April 22nd, 2019

In This Article

Summary

We describe approaches for the manipulation of genes in the evolutionary model system Astyanax mexicanus. Three different techniques are described: Tol2-mediated transgenesis, targeted manipulation of the genome using CRISPR/Cas9, and knockdown of expression using morpholinos. These tools should facilitate the direct investigation of genes underlying the variation between surface- and cave-dwelling forms.

Abstract

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, including eye degeneration, albinism, sleep loss, hyperphagia, and sensory processing. Species of cavefish from around the world display a convergent evolution of morphological and behavioral traits due to shared environmental pressures between different cave systems. Diverse cave species have been studied in the laboratory setting. The Mexican tetra, Astyanax mexicanus, with sighted and blind forms, has provided unique insights into biological and molecular processes underlying the evolution of complex traits and is well-poised as an emerging model system. While candidate genes regulating the evolution of diverse biological processes have been identified in A. mexicanus, the ability to validate a role for individual genes has been limited. The application of transgenesis and gene-editing technology has the potential to overcome this significant impediment and to investigate the mechanisms underlying the evolution of complex traits. Here, we describe a different methodology for manipulating gene expression in A. mexicanus. Approaches include the use of morpholinos, Tol2 transgenesis, and gene-editing systems, commonly used in zebrafish and other fish models, to manipulate gene function in A. mexicanus. These protocols include detailed descriptions of timed breeding procedures, the collection of fertilized eggs, injections, and the selection of genetically modified animals. These methodological approaches will allow for the investigation of the genetic and neural mechanisms underlying the evolution of diverse traits in A. mexicanus

Introduction

Since Darwin’s Origin of Species1, scientists have gained profound insights into how traits are shaped evolutionarily in response to defined environmental and ecological pressures, thanks to cave organisms2. The Mexican tetra, A. mexicanus, consists of eyed ancestral ‘surface’ populations that inhabit rivers throughout Mexico and southern Texas and of at least 29 geographically isolated populations of derived cave morphs inhabiting the Sierra del Abra and other areas of Northeast Mexico3. A number of cave-associated traits have been identified in A. mexicanus, including altered oxygen consumption, depigmentation, loss of eyes, and altered feeding and foraging behavior4,5,6,7,8,9. A. mexicanus presents a powerful model for investigating mechanisms of convergent evolution due to a well-defined evolutionary history, a detailed characterization of ecological environment, and the presence of independently evolved cave populations10,11. Many of the cave-derived traits that are present in cavefish, including eye loss, sleep loss, increased feeding, loss of schooling, reduced aggression, and reduced stress responses, have evolved multiple times through independent origins, often utilizing different genetic pathways between caves8,12,13,14,15. This repeated evolution is a powerful aspect of the A. mexicanus system and can provide insight into the more general question of how genetic systems may be perturbed to generate similar phenotypes. 

While the application of genetic technology for the mechanistic investigation of gene function has been limited in many fish species (including A. mexicanus), recent advances in the zebrafish provide a basis for genetic technology development in fish16,17,18,19,20. Numerous tools are widely used in zebrafish to manipulate gene expression, and the implementation of these procedures have long been standardized. For example, the injection of morpholino oligos (MOs) at the single-cell stage selectively blocks RNA and prevents translation for a brief temporal window during development21,22. In addition, gene-editing approaches, such as clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) and transcription activator-like effector nuclease (TALEN), allow for the generation of defined deletions or, in some cases, insertions through a recombination in genomes19,20,23,24. Transgenesis is used to manipulate stable gene expression or function in a cell-type specific manner. The Tol2 system is used effectively to generate transgenic animals by coinjecting transposase mRNA with a Tol2 DNA plasmid containing a transgene25,26. The Tol2 system utilizes the Tol2 transposase of medaka to generate stable germline insertions of transgenic construct17. Generating Tol2 transgenics involves coinjecting a plasmid containing a transgene flanked by Tol2 integration sites and mRNA for Tol2 transposase17. This system has been used to generate an array of transgenic lines in zebrafish and its use has recently expanded to additional emergent model systems, including cichlids, killifish, the stickleback, and, more recently, the Mexican cavefish27,28,29,30

While the cavefish is a fascinating biological system for elucidating mechanisms of trait evolution, its full capability as an evolutionary model has not been fully harnessed. This has partially been due to an inability to manipulate genetic and cellular function directly31. Candidate genes regulating complex traits have been identified using quantitative trait loci (QTL) studies, but the validation of these candidate genes has been difficult32,33,34. Recently, transient knockdown using morpholinos, gene editing using CRISPR and TALEN systems, and the use of Tol2-mediated transgenesis have been used to investigate the genetic basis underlying a number of traits35,36,37,38. The implementation and standardization of these techniques will allow for manipulations that interrogate the molecular and neural underpinnings of biological traits, including the manipulation of gene function, the labeling of defined cell populations, and the expression of functional reporters. Whereas the successful implementation of these genetic tools to manipulate gene or cellular function has been demonstrated in emergent model systems, detailed protocols are still lacking in A. mexicanus

A. mexicanus provide critical insight into the mechanisms of evolution in response to a changing environment and present the opportunity to identify novel genes regulating diverse traits. A number of factors suggest that A. mexicanus is an extremely tractable model for applying established genomic tools currently available in established genetic models, including the ability to easily maintain fish in the laboratories, large brood size, transparency, a sequenced genome, and defined behavioral assays39. Here, we describe a methodology for the use of morpholinos, transgenesis, and gene editing in surface and cave populations of A. mexicanus. The broader application of these tools in A. mexicanus will allow for a mechanistic investigation into the molecular processes underlying the evolution of developmental, physiological, and behavioral differences between cavefish and surface fish. 

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Morpholino oligo design

NOTE: Sequences for A. mexicanus are available through National Center of Biotechnology Information (NCBI) Gene and NCBI SRA (https://www.ncbi.nlm.nih.gov), as well as from the Ensembl genome browser (https://www.ensembl.org). When designing a morpholino for use in both surface- and cave-dwelling forms, it is critical to identify any genetic variation between the morphs at this stage, so these genetic regions can be avoided as targets for morpholinos. Any polymorphic variation within a morpholino target site can lead to ineffective binding. The design is similar to other fish systems, such as zebrafish, and has previously been shown to work effectively in A. mexicanus21,36,40.

  1. Design of translation-blocking morpholinos
    NOTE: Translation-blocking morpholinos block translation by binding to the endogenous start site and impede translational machinery from binding the mRNA sequence through steric hinderance.
    1. Identify the coding region of the target gene starting with the ATG start site.
    2. Record the first 25 base pairs of the target sequence by copy-and-pasting the sequence in a text editor or lab notebook.
    3. Using either online software (e.g., http://reverse-complement.com) or manual translation, generate the reverse complement of the target sequence. Save the resulting reverse complement in a text editor or lab notebook.
    4. Order a morpholino with the reverse complement sequence from a company that generates morpholino oligonucleotides. See Table of Materials for companies.
  2. Design of splice-blocking morpholinos
    NOTE: Splice-blocking morpholinos block splicing and, thus, prevent the formation of a mature mRNA molecule. This provides an alternative method for knockdown when the start sites are not well-defined, or a more optimal approach when validation of knockdown via polymerase chain reaction (PCR) is desired. This benefit of splice-blocking morpholinos (over ATG-blocking MOs) is that exon exclusion or intron inclusion can be readily assessed with reverse transcriptase (RT)-PCR and size differences visualized on a gel. RT-PCR and gel electrophoresis to determine morpholino efficacy should be done using standard laboratory procedures.
    1. Identify the pre-mRNA sequence of the target gene. Utilize available information from the A. mexicanus genome via NCBI or Ensembl to determine intron-exon boundaries33.
    2. Target exon-intron (splice donor) or intron-exon boundary (splice acceptor) sites for intron inclusion or exon exclusion.
      NOTE: The spliceosome normally targets a “GU” sequence (U1 target) in the intron at the 5' splice site and an AG sequence at the 3' (U2 target) intronic splice site. Under normal conditions, the spliceosome U1 and U2 subunits bind these target sites on the pre-mRNA sequence for proper splicing to occur. However, if either of these target sequences is blocked by a morpholino, the spliceosome will move on to the next available U1 or U2 site, causing either an intron exclusion or exon in the mRNA sequence. This will involve planning/optimization, depending on the nature of the target gene21. Generally, blocking an internal U1 site redirects the splice to the next available U1 site, causing an exon excision. Alternatively, blocking the first or last splice junction causes an intron inclusion because there is no other site to redirect the splice to. Use sequence software to predict the effect of various exclusions versus inclusions. Predictions can indicate potential frameshifts or premature stop codons, indicating a more effective target site for mRNA disruption.
    3. Once the target site is identified, record its sequence in a text editor or lab book. Make sure the target site is 25 base pairs (bp) long.
    4. Using either online software (e.g., http://reverse-complement.com) or manual translation, generate the reverse complement of the target sequence. Record its sequence in a text editor or lab book.
    5. Order a morpholino with the reverse complement sequence from a company that generates morpholino oligonucleotides. See Table of Materials for sample companies.

2. Morpholinos for injection

NOTE: Several concentrations or volumes of MO injection will need to be performed to establish the optimal concentration to inject. Typical injections quantities are 400–800 pg of MO. The effect of morpholino knockdown can persist for up to 6 days postinjection.

  1. Obtain the stock morpholino. The stock morpholino arrives lyophilized. Hydrate it with sterile H2O prior to use at the desired stock concentration (e.g., 4 mM). Store at -20 °C until use.

3. CRISPR gRNA design, in vitro transcription, and preparation

  1. CRISPR gRNA design
    NOTE: gRNAs were generated using previously published research by Varshney et al.40 and Wierson et al.41.
    1. Using a genome browser, identify the coding region of the gene of interest. Using the genomic sequence, identify the gRNA target sequence within an exon by searching for a 20 bp nucleotide target sequencing beginning with GG and followed by a PAM sequence (NGG). A region of the gene after the start (ATG) will be targeted.
      NOTE: If a target sequence with GG at the 5' end cannot be found in the desired exon of the gene, one or both of the Gs can be substituted for the first and second nucleotides at the 5' end of the sequence. However, the two Gs must be incorporated in the oligo, as these are required for T7 transcription.
    2. Design and order a gene-specific oligonucleotide (oligo A: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). Add the gene-specific 20 bp gRNA target sequence (bolded) without the PAM sequence between a T7 promoter sequence (red) and an overlap sequence used to anneal to a second oligonucleotide (blue). Anneal and amplify (see step 3.2.1) this oligo A and a second oligo (oligo B: 5'- GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') to generate the gRNA template used for transcription.
      NOTE: Oligo B is the same for every reaction and need only be ordered 1x.
  2. gRNA preparation and transcription
    1. Anneal and amplify the oligos. Include the following primers to amplify the gRNA in order to increase yield: 5'-TAATACGACTCACTATA-3' (T7 primer) and 5'- GATCCGCACCGACTCGGTG-3' (3' gRNA primer). Perform a PCR using Thermococcus kodakaraensis (KOD) polymerase.
      NOTE: For both primers in oligo A and oligo B, 10 cycles is recommended for a good yield. A detailed protocol can be found in Wierson et al.41.
    2. Transcribe the gRNA using commercially available in vitro transcription kits (see Table of Materials). This is done through modifications to the manufacturers protocol published by Klaassen et al.42.
    3. Precipitate, wash, and resuspend the gRNA as described by Klaassen et al.42.
      NOTE: The gRNA must be resuspended in RNase-free water to prevent degradation.
    4. Record the concentration of the gRNA, which can be determined using a spectrophotometer. Assess the quality of the RNA by running 2 µL on an agarose gel. Aliquot RNA to avoid freeze/thaw and store it at -80 °C until immediately before the injections.
  3. Cas9 preparation and transcription
    1. Cas9 mRNA can be transcribed using commercially available in vitro transcription kits (see Table of Materials) as described previously43. Use the nls-Cas9-nls version43.
    2. Record the concentration of the gRNA and assess its quality by running 2 µL on an agarose gel. Aliquot RNA to avoid decomposition that arises through multiple freeze-thaw cycles, and store the aliquots at -80 °C.

4. Preparation of Tol2 constructs, Tol2 transposase, and transgenesis

  1. Prepare Tol2 transgene constructs for injection.
    NOTE: We have successfully utilized published/available zebrafish and medaka constructs in A. mexicanus. These constructs are fully functional in A. mexicanus, likely because of the high level of sequence homology (refer to the AddGene repository and the Zebrafish Information Network [ZFIN] databases for available constructs). The zebrafish promoter fragments have expressed the transgenes in the expected tissues when used in A. mexicanus.
    1. Acquire Tol2 constructs or generate plasmid with a tissue-specific promoter, the desired transgene, and Tol2 arms (see Kwan et al.44). Upon receipt, sequence the construct to validate the plasmid.
    2. Perform a midiprep for constructs according to the manufacturers guidelines. Elute the final plasmid in RNase-free H2O, determine the concentration with a spectrophotometer, dilute the concentration to 100300 ng/μL, and aliquot and store the constructs at -20 °C.
  2. Digest Tol2 transposase plasmid, and synthesize mRNA.
    1. Obtain a copy of the Tol2 transposase plasmid (pCS-zT2TP) as a template for generating Tol2 mRNA45.
    2. Midiprep the pCS-zT2TP construct according to the manufacturers guidelines. Elute it in a low volume of RNase-free water or buffer (~50 μL). Store the aliquots at -20 °C.
    3. Digest the Tol2 plasmid using a restriction enzyme.
      1. Perform a restriction digest on 10 µg of circular pCS-zT2TP plasmid using Table 1.
      2. Split the reaction into 250 μL reactions and incubate the reactions overnight at 37 °C in a thermal cycler.
      3. On the following day, inactivate the enzyme by heating it to 65 °C for 20 min.
      4. Purify linearized plasmid immediately following the digest, using commercially available PCR purification kits (see Table of Materials) per the manufacturers guidelines. Elute the plasmid in 15 μL of RNase-free H2O and determine the concentration of the product using a spectrophotometer.
      5. Run 1 μL of digested plasmid and 1 μL of uncut plasmid on a 1.5% agarose gel to confirm linearized plasmid.
    4. Perform an in vitro transcription of Tol2 mRNA.
      1. Utilize 1 µg of linearized pCS-zT2TP plasmid as a template for transcription. Follow the manufacturers guidelines for in vitro transcription (see Table of Materials) as described in Table 2.
      2. Incubate at 37 °C in a thermal cycler per the manufacturers guidelines.
      3. Add 1 µL of DNase, incubate it at 37 °C in a thermal cycler per the manufacturers guidelines.
      4. Perform lithium chloride precipitation per transcription kit protocol. Resuspend the RNA pellet in ~2030 μL of RNase-free H2O.
      5. Determine the concentration of the product by using a spectrophotometer and record the RNA quality.
      6. Dilute the product to ~100300 ng/µL and aliquot it into 510 μL samples to avoid repeated freeze-thaw. Store them at -80 °C until use.
        NOTE: It is possible to check 12 µL of purified Tol2 mRNA for smear/band with gel electrophoresis.

5. Microinjections

  1. Preparation of general tools for injections
    NOTE: The procedures in this section have been described in detail by Kowalko et al.46, and an overview with minor modifications is presented here.
    1. Generate injection plates by pouring warm 3% agarose dissolved in fish system water into a 100 mL Petri dish. Carefully place an egg injection mold in the freshly poured agarose to make wells for the fish eggs. Place the side of the mold in agar at a 45° angle and, then, slowly lower it into the agarose; slowly lowering the mold at an angle avoids air getting trapped underneath the mold. Gently remove the mold once the agarose is solidified. The plates can be stored, sealed, at 4 °C for up to 1 week.
    2. Pull needles from borosilicate glass capillaries for injection in an electrode/needle puller according to the manufacturers guidelines. This protocol will vary per pipette puller; however, a sample needle-pulling program can be found in Table 3.
      NOTE: Optimizing the needle is important for injections, as needles that are too long will bend rather than cleanly penetrate the egg.
    3. Make large-bore glass pipettes for the egg transfer by breaking standard glass pipettes so the opening is large enough for the eggs. Using a Bunsen burner, polish the broken end of the glass by exposing the end of the broken pipettes to the flame until it is smooth.
  2. Breeding setup
    NOTE: There are many different protocols used for breeding A. mexicanus. For a detailed protocol, see Borowsky39. Start the breeding setup 1 week prior to the injections.
    1. On day 1, place two to three females and three to four males in a single 10 gallon tank maintained at 24 ± 1 °C.
    2. On days 17, increase the feeding to ~3x a day. Ensure the diet includes live food, such as black worms and brine shrimp.
    3. On day 6, add a single tank heater set to 27 °C. Lab tank temperatures can vary; therefore, this will be an increase of 23 °C relative to the normal tank temperature.
    4. On the evening of day 7, which is the evening (zeitgeber [ZT] 911) of injection night, thoroughly clean the tanks with a water-soaked sponge and remove any excess food or debris using a fine mesh net or a siphon.
    5. On the night of day 7, start checking for surface fish eggs at ZT15 and continue to check every 1530 min until ZT18. For cavefish, start checking for eggs at ZT17 and continue to check every 1530 min until ZT20.
      NOTE: The times are based on a 14:10 h light:dark cycle using zeitgeber time. Breeding times are estimates and individual labs must determine exact times. It is critical to collect eggs soon after they are released/fertilized in order to inject them at the single-cell stage.
  3. Collection of single-cell stage eggs
    1. The night in which breeding is expected, examine the tanks every 1530 min and monitor for eggs at the bottom of the tank. Eggs appear translucent, measuring approximately 1 mm in diameter.
    2. Use a fine mesh fish net to collect eggs and transfer them to a glass bowl filled with fresh fish system water. Examine the eggs under a microscope to confirm that the eggs are at the one-cell stage.
    3. Using glass pipettes, transfer single-cell eggs to the injection plates. Glass pipettes are required at this stage as the eggs will stick to plastic.
    4. Using a pipette, carefully release the eggs into the wells of the agarose injection plate from section 5.1. Fill the rows of the prewarmed (at room temperature) injection plate with the maximum number of eggs (3040 per row, and up to five rows). Full rows help keep the eggs from moving during injections. Keep the eggs hydrated on the injection plate with a small amount of fish system water until the performance of the injections.
  4. Pico-injection setup and general injection optimization guidelines
    1. Backfill the injection needles using either gel-loading pipette tips that fit inside the capillary or using standard micropipette tips and adding a 24 µL bolus to the end. Once the needle is filled, use forceps to trim the excess length from the injection needle.
    2. Perform microinjections using a needle mounted in a micromanipulator, connected to a picoliter microinjector.
    3. Set the injection time to 0.03 s and the pressure out at ~0.0 psi. The injection pressure will vary accordingly with minor differences between needles, so optimize to achieve a ~1.0 nL injection bolus.
      NOTE: The injection pressure is often in the range of ~1030 psi.
    4. Standardize the injection bolus by injecting into mineral oil and measuring the bolus size with a slide micrometer to achieve a ~11.5 nL injection volume. Adjust the injection pressure (psi) to increase or decrease the bolus volume.
    5. Draw water off of the very top of the eggs using a lab tissue.
      NOTE: The Astyanax egg chorion is slightly tougher to penetrate than zebrafish eggs. We find that drawing the water off of the top of the eggs helps facilitate needle penetration into the egg. Plate optimization can allow for ~200 eggs on a single plate.
    6. Use the micromanipulator to penetrate each egg with the needle, and inject directly into the yolk. Once positioned in the yolk, inject the egg by pressing the inject button or injection foot pedal.
      ​NOTE: A full plate can be injected within ~15 min. The single-cell stage lasts for ~40 min.
  5. Injection of morpholinos
    NOTE: The amount of morpholino necessary for knockdown without causing toxicity will need to be optimized per gene target; however, a concentration of 400 pg is a good place to start.
    1. Prepare morpholino so that 400 pg of morpholino will be injected per egg. Thaw morpholino on ice. The injection solution is comprised of morpholino (at the desired concentration), RNase-free H2O or Danieaus solution, and phenol red (10% of the final volume). For an example, see Table 4.
    2. Inject 1 nL per embryo.
  6. CRISPR injections
    1. Prepare RNA so that 25 pg of gRNA and 300 pg of Cas9 mRNA total will be injected per embryo. For a sample CRISPR/Cas9 injection mixture, see Table 5.
    2. Inject 2 nL of gRNA/Cas9 mRNA per embryo directly into the embryo.
  7. Injection of Tol2 transposase and Tol2-flanked plasmid for transgenesis
    1. Thaw transposase mRNA and Tol2 plasmid on ice. Combine Cas9 mRNA (at 25 ng/µL), desired Tol2 construct (at 25 ng/μL), and phenol red (10% of the final volume) in RNase-free water. For a sample Tol2 transgenesis injection mixture, see Table 6.
    2. Keep the injection solution and needles on ice to avoid the degradation of mRNA. Inject at 1 nL in volume per embryo.

6. Rearing and screening injected fish

  1. Injected fish husbandry
    1. After the eggs are injected, immediately transfer them to glass bowls (10 x 5 cm) filled with ~200 mL of fish system water. Eggs are easily rinsed by dipping the injection plates into bowls filled with fish water and rinsing the eggs with a pipette.
    2. Place ~5080 injected embryos per bowl and rear them at 2224 °C.
    3. Clean the bowls with injected fish 2x per day to remove dead embryos and change ~20% of the water on a daily basis.
    4. Additional rearing is performed in accordance with previously published protocols39.
  2. Screening of morpholino-injected individuals
    1. Visualize the animals under a stereomicroscope to screen for phenotypes. The effect of morpholinos can persist up to ~5 days postinjection21.
    2. Measure behavioral phenotypes at 4 days postinjection.
  3. Screening for CRISPR indels
    1. Design primers to amplify genomic DNA around the target site. Design primers so that the target PCR product is approximately 100125 bp.
      NOTE: For example, for the oca2 locus, the region surrounding the gRNA target site was amplified using the forward primer 5'-CTCCTCTGTCAGGCTGTGC-3' and the reverse primer 5'- GAAGGGGATGTTGTCTATGAGC-3' for a PCR product length of 105 bp.
    2. Sacrifice embryos or fin clip adult fish according to the institutional animal protocol.
    3. Collect embryos or dissected fins into PCR tubes and extract DNA and perform PCRs. Sample PCR protocols for gene-specific primers can be found in Ma et al.35.
    4. To assess for mutagenesis, run 5 µL of PCR product on a 3% agarose gel at 70 V for 3 h. Wild-type (nonmutagenized) DNA will result in a PCR product as a distinct band. Mutant DNA will result in a smeary band on the gel.
    5. To determine the sequence of mutant alleles, TA clone the PCR product according to the manufacturers instructions, pick colonies, and miniprep cultures. Send the resulting DNA for sequencing.
    6. To establish and maintain lines of fish transmitting mutant alleles, cross adult injected fish to wild-type fish, and screen 510 embryos to determine if any of the progeny carry a mutant allele of the gene following steps 6.3.1-6.3.6.
      NOTE: Different F1 individuals from the same F0 founder fish can carry different mutations. Ensure mutant lines are sequenced to obtain mutations predicted to produce alleles that are out of frame.
    7. Identify fish carrying a mutant allele by PCR using the smeary band assay (steps 6.3.1-6.3.6) or by designing allele-specific PCR primers that will amplify mutant and wild-type bands (Figure 2C).
    8. Once a line of fish is established, homozygose mutant alleles to test for recessive phenotypes.
  4. Screening for transgenic positive individuals
    NOTE: Using constructs containing a fluorescent maker is recommended to streamline the screening for transgenic positive individuals. However, standard PCR screening methods can be used to screen for transmission.
    1. Visualize tissue-specific fluorescent proteins in F0 fish as early as 2 days postinjection, with an epifluorescence dissecting scope.
      NOTE: The expression in F0 larvae is mosaic, and positive individuals may have a range of expression phenotypes.
    2. Keep positive individuals as F0 founder fish.
    3. When F0s reach maturity, backcross founding fish to nontransgenic individuals derived from the same population/lab stock. Screen F1 offspring using the same protocol as described in step 6.2.
      NOTE: The expression in F1 larvae is uniform and ensures consistency among F1 siblings.
    4. Since Tol2 integration is not site-mediated and integration can vary among founders, select F1 siblings derived a single F0 founder and interbreed positive-expressing F1 siblings to generate F2s. This offspring will be the basis for a stable line.

Access restricted. Please log in or start a trial to view this content.

Results

Multiple populations of cave-dwelling A. mexicanus show reduced sleep and increased wakefulness/activity relative to their surface-dwelling conspecifics14. Hypocretin/orexin (HCRT) is a highly conserved neuropeptide, which acts to increase wakefulness, and aberrations in the HCRT pathway cause narcolepsy in humans and other mammals47,48. We have previously demonstrated that cave A. mexicanus have increased expression of H...

Access restricted. Please log in or start a trial to view this content.

Discussion

Here, we provided a methodology for manipulating gene function using morpholinos, CRISPR/Cas9 gene editing, and transgenesis methodology. The wealth of genetic technology and the optimization of these systems in zebrafish will likely allow for the transfer of these tools into A. mexicanus with ease52. Recent findings have used these approaches in A. mexicanus, but they remain underutilized in the investigation of diverse morphological, developmental, and behavioral traits in this...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors thank Sunishka Thakur for her assistance in genotyping and imaging the oca2 mutant fish depicted in Figure 2. This work was supported by National Science Foundation (NSF) award 1656574 to A.C.K., NSF award 1754321 to J.K. and A.C.K., and National Institutes of Health (NIH) award R21NS105071 to A.C.K. and E.R.D.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Fish breeding & egg supplies
Fine mesh fish netPenn PlaxBN4
Fish tank heaterAqueon100106108
Egg trapsCustom madeNADesign and create plastic grate to place at bottom of tank to protect eggs
Glass pipettesFisher Scientific13-678-20C
Pipette bulbsFisher Scientific03-448-21
AgaroseFisher ScientificBP160-500
Egg moldsAdaptive Science ToolsTU-1
Morpholino supplies
Control MorpholinoGene Tools, LLCStandard control olio
Custom MorpholinoGene Tools, LLCNA
Phenol RedSigma AldrichP0290-100ML
CRISPR supplies
Cas9 PlasmidAddGene46757
GoTaq DNA PolymerasePromegaM3001
KOD Hot Start TaqEMD Millipore71-842-3
PrimersIntegrated DNA TechnologiesCustom
T7 Megascript KitAmbion/ThermofisherAM1333
miRNeasy KitQiagen217004
mMessage mMachine T3 kitAmbion/ThermofisherAM1348
MinElute KitQiagen28204
Tol2 transgenesis supplies
pCS-zT2TP plasmidKawakami et al., 2004Request from senior author
CutSmart BufferNew England BiolabsB7204
NotI-HF Restriction EnzymeNew England BiolabsR3189
PCR purification KitQiagen28104
SP6 mMessenger KitAmbion/ThermofisherAM1340
Microinjection supplies
Glass Capillary TubesSutter InstrumentsBF100-58-10
Pipette pullerSutter InstrumentsP-97
PicoinjectorWarner InstrumentsPLI-100A
MicromanipulatorWorld Precision InstrumentsM3301R
Micromanipulator StandWorld Precision InstrumentsM10
Micmanipulator BaseWorld Precision InstrumentsSteel Plate Base, 10 lbs

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. , D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. , Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. , (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9 (9), e107877(2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112 (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20 (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105(2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23 (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23 (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21 (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. , (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80 (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97 (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. , (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24 (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6 (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. , (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. , (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. , (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234 (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174 (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8 (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11 (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055(2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11 (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. , Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307(2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13 (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10 (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8 (11), e80823(2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808(2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637(2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3 (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. , (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. , (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110 (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236 (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7 (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113(2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. , (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. , (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227 (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. , (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11 (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5 (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637(2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. , (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. , (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841(2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46 (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11 (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11 (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20 (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4 (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. , (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. , (2018).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Gene ManipulationMorpholino InjectionCRISPR Gene EditingTol2 TransgenesisMicroinjection ProcedureEmbryo CollectionPhenotype ScreeningDNA ExtractionCalcium Imaging