Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Genetische modificatie van cyanobacteriën door conjugatie met behulp van de CyanoGate modulaire kloon Toolkit

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Hier presenteren we een protocol met een beschrijving van hoe ik) een zelfreplicerende vector met behulp van de cyanogate modulaire kloon Toolkit, II), introduceren de vector in een cyanobacterial gastheer door conjugatie, en III) karakteriseren transgene cyanobacteriën stammen met behulp van een plaat lezer of flow cytometrie.

Abstract

Cyanobacteria zijn een gevarieerde groep prokaryotische fotosynthetische organismen die genetisch gemodificeerd kunnen worden voor de hernieuwbare productie van nuttige industriële grondstoffen. Recente ontwikkelingen in de synthetische biologie hebben geleid tot de ontwikkeling van diverse kloon toolkits zoals cyanogate, een gestandaardiseerd modulair kloon systeem voor het bouwen van plasmide vectoren voor latere transformatie of echtelijke overdracht in cyanobacteriën. Hier schetsen we een gedetailleerde methode voor het assembleren van een zelf-replicerende vector (bijv. met een fluorescerende marker Expression cassette) en echtelijke overdracht van de vector in de cyanobacteriële stammen synechocystis SP. PCC 6803 of synechococcus elongatus utex 2973. Daarnaast beschrijven we hoe u de prestaties van een genetisch deel (bijv. een promotor) karakteriseren met behulp van een plaat lezer of Flowcytometrie.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cyanobacteriën zijn autotrofische bacteriën die kunnen worden gebruikt voor de biosynthese van een breed scala aan natuurlijke en heterologeuze hoge waarde metabolische producten1,2,3,4,5, 6. Er moeten nog verschillende hindernissen worden overwonnen om hun commerciële levensvatbaarheid te vergroten, met name de relatief slechte opbrengsten in vergelijking met heterotrofische bio-platformen (bijv. Escherichia coli en gist)7. De recente uitbreiding van de beschikbare genetische manipulatie tools en de opname van het synthetische biologie paradigma in cyanobacteriaal onderzoek helpt om dergelijke uitdagingen te overwinnen en cyanobacteriën verder te ontwikkelen als efficiënte biofabrieken8, 9,10.

De belangrijkste benaderingen voor de introductie van DNA in cyanobacteriën zijn transformatie, conjugatie en elektroporation. De vectoren die door transformatie of elektroporation naar cyanobacteriën worden overgebracht, zijn "zelfmoord vectoren" (d.w.z. integratieve vectoren die homologe recombinatie mogelijk maken), terwijl zelfreplicerende vectoren kunnen worden overgebracht naar cyanobacteriën door transformatie, conjugatie of elektroporation. Voor de eerste, een protocol is beschikbaar voor de technische model soorten die geschikt zijn voor natuurlijke transformatie11. Meer recentelijk is een modulaire kloon (MoClo) Toolkit voor cyanobacteriën genaamd CyanoGate ontwikkeld die een gestandaardiseerde Golden Gate vector assemblage methode gebruikt voor engineering met behulp van natuurlijke transformatie, elektroporation of conjugatie12.

Golden Gate-type assemblage technieken zijn in de afgelopen jaren steeds populairder geworden, en assemblage standaarden en deel bibliotheken zijn nu beschikbaar voor een verscheidenheid aan organismen13,14,15,16 ,17. Golden Gate gebruikt type IIS restrictie enzymen (bijv. bsai, bpii, bsmbi, btgzi en AarI) en een pak acceptoren en unieke uitsteeklengten om directionele hiërarchische assemblage van meerdere sequenties in een "One pot" assembly reactie te faciliteren. Type IIS restrictie enzymen herkennen een unieke asymmetrische sequentie en knippen een gedefinieerde afstand van hun herkennings locaties om een gespreide, "Sticky end" snede te genereren (meestal een 4 nucleotide [NT] overhang), die vervolgens kan worden benut om bestelde DNA te bestellen montage reacties15,18. Dit heeft de ontwikkeling vergemakkelijkt van grote bibliotheken van modulaire niveau 0-onderdelen (bijv. promotors, open reading frames en terminators) gedefinieerd door een gemeenschappelijke syntaxis, zoals de PhytoBricks Standard19. Niveau 0-onderdelen kunnen dan gemakkelijk worden geassembleerd in Expression cassettes van niveau 1, waarna complexere hogere bestel assemblages (bijvoorbeeld multigene Expression constructies) kunnen worden ingebouwd in een accepterende vector van keuze12,15. Een belangrijk voordeel van Golden Gate-type assemblage technieken is hun geschiktheid voor automatisering bij High-throughput faciliteiten, zoals DNA-gieterijen20,21, die kunnen leiden tot het testen van complexe experimentele ontwerpen die kan niet gemakkelijk worden bereikt door handmatige arbeid.

Cyanogate bouwt voort op de gevestigde plant moclo System12,15. Om een nieuw onderdeel in CyanoGate op te nemen, moet de deel volgorde eerst gedomesticeerd worden, d.w.z. "illegale" herkennings locaties voor BsaI en BpiI moeten worden verwijderd. In het geval van een deel codering voor een open Lees frame (d.w.z. een codeer volgorde, CD'S), kunnen herkennings plaatsen worden verstoord door het genereren van synoniemen mutaties in de sequentie (d.w.z. het veranderen van een codon naar een alternatief dat codeert voor hetzelfde aminozuur residu). Dit kan worden bereikt door een verscheidenheid aan benaderingen, variërend van DNA-synthese tot polymerase chain reaction (PCR) amplificatie strategieën zoals Gibson assembly22. Afhankelijk van de uitdrukkings gastheer die wordt gebruikt, moet worden gezorgd om de introductie van zeldzame Codons te voorkomen die de efficiëntie van translatie23kunnen remmen. Het verwijderen van herkennings locaties in promoter en Terminator-reeksen is meestal een risicovollere inspanning, omdat wijzigingen de functie kunnen beïnvloeden en het onderdeel mogelijk niet zoals verwacht presteert. Bijvoorbeeld, veranderingen in de putatieve transcriptiefactor binding sites of de ribosoom binding site binnen een organisator kunnen de kracht en het reactievermogen op inductie/onderdrukking veranderen. Evenzo kunnen wijzigingen in belangrijke Terminator-structurele kenmerken (bijv. de GC Rich stam, lus en poly-U tail) de terminatie efficiëntie en het effect van genexpressie24,25veranderen. Hoewel er verschillende online bronnen beschikbaar zijn om de activiteit van de Promoter-en Terminator-sequenties te voorspellen en te informeren of een voorgestelde mutatie invloed zal hebben op de prestaties26,27, zijn deze gereedschappen vaak slechte voorspellers van prestaties in cyanobacteriën28,29,30.. Als zodanig wordt in vivo de karakterisering van gewijzigde delen nog steeds aanbevolen om de activiteit te bevestigen. Om te helpen bij het klonen van recalcitrante sequenties, bevat cyanogate een lage kopie kloon acceptor vector gebaseerd op de biobrick vector pSB4K512,16,31. Verder is er een "Design and build" portaal beschikbaar via de Edinburgh Genome Foundry om te helpen met Vector Design (dab.genomefoundry.org). Tot slot, en nog belangrijker, bevat CyanoGate twee niveau T acceptor vector ontwerpen (equivalent aan niveau 2 acceptor vectoren)15 voor de invoering van DNA in cyanobacteriën met behulp van zelfmoord vectoren, of brede host-Range vectoren die in staat zijn zelfreplicatie in verschillende cyanobacteriële soorten32,33,34.

Hier zullen we ons concentreren op het beschrijven van een protocol voor het genereren van niveau T zichzelf replicerende vectoren en de genetische modificatie van synechocystis pcc 6803 en Synechococcus elongatus Utex 2973 (synechocystis PCC 6803 en S. elongatus Utex 2973 hierna) door conjugatie (ook bekend als Tri-Parental paring). Conjugal overdracht van DNA tussen bacteriële cellen is een goed beschreven proces en is eerder gebruikt voor technische cyanobacteriële soorten, in het bijzonder die welke niet van nature competent zijn, zoals S. elongatus utex 297335, 36,37,38,39,40,41. In het kort worden cyanobacteriële culturen geïnnobeerd met een E. coli stam die de vector draagt die moet worden overgebracht (de "lading" vector) en vectoren (hetzij in dezelfde E. coli stam of in extra stammen) om conjugatie mogelijk te maken ("mobilizer" en "helper" vectoren). Er zijn vier belangrijke voorwaarden vereist voor de overdracht van conjugaat: 1) direct contact tussen cellen die betrokken zijn bij DNA-overdracht, 2) de lading vector moet verenigbaar zijn met het conjugatiesysteem (d.w.z.moet een geschikte herkomst van de overbrenging bevatten; ook bekend als een bom (basis van mobiliteit) site), 3) een DNA-nikkel-eiwit (bijv. gecodeerd door het Mob -gen) dat het DNA van de orit om één streng overdracht van het DNA in het cyanobacterium te initiëren moet aanwezig zijn en uitgedrukt van de lading of de hulp vectoren, en 4) het overgedragen DNA mag niet worden vernietigd in de ontvangende cyanobacterium (d.w.z. moet resistent zijn tegen afbraak door bijvoorbeeld een restrictie-activiteit van de endonuclease)35,42. Om de lading vector te behouden, moet de oorsprong van de replicatie verenigbaar zijn met de ontvanger cyanobacterium om zelfreplicatie en proliferatie in dochtercellen na de splitsing mogelijk te maken. Om te helpen met de voorwaarden 3 en 4, zijn verschillende hulp vectoren beschikbaar via addgene en andere commerciële bronnen die coderen voor Mob en verschillende methylases om te beschermen tegen inheemse enzym in de gastheer cyanobacterium43. In dit protocol werd conjugatie vergemakkelijkt door een MC1061 E. coli stam met mobilizer en helper vectoren pRK24 (www. addgeneorg/51950) en pRL528 (www.addgene.org/58495), respectievelijk. Zorg moet worden genomen bij het kiezen van de vectoren te gebruiken voor echtelijke overdracht. Bijvoorbeeld, in de CyanoGate Kit de zelf-replicerende Cargo vector pPMQAK1-T codeert voor een Mob proteïne12. Echter, pSEVA421-T niet44, en als zodanig, Mob moet worden uitgedrukt uit een geschikte helper vector. De gebruikte vectoren moeten ook geschikt zijn voor het doelorganisme. Efficiënte echtelijke overdracht in Anabaena SP. PCC 7120 vereist bijvoorbeeld een hulp vector die de mobilizer vector beschermt tegen de spijsvertering (bijv. pRL623, die codeert voor de drie methylases avaim, Eco47iiM en Ecot22iM)45, 46.

In dit protocol beschrijven we verder hoe de prestaties van onderdelen (d.w.z. promotors) karakteriseren met een fluorescerende marker met behulp van een plaat lezer of een flow-cytometer. Flow-Cytometers kunnen fluorescentie op één celbasis meten voor een grote populatie. Bovendien stellen Flow Cytometers gebruikers in staat om de verkregen gegevens te "hek" en achtergrondruis te verwijderen (bijvoorbeeld van deeltjes in de cultuur of verontreiniging). Plaat lezers krijgen daarentegen een geaggregeerde fluorescentie meting van een bepaald volume cultuur, meestal in verschillende replicaatputten. De belangrijkste voordelen van plaat lezers boven Cytometers zijn de lagere kosten, hogere beschikbaarheid en meestal geen vereiste voor specialistische software voor downstream data-analyses. De belangrijkste nadelen van plaat lezers zijn de relatief lagere gevoeligheid in vergelijking met Cytometers en mogelijke problemen met de optische dichtheid van gemeten culturen. Voor vergelijkende analyses moeten plaat lezers monsters voor elke put worden genormaliseerd (bijvoorbeeld voor een meting van de cultuur dichtheid, gewoonlijk genomen als de extinctie bij de optische dichtheid bij 750 nm [OD750]), wat kan leiden tot onnauwkeurigheden voor monsters die te dicht en/of niet goed gemengd (bijv. Wanneer het gevoelig is voor aggregatie of flocculatie).

Als een overzicht tonen we hier in detail de principes van het genereren van niveau 0-onderdelen, gevolgd door hiërarchische assemblage met behulp van de cyanogate-Kit en klonen in een vector die geschikt is voor echtelijke overdracht. Vervolgens demonstreren we het echtelijke overdrachtsproces, selectie van Axenische-transconjugerende stammen die een fluorescerende marker uitdrukken, en daaropvolgende overname van fluorescentie gegevens met behulp van een flow-cytometer of een plaat lezer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. vector assemblage met behulp van de plant MoClo en CyanoGate toolkits

Opmerking: voordat u doorgaat met de vector assemblage, is het sterk aanbevolen dat gebruikers zich vertrouwd maken met de vector niveau structuren van de plant en cyanogate moclo systemen12,15.

  1. Bouw van onderdelen van niveau 0
    Opmerking: onderdelen van niveau 0 kunnen worden gesynthetiseerd als volledige vectoren of als lineaire sequenties voor assemblage met niveau 0 acceptoren (bijv. gblocks, IDT). Als alternatief kunnen sequenties worden versterkt vanuit een bronsjabloon (bijv. een vector of gezuiverd genomisch DNA). Hier wordt beschreven hoe u een nieuw niveau 0-onderdeel van een versterkt product genereert. Een overzicht van het Golden Gate-assemblageproces van niveau 0 tot niveau T wordt weergegeven inFiguur 1.
    1. Ontwerp de primers.
      1. Bepaal welke module van niveau 0 te monteren en identificeren van de juiste 5 ′ en 3 ′ uitsteeklengten (tabel 1)12,15. Controleer de DNA-sequentie te klonen voor de aanwezigheid van BpiI of BsaI restrictie sites.
        Opmerking: een reeks met een van deze sites moet worden gedomesticeerd door een of meer NTs in de beperkings site volgorde te wijzigen. Een strategie om dit te doen met behulp van Golden Gate assembly is uiteengezet in Figuur 2.
      2. Om een DNA sequentie te versterken, ontwerpt u een geschikte voorwaartse en omgekeerde primer. Selecteer voor de voorwaartse primer 18 − 30 BP complementair aan het 5 ′-uiteinde van de DNA-template sequentie. Voor de omgekeerde primer, selecteer 18 − 30 BP reverse complementair aan het 3 ′-uiteinde van de DNA-template sequentie.
        Opmerking: primers met smelttemperaturen (Tm) van 58 − 62 °c geven doorgaans de meest consistente versterkings resultaten (Figuur 1A).
      3. Voeg het volgende toe aan het 5 ′-uiteinde van de voorwaartse primer: 1) een willekeurige reeks van 4 − 6 NTS aan het 5 ′-uiteinde van de bpii-site, 2) de bpii-beperkings site (gaagac), 3) twee willekeurige NTS en 4) de 5 ′-uitsteeklengte geselecteerd in stap 1.1.1.1. Voeg het volgende toe aan het 5 ′-uiteinde van de omgekeerde primer: 1) een willekeurige reeks van 4 − 6 NTS aan het 5 ′-uiteinde van de bpii-site, 2) de bpii-beperkings site (gaagac), 3) twee willekeurige NTS en 4) de 3 ′-uitsteeklengte geselecteerd in stap 1.1.1.1. Bij het afronden, bestel de primer paren.
        Opmerking: Zie afbeelding 1a voor een voorbeeld van een voorwaartse en omgekeerde primer paar.
    2. Vergroot een DNA sequentie van genomisch DNA.
      1. Extract genomisch DNA zoals beschreven in rubriek 5. Amplify producten door PCR met behulp van een high-fidelity DNA-polymerase (tabel van materialen).
        Opmerking: Stel als voorbeeld PCR-reacties (20 − 50 μL) in volgens de instructies van de fabrikant. Gebruik ~ 100 ng van genomisch DNA per reactie. Gebruik een thermisch fiets programma bestaande uit een initiële denaturatiestap van 98 °C gedurende 30 sec., gevolgd door niet meer dan 25 cycli denaturatie bij 98 °C gedurende 10 sec., primer gloeien bij 58 °C gedurende 15 sec. en productuitbreiding bij 72 °C gedurende 30 sec. (Wijzig de laatste afhankelijk van de grootte van het product/type van de gebruikte DNA-polymerase), gevolgd door een laatste uitbreidings stap van 72 °C gedurende 2 minuten.
      2. Als het PCR-product gel gezuiverd moet worden, voer dan de volledige PCR-reactie uit op een agarose-gel zoals beschreven in rubriek 6. Snijd de band van de interesse uit de agarose-gel en reinig deze met behulp van een gel-extractie Kit (tabel met materialen).
      3. Alternatief voor stap 1.1.2.2, als het PCR-product zonder gelzuivering moet worden gebruikt, controleer dan de band grootte door een aliquot van het PCR-reactie monster (~ 5 μL) op een agarose-gel uit te voeren. Als de gel alleen de juiste band en geen aanwijzingen voor primer dimers vertoont, zuivert dan het PCR-product met behulp van een DNA-zuiverings pakket (tabel met materialen).
      4. Elute gezuiverd DNA in een klein volume gedeïoniseerd water (bijv. 10 μL) om een hoge DNA-concentratie te verkrijgen (> 20 ng/μL is doorgaans voldoende).
    3. Monteer het versterkte DNA-product (of de producten, Zie Figuur 2) in niveau 0. Bereid een reactiemengsel van 20 μL met BpiI (Figuur 1b) en stel het Thermal cycler-programma in zoals beschreven in tabel 2. Ga door naar E. coli transformatie met 5 μL van de samengevoegde level 0-reactiemix (zoals beschreven in rubriek 2).
  2. Bouw van niveau 1-assemblages
    1. Bepaal welke onderdelen van niveau 0 moeten worden geassembleerd (Figuur 1C en tabel 1). Kies een geschikte Level 1 acceptor Vector15.
      Opmerking: in dit stadium is het belangrijk om te weten wat het uiteindelijke vector ontwerp in niveau T zal zijn, omdat dit invloed heeft op de keuze van niveau 1 acceptor vector. Niveau 1 positie 1 (voorwaarts) acceptor vector (pICH47732) kan als standaard worden gebruikt als het doel is om één niveau 1-assemblage (bijvoorbeeld een genexpressie cassette) in niveau T te hebben. Indien echter twee of meer assemblages van niveau 1 in niveau T moeten worden geassembleerd, moeten de positie en de richting van elk niveau 1-assemblage in aanmerking worden genomen. Tot zeven niveau 1-assemblages kunnen worden geassembleerd in een niveau T acceptor vector met behulp van niveau 1 acceptor vectoren met passende posities12.
    2. Monteer de niveau 0-onderdelen in niveau 1. Bereid een reactiemix van 20 μL met BsaI en stel het Thermal cycler-programma in zoals beschreven in tabel 2. Ga door naar E. coli transformatie met behulp van 5 μL van de gemonteerde reactie mix van niveau 1 (zoals beschreven in rubriek 2).
  3. Bouw van de niveau T-assemblages
    1. Bepaal welke assembly's van niveau 1 moeten worden geassembleerd (Figuur 1D). Kies een geschikte niveau T acceptor vector.
      Opmerking: pUC19A-T (ampicillaire resistentie) en pUC19S-T (spectinomycine resistentie) zijn high-Copy nummer integratieve vectoren die niet in staat zijn om te repliceren in cyanobacteriën en worden voornamelijk gebruikt voor genomische integratie (d.w.z. knock-in of knock-out van genen) via homologeuze recombinatie12. De levering van integratieve vectoren kan doorgaan met natuurlijke transformatie in niet-ontvankelijk cyanobacteriële soorten11. pPMQAK1-T is een breed hostbereik, replicatieve vector dat wordt geleverd door echtelijke overdracht (sectie 3).
    2. Kies een geschikte Eindkoppeling om het 3 ′-uiteinde van de laatste niveau 1-assemblage te koppelen aan de niveau T-backbone15.
      Opmerking: de vereiste Eindkoppeling is hetzelfde nummer als de positie van het laatste deel. Een niveau T-vector met slechts één niveau 1 (voorwaarts of omgekeerd)-onderdeel vereist bijvoorbeeld end-link 1 (pICH50872) voor ligatie in de niveau T-backbone.
    3. Assembleer een of meer niveau 1-assemblages in niveau T. bereid een reactiemix voor met BpiI en de vereiste Eindkoppelings vector en stel het Thermal cycler-programma in zoals beschreven in tabel 2. Ga door naar E. coli transformatie met 5 μL van de gemonteerde niveau T-reactiemix (zoals beschreven in rubriek 2).

2. E. coli transformatie en vector zuivering

  1. E. coli transformatie (dag 1)
    1. Ontdooi een aliquot (~ 25 μL) chemisch competente E. coli cellen (tabel met materialen) en Pipetteer zachtjes in een tube van 1,5 ml op ijs. Voeg 5 μL van de assemblage mix (niveau 0, 1 of T) toe en inbroed de buis op ijs voor nog eens 30 − 60 minuten.
    2. Warmte-schok cellen door de buis in een waterbad op 42 ° c voor 30 s te bebroed, plaats de buis dan 2 minuten terug op het ijs. Voeg kamertemperatuur (RT) Super optimale bouillon toe met van repressie (S.O.C.) medium (250 μL) op de buis. Incuberen de buis bij 37 °C gedurende 1 uur bij 225 rpm in een schud incubator.
    3. Plaat 40 μL van de kweek op een LB agar-plaat met de juiste eindconcentratie van antibiotica (100 μg/mL voor spectinomycinedihydrochloride pentahydraat [niveau 0], 100 μg/mL carbenicilinedinatrium [niveau 1] of 50 μg/mL kanamycine sulfaat [ Niveau T]), 1 mM Isopropyl-Beta-D-thiogalactopyranoside (IPTG) en 40 μg/mL 5-broom-4-Chloro-3-indolyl-β-D-galactopyranoside (X-Gal) voor blauw-witte screening. Incuberen de plaat 's nachts bij 37 °C.
      Opmerking: de hoeveelheid geplateerde cultuur kan variëren afhankelijk van de efficiëntie van de E. coli competente cellen en de ligatie reactie. Plaat een groter volume als < 10 kolonies worden waargenomen na een nachtelijke incubatie.
  2. Selectie van witte kolonies en bereiding van vloeibare culturen (dag 2)
    Opmerking: afhankelijk van de efficiëntie van de assemblage reactie en de daaropvolgende transformatie mogen LB agar platen geen kolonies, blauwe kolonies of witte kolonies bevatten (Figuur 3). Blauwe kolonies zijn indicatief voor accepterende vectoren die geen beperking hebben ondergaan (d.w.z. een functionele kopie van Lacz is nog steeds aanwezig). Witte kolonies geven aan dat de Lacz Expression cassette verloren is gegaan en vervangen is door een onderdeel/assemblage.
    1. Valideer desgewenst dat witte kolonies de verwachte vector bevatten door PCR uit te voeren zoals beschreven in rubriek 7.
    2. Kies enkele witte kolonies (of PCR-geverifieerde kolonies) met een tip van 10 μL en breng over in een centrifugebuis van 15 mL met LB-medium (5 mL) en geschikte antibiotica concentraties (stap 2.1.3). Incuberen de buisjes bij 37 °C 's nachts bij 225 rpm in een schud incubator.
  3. Plasmide vector zuivering (dag 3)
    1. Bereid desgewenst een glycerol-voorraad van de nachtelijke E. coli cultuur voor lange termijn cryoopslag van vectoren. Voeg 500 μL bacteriële cultuur toe aan 500 μL 50% (v/v) glycerol in een passende 1,5 − 2,0 mL tube voor cryoopslag bij-80 °C. Meng zachtjes door 5 − 10x te inverteren. Flash-Freeze monsters in vloeibare stikstof en opslaan in een-80 °C vriezer.
    2. Spin-down culturen in 15 mL centrifugebuizen bij 3.000 x g gedurende 5 − 10 min. Gooi het supernatant weg zonder de celpellet te verstoren. Reinig de vector met behulp van een plasmide zuiverings pakket (tabel met materialen). Gezuiverde vector in 35 μL gedeïoniseerd water.
      Opmerking: gebruik lagere elutie volumes om de vector concentratie verder te verhogen. Dezelfde eluens kan tweemaal door een zuiverings kolom worden gebracht voor verhoogde opbrengsten.
    3. Meet de concentratie van de vector in de eluens met behulp van een spectrofotometer (tabel met materialen).
      Opmerking: hoge kopie-nummer vectoren in E. coli, zoals pUC19, geven doorgaans een opbrengst van 50 − 300 ng/μl. lage kopie-nummer vectoren, zoals PPMQAK1-T, geven doorgaans een opbrengst van 15 − 60 ng/μl.
  4. Vector validatie
    Opmerking: vectoren kunnen worden geverifieerd door beperking van de spijsvertering (stap 2.4.1) en/of sequencing (stap 2.4.2).
    1. Beperk 0,5 − 1 μg vector met een geschikt restrictie-enzym (en) en controleer de verwachte band grootten zoals beschreven in rubriek 6 (Figuur 4).
      Opmerking: onjuiste band grootten duiden meestal op foutieve assemblage, in welk geval meer witte kolonies kunnen worden gescreend of assemblage kan worden herhaald. BsaI en BpiI kunnen worden gebruikt voor het valideren van de juiste grootte van de insert voor respectievelijk niveau 0 en niveau 1-assembly's. BsaI of BpiI kan worden gebruikt in combinatie met een aanvullend, compatibel restrictie-enzym dat binnen de INSERT en/of de vector backbone snijdt om een aparte set van goed gescheiden banden te produceren na de spijsvertering.
    2. Sequentie van de vector door Sanger-sequencing met behulp van een geschikte primer stroomopwaarts van de geassembleerde regio met behulp van commerciële sequencing faciliteit (tabel 3).
      Opmerking: alle nieuwe onderdelen van niveau 0 moeten worden geordend om de verwachte sequentie identiteit te bevestigen. Sequentie validatie van niveau 1 en T vectoren is meestal niet nodig als geassembleerd van eerder gesequenced niveau 0 onderdelen.

3. generatie mutanten door conjugatie

Opmerking: hier wordt een protocol voor echtelijke overdracht van een zelfreplicerende lading vector in synechocystis PCC 6803 of S. elongatus utex 297311,47 beschreven. Dit protocol is van toepassing op andere model soorten (bijv. S. elongatus pcc 7942 en Synechococcus sp. PCC 7002). Alle werken met cyanobacteriën (en bijbehorende buffer preparaten) moeten onder steriele omstandigheden worden uitgevoerd in een laminaire stroom afzuigkap.

  1. Groei van de cyanobacteriële cultuur (dag 1)
    1. Bereid BG11 medium voor volgens Lea-Smith et al.11en agar-platen met lb-BG11 en BG11 + Kan50 (sectie 8).
    2. Stel een nieuwe cultuur van Synechocystis pcc 6803 of S. elongatus utex 2973 in door een erlenmeyer van 100 ml van fresh BG11 medium (50 ml) te inoculeren met cellen afkomstig van een Axenische BG11 agar-plaat. Kweek Synechocystis pcc 6803 culturen bij 30 °c, 100 μmol fotonen m-2s-1 bij 100 rpm en Grow s. Rekatus utex 2973 bij 40 °c, 300 μmol fotonen m-2s-1 bij 100 rpm. Kweek culturen tot OD750 = 0,5 − 1,5 (meestal 1 − 2 dagen).
      Opmerking: S. elongatus utex 2973 culturen kunnen worden geteeld bij 40 °c in hoge licht intensiteiten (bijv. 2000 μmol fotonen m-2S-1)48.
  2. Groei van helper en lading E. coli stammen (dag 2)
    1. Inoculeren LB medium met ampicilinegehalte (eindconcentratie 100 μg/mL) en chlooramfenicol (eindconcentratie 25 μg/mL) met een MC1061 E. coli stam met vectoren PRK24 en pRL528 (d.w.z. de helperstam) en groeien bij 37 °c 's nachts bij 225 rpm in een schud incubator. Opgroeien een voldoende hoeveelheid helper stam cultuur, ervan uitgaande dat 1 mL cultuur vereist per conjugatie.
    2. Inoculate LB medium (5 mL) met geschikte antibiotica met de E. coli cultuur die de lading vector draagt (D.w.z. een niveau T vector). Kweek de cultuur bij 37 °C 's nachts bij 225 rpm in een schud incubator.
  3. Conjugal overdracht (Tri-ouderlijke paring) (dag 3)
    1. Bereid de E. coli helper en lading stammen. Centrifugeer de helper en de lading E. coli nachtelijke culturen bij 3.000 x g gedurende 10 minuten bij kamertemperatuur. Gooi het supernatant weg zonder de celpellet te verstoren.
    2. Was de pellet door het toevoegen van verse LB medium zonder antibiotica. Gebruik hetzelfde volume als de initiële cultuur. Rebreng de pellet door voorzichtig op en neer te pipetteren. De cultuur niet Vortex. Herhaal deze stap 3x om resterende antibiotica uit de nachtelijke cultuur te verwijderen.
    3. Centrifugeer de geresuspendeerde cultuur (zoals in stap 3.3.1), gooi de supernatant weg en resuspendeer in het halve volume LB medium van het initiële kweek volume (bijv. 2,5 mL als de nachtelijke kweek 5 mL was). Combineer 450 μL van de hulp stam met 450 μL van de lading stam in een 2 mL Tube en zet opzij (laat op de RT) tot stap 3.3.6.
    4. Bereid de cyanobacteriële cultuur. Gebruik voor elke conjugatie reactie 1 mL cyanobacteriële cultuur (OD750 = 0,5 − 1,5).
    5. Centrifugeer het vereiste totale volume van de cyanobacteriële cultuur bij 1.500 x g gedurende 10 minuten bij RT en gooi het supernatant voorzichtig weg zonder de celpellet te storen. Was de pellet door het toevoegen van verse BG11 medium van hetzelfde initiële volume. Revoer de pellet door voorzichtig op en neer te pipetteren, de cultuur niet te Vortex. Herhaal deze stap 3x en zet de gewassen cultuur opzij.
    6. Voeg een hoeveelheid gewassen cyanobacteriële cultuur (900 μL) toe aan de gecombineerde E. coli stammen (hulp en lading) (900 μL) in een buis van 2 ml. Meng de culturen door zachtjes op en neer te pipetteren. Niet Vortex. Inbroed het mengsel bij RT gedurende 30 min voor Synechocystis pcc 6803 of 2 h voor S. elongatus utex 2973.
    7. Centrifugeer het mengsel op 1.500 x g gedurende 10 minuten bij RT. Verwijder 1,6 ml van het supernatant. Resteert de pellet in de resterende ~ 200 μL supernatant. Plaats één 0,45 μm membraanfilter op een LB-BG11 agar-plaat zonder antibiotica (rubriek 8). Verdeel voorzichtig 200 μL van de E. coli/cyanobacteriële cultuurmix op het membraan met een steriele strooier of een steriele gebogen punt en sluit de plaat af met paraffine folie.
    8. Inbroed de LB-BG11 plaat met het membraan voor 24 h. onderhoud membranen met Synechocystis pcc 6803 culturen bij 30 °c, 100 μmol fotonen m-2s-1. Onderhoud membranen met S. elongatus utex 2973 culturen bij 40 °c in 150 μmol fotonen m-2S-1.
  4. Membraan overdracht
    1. Breng na 24 uur het membraan voorzichtig met behulp van met vlam gesteriliseerde Tang naar een verse BG11 agar plaat met geschikte antibiotica (sectie 8) om de lading vector te selecteren. Sluit de plaat af met een paraffine laagje.
    2. Inbroed de BG11 agar-plaat onder passende groeiomstandigheden, zoals hierboven beschreven voor Synechocystis pcc 6803 of S. elongatus utex 2973, totdat er kolonies verschijnen.
      Opmerking: kolonies verschijnen meestal na 7 − 14 dagen voor Synechocystis pcc 6803 en 3 − 7 dagen voor S. elongatus utex 2973.
  5. Selectie van conjuganten
    Opmerking: alleen cyanobacteriale kolonies die de lading vector dragen, kunnen op het membraan groeien (Figuur 5).
    1. Selecteer met behulp van een hitte steriele lus ten minste twee afzonderlijke kolonies uit het membraan en streep op een nieuwe BG11 agar-plaat met geschikte antibiotica (Figuur 5C).
      Let op: vers gestreepte kolonies kunnen nog steeds verontreinigd zijn met E. coli overgedragen van conjugatie (d.w.z., als kleine witte kolonies zichtbaar zijn op de plaat), dus twee of drie extra rondes van opnieuw streaking op verse BG11 agar platen zijn meestal nodig om een Axenische-cyanobacteriële cultuur te verkrijgen.
    2. Bevestig de afwezigheid van E. coli besmetting door een streep cyanobacteriële cultuur te inoculëren in een centrifugebuis van 15 ml met 5 ml lb medium en incubatie bij 37 °c 's nachts bij 225 rpm in een schud incubator. Na een voldoende groeiperiode (~ 7 dagen), kiest u individuele Axenische-kolonies om vloeibare culturen op te zetten voor langdurige cryoopslag of daaropvolgende experimenten.
  6. Cryoopslag van cyanobacteriële stammen
    1. Groei van een cyanobacteriële vloeibare cultuur in BG11 (zoals beschreven in paragraaf 3,1) tot OD750 = 1.5 − 3.0. Centrifuge 10 mL cultuur gedurende 10 minuten bij 1.500 x g, verwijder de supernatant en regeer de cellen in 5 ml vers BG11 medium.
    2. Voeg 3,5 mL autoclaaf gesteriliseerde 50% (v/v) glycerol toe voor een uiteindelijke glycerol concentratie van ~ 20% (v/v)49. Deze aanpak werkt goed voor Synechocystis pcc 6803. U ook 5 mL filter gesteriliseerde BG11 met 16% (v/v) dimethylsulfoxide (DMSO) toevoegen voor een uiteindelijke DMSO-concentratie van ~ 8% (v/v)50. Deze aanpak wordt aanbevolen voor de meeste stammen, waaronder S. elongatus utex 2973.
      Let op: DMSO is giftig en moet met gepaste bescherming worden behandeld.
    3. Meng zachtjes door 5 − 10x te inverteren. Subaliquot ~ 1 ml van de cultuur in afzonderlijke cryozak compatibele 1,5 ml schroefdop buizen (tafel van materialen). Plaats Tubes in a-80 °C vriezer voor cryoopslag. Vlam niet bevriezen in vloeibare stikstof.
      Opmerking: ten minste drie voorraden per stam worden aanbevolen.
    4. Voor herstel, verwijder een buis van de-80 ° c vriezer en ontdooien de cultuur in een 35 °C waterbad terwijl zachtjes mengen. Voeg de ontdooide cultuur toe aan 50 mL vers BG11 medium en groei als een vloeibare cultuur (zoals beschreven in paragraaf 3,1).
      Opmerking: als alternatief kan de cultuur worden gestreept en geteeld op een verse BG11 agar plaat. Transgene culturen die selectie markers dragen, moeten in eerste instantie op BG11 agar-platen zonder antibiotica worden herleven en vervolgens met geschikte antibiotica op BG11 agar-platen worden gerestreefd.

4. karakterisering van de organisator

Opmerking: hier wordt een standaardbenadering beschreven voor het analyseren van de sterkte van een promotor deel door het meten van de expressieniveaus van een fluorescerende marker (eYFP) na een groeiperiode van 72 uur met behulp van een plaat lezer of een flow cytometer12.

  1. Cultuur groei
    1. Zaad culturen instellen door het inoculeren van 10 mL BG11 medium dat geschikte antibiotica bevat, met een enkele kolonie van de transgene cyanobacteriële stam die de fluorescerende marker Expression cassette draagt. Bereid ook zaad culturen voor geschikte negatieve controle stammen (bijv. een wild type stam en/of een transgene stam die dezelfde vector ruggengraat heeft, maar zonder de fluorescerende marker Expression cassette).
      Opmerking: ten minste vier biologische replicaten worden aanbevolen.
    2. Kweek de zaad culturen voor 48 uur of tot OD750 = 1 − 1.5 onder groeiomstandigheden die geschikt zijn voor de soort stam.
    3. Om de promotor-expressie na verloop van tijd te volgen, meet u eerst de OD750 van elke zaad cultuur. Bereken de verdunnings vereisten om elke cultuur naar een startende OD750 = 0,2 te brengen. Het instellen van verdunde experimentele kweek monsters (2 mL totaal volume) in een vlakke-bodem 24-goed plaat (tabel van materialen).
    4. Incureren van de plaat in een schud incubator met witte ledlampjes (tabel van materialen) onder passende groeiomstandigheden. Meet de groei dichtheid van de cultuur (OD750) en het verbeterde fluorescentie geel fluorescerende eiwit (eyfp) met behulp van een plaat lezer (sectie 4,2) of een flow-cytometer (sectie 4,3).
      Opmerking: Synechocystis pcc 6803 en S. elongatus utex 2973 culturen kunnen worden geteeld zoals in stap 3.1.2. Het wordt ten zeerste aanbevolen om de plaat onder een hoge luchtvochtigheid te behouden (95%) om de verdamping van de kweek monsters te voorkomen.
  2. Plate Reader
    1. Meng de culturen in de 24-put plaat (stap 4.1.4) kort met zachte Pipetteer. Breng een submonster van elke cultuur over naar een zwarte vlakke bodem 96-well plate (tabel met materialen). Indien nodig verdunnen (100 μL eindvolume). Vermijd de vorming van bellen omdat dit de meetnauwkeurigheid kan verstoren.
      Opmerking: het wordt aanbevolen dat alle metingen worden uitgevoerd op monsters in een OD750 -bereik van 0,2 − 1,0. Naarmate de dichtheid van de culturen in de 24-put in de loop van de tijd toeneemt, worden de volgende verdunningen aanbevolen op basis van de verwachte stijgingen van de standaard groeicondities: geen verdunning bij 0 h, 1:4 bij 24 h, 1:10 bij 48 h en 1:10 bij 72 h. Bijvoorbeeld, bij 24 h oogst 25 μL cultuur en meng met 75 μL van BG11 medium.
    2. Neem twee blanco putten op in de 96-boorput (d.w.z. 100 μL van BG11 medium). Plaats de 96-well plate in een plaat lezer (tabel met materialen). Schud de plaat voor 60 s bij 500 rpm met behulp van de orbitale Shaker in de plaat lezer om de putten te mengen.
      Opmerking: Cyanobacteriële culturen kunnen samenvoegen en/of flocculeren, dus goed mengen is van cruciaal belang voorafgaand aan het lezen voor nauwkeurige metingen.
    3. Meet OD750 en eyfp fluorescentie met excitatie/emissie golflengten bij 485 nm/520 nm.
    4. Trek het gemiddelde van de OD750 -metingen van de twee lege putten af van de OD750 -meting van elk monster met de cyanobacteriën cultuur.
    5. Normaliseer de fluorescentie waarden van elk kweek monster door de eYFP fluorescentie meting (stap 4.2.3) te delen door de aangepaste OD750 van de cultuur (stap 4.2.4). Trek vervolgens de gemiddelde genormaliseerde Oogfp-fluorescentie waarde (eYFP fluorescentie/OD750) van de biologische replicaten van een geschikte negatieve controlestam van de transgene stammen die de eyfp-expressie cassette dragen af.
      Opmerking: cyanobacteriën zijn van nature fluoresceren door de aanwezigheid van pigmenten, zoals chlorofyl en phycobiliproteïnen.
    6. Plot cultuur groei na verloop van tijd (Figuur 6a) en de gemiddelde genormaliseerde eyfp fluorescentie waarden van elke experimentele cultuur op de gewenste tijdstippen (bijv. 72 uur; Figuur 6B).
  3. Flow cytometer
    1. Kies een compatibele plaat voor het vloeistof behandelingssysteem flow cytometer. Gebruik bijvoorbeeld een ronde bodem 96-well plate (Inhoudsopgave) met de flow cytometer (tabel met materialen) die in dit protocol wordt gebruikt.
    2. Meng de culturen in de 24-put plaat (stap 4.1.4) kort met zachte Pipetteer. Verdun culturen tot OD750 = 0,1 − 0,2 om mondstuk verstoppingen in het vloeistof behandelingssysteem te voorkomen. Voeg een geschikte hoeveelheid kweek monster toe aan de 96-put en breng tot een eindvolume van 250 μL met filter-gesteriliseerde 1x fosfaat-gebufferde zoutoplossing (PBS). Neem een blanco put op voor de medium oplossing op de plaat met 60 μL BG11 en 190 μL 1x PBS.
      Opmerking: dit volume wordt aanbevolen voor het geval er een noodzaak voor het opnieuw uitvoeren van monsters. Volumes hoger dan 250 μL worden niet aanbevolen, aangezien het maximale volume van elke put 300 μL is.
    3. Zodra de flow cytometer klaar is voor gebruik, plaats de 96-well plate met cultuur monsters in het vloeistof behandelings station. Stel het software protocol voor de flow cytometer in om de metingen van 10.000 individuele gebeurtenissen (bijv. cellen) te verzamelen. Meet eYFP fluorescentie met excitatie/emissie golflengten van 488 nm/515 − 545 nm. Eerste meting en controleer de lezing van de lege put (afbeelding 7A), voer vervolgens de monsters.
    4. Poort de populatie van cyanobacteriën in de voorwaartse en zijspreidings gegevensverzamelingen, met uitzondering van de gebieden die gemeenschappelijk zijn met de blanco lezing (Figuur 7B). Trek de gemiddelde eYFP-fluorescentie waarden van de biologische replicaten van een geschikte negatieve controlestam af van de transgene stammen die de eYFP-expressie cassette dragen (Figuur 7C, D). Plot het gemiddelde van de mediane fluorescentie waarden per cel voor elke experimentele cultuur op de gewenste tijdstippen (bijv. 72 uur; Afbeelding 7E).

5. genomische DNA-extractie van cyanobacteriën

Opmerking: het onderstaande protocol maakt gebruik van een commerciële DNA-extractie Kit (tabel met materialen).

  1. Groei van een cyanobacteriële vloeibare cultuur in BG11 (zoals beschreven in paragraaf 3,1) tot OD750 = 1.5 − 3.0. Spin 10 mL cultuur bij 3.000 x g gedurende 10 minuten en gooi het supernatant weg. Vries de pellet in door de buisjes gedurende 30 minuten bij-20 °C te bebroed.
  2. Voeg 400 μL lysisbuffer (buffer AP1) en 400 μL ribonuclease-oplossing (RNase A) en 50% (w/v) glas parels (0,5 mm diameter) toe. Verstoren van monsters met behulp van een kraal molen (tabel van de materialen) op 30 Hz (d.w.z. equivalent aan 1.800 oscillaties/min) gedurende 6 minuten.
  3. Draai het monster gedurende 5 minuten bij 17.000 x g en breng het supernatant voorzichtig over in een nieuwe buis en gooi de pellet weg. Ga verder volgens de instructies van de fabrikant (tabel met materialen).

6. agarose gel elektroforese

  1. Giet een 1% (w/v) agarose gel met 0,02% (v/v) ethidiumbromide bromide. Load samples en een geschikte DNA-ladder referentie.
  2. Voer de monsters uit voor 50 min bij 125 V. Controleer op de scheiding van de band op een ultraviolette (UV)-transverlichter.
    Opmerking: de looptijd en agarose gel percentage kan worden aangepast aan de verwachte band grootte. Zo kan een hoger percentage agarose-gel en langere looptijd de band resolutie en scheiding van DNA-producten < 500 BP verbeteren.

7. kolonie PCR

  1. Stel een PCR-reactiemix in met een standaardset (tabel met materialen) en een geschikte combinatie van primers (bijvoorbeeld primers die het assemblagegebied flankeren of die specifiek zijn voor sequenties binnen het assemblagegebied (tabel 3). Pipetteer 10 μL in een PCR-buis.
  2. Raak de bovenkant van een enkele witte kolonie zachtjes aan met een steriele tandenstoker of een pipetpunt van 10 μL en beënt een PCR-buis met PCR-reactiemix. Wees voorzichtig om de kolonie te markeren en match met de specifieke PCR-buis. Roer de reactiemix zachtjes om ervoor te zorgen dat E. coli cellen in de oplossing worden vergoten.
  3. Amplify producten door PCR. Gebruik een programma bestaande uit een initiële denaturatiestap van 95 °C voor 60 s, 30 rondes van 95 °C gedurende 15 s, 58 °C gedurende 15 sec. (enkele graden onder de Tm waarden van de primers), 72 °c gedurende 30 s (30 s/KB van insert) , gevolgd door een laatste uitbreidings stap van 72 °C gedurende 5 minuten.

8. bereiding van BG11 medium en platen

  1. Bereid stockoplossingen van 100x BG11 medium, ijzer (ammoniumijzer citraat), sporenelementen, fosfaat (K2HPO4), na2co3 en tes buffer volgens Lea-Smith et al.11. Autoclaaf fosfaat en na2co3 aandelen. Gebruik 0,2 μm filters steriliseren de TES buffer (pH 8,2) en NaHCO3 stockoplossingen.
  2. Bereid 1 L van BG11 medium. Meng 10 mL 100 x BG11 mL sporenelementen en 1 mL ijzervoorraad en autoclaaf de oplossing met 976 mL water. Wanneer de oplossing is afgekoeld tot RT, voeg dan 1 mL fosfaat voorraad, 1 mL na2co3 kolf en 10 ml NaHCO3toe en breng aan op de pH 7,6 − 7,8 met 1 M HCl.
  3. LB-BG11 agar platen (1,5% [w/v])
    1. Combineer 700 mL gedeïoniseerd water en 15 g agar in een glazen kolf. Voeg in een tweede kolf 186 mL water, 10 mL 100x BG11, 1 mL sporenelementen en 1 mL ijzervoorraad toe. Beide oplossingen autoclaaf.
    2. Zodra de oplossingen zijn afgekoeld tot ongeveer 60 °C, combineer ze en voeg 1 mL fosfaat voorraad, 1 mL na2co3 kolf, 10 ml NaHCO3 kolf en 50 ml lb steriel medium, die een laatste volume van 1 L moet geven. gegoten Petri schaaltjes met 25 mL LB-BG11 agar-medium.
  4. BG11 + Kan50 agar-platen (1,5% [w/v])
    1. Combineer 700 mL gedeïoniseerd water en 15 g agar in een glazen kolf. Voeg in een tweede kolf 3 g Natriumthiosulfaat (na2S2O3), 226 ml water, 10 ml 100x BG11 kolf, 1 ml sporenelementen en 1 ml ijzervoorraad toe. Beide oplossingen autoclaaf.
    2. Zodra de oplossingen zijn afgekoeld tot ongeveer 60 °C, combineer ze en voeg 1 mL fosfaat voorraad, 1 mL na2co3 kolf, 10 ml tes buffer kolf en 10 ml NaHCO3 kolf toe, die een eindvolume van 1 L moet geven. Voeg kanamycine sulfaat toe tot een eindconcentratie van 50 μg/mL en gegoten Petri schaaltjes met 35 mL medium.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Om de Golden Gate assembly workflow te demonstreren, werd een Expression cassette geassembleerd in de niveau 1 positie 1 (voorwaartse) acceptor vector (pICH47732) met de volgende niveau 0 onderdelen: de promotor van de C-phycocyanin operon Pcpc560 (PC 0,005), de programmeer volgorde voor eYFP (pC 0.008) en de dubbele Terminator TRrnb (PC 0.082)12. Na de transformatie van de assemblage reactie werden succesvolle assemblages geïdentificeerd met behulp van standaard blauw-witte screening van E. coli kolonies (Figuur 3). De eYFP-expressie cassette in de vector van niveau 1 en de end-link 1 vector (pICH50872) werden vervolgens geassembleerd tot een niveau T acceptor vector (pPMQAK1-T) om de vector Cpcba-Eyfp (Figuur 4a) te geven. De verzamelde Cpcba-eyfp-vector werd geverifieerd door een beperking van de spijsvertering (Figuur 4B).

Succesvolle echtelijke overdracht van cpcba-eyfp of de lege pPMQAK1-T vector (d.w.z. een negatieve controle ontbreekt de eyfp Expression cassette) resulteerde in de groei van tot enkele honderden kolonies op het membraan voor synechocystis PCC 6803 en S. elongatus utex 2973 na 7 − 14 dagen en 3 − 7 dagen, respectievelijk (Figuur 5). Individuele kolonies werden geplukt en uitgestrekt op verse BG11 + Kan50 agar-platen; 2 − 3 opnieuw streaks waren nodig om Axenische-culturen te genereren.

Zoals verwacht voor de sterke Pcpc560 Promoter51, waren de waarden voor genormaliseerde eyfp fluorescentie van de plaat lezer en eyfp fluorescentie per cel van de flow-cytometer hoog in vergelijking met de negatieve controle (Figuur 6 en Figuur 7). De fluorescentie waarden waren hoger in S. elongatus utex 2973 dan in Synechocystis PCC 680312.

Figure 1
Figuur 1: overzicht van het Golden Gate assemblageproces in CyanoGate. Assemblage van een genexpressie cassette wordt getoond, te beginnen met de versterking van een reeks van belangstelling van template DNA tot assemblage in een niveau T vector (onderdelen worden niet op schaal getekend). A) het ontwerpen van voorwaartse en omgekeerde primers voor de versterking van een CDS1 deel uit template DNA (bijv. Genomisch of plasmide DNA). De locaties van de BpiI restrictie sites en uitsteeklengten die nodig zijn voor het inbrengen in de acceptor vector (dat wil zeggen, 5 ′ en 3 ′ van de template sequentie) zijn gemarkeerd in respectievelijk rood en blauw. De letter "n" betekent dat elke NT kan worden gebruikt op deze positie. De gloei gebieden van de primers met de DNA-template en hun aanbevolen smelttemperaturen (Tm) zijn geïndiceerd. B) niveau 0-assemblage van het PCR-product in het niveau 0 CDS1 acceptor vector pICH41308. De volgorde die door BpiI wordt uitgelicht en in de acceptor-vector wordt geligd, wordt blauw gemarkeerd. C) niveau 1-samenstelling van een genexpressie cassette met drie niveau 0-delen (Pro + 5U, CDS1 en 3U + ter) in de niveau 1-positie 1 (voorwaartse) acceptor vector pICH47732 met behulp van bsai. D) niveau t-assemblage van niveau 1-assemblage en eindkoppeling 1 (pICH50872, genaamd "level M end-link 1" in Engler et al.15) in een niveau t acceptor vector (bijvoorbeeld pPMQAK1-t) met behulp van bpii. E) de uiteindelijke geassembleerde niveau T-vector. Afkortingen: AmpR, ampicillaire weerstands cassette; CarbR, carbenicillaire weerstands cassette; CDS1, codeer volgorde in de syntaxis van niveau 015; EL1, end-link 1 deel; KanR, kanamycine weerstands cassette; Laczα, β-galactosidase-expressie cassette; SpecR, spectinomycine weerstands cassette. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: een op PCR gebaseerde domesticatiestrategie voor het verwijderen van een illegale type IIS-beperkings site. (A) schematisch diagram met twee primer paren (respectievelijk groen en oranje) voor de aanpassing van een bpii-plaats (gaagac) aan gaggac in een DNA-sequentie voor eiwit codering, bedoeld voor montage in de CDS1-niveau 0 acceptor vector (pICH41308). Merk op dat wijziging behoudt de codon voor glutaminezuur (GLU) (dat wil zeggen, GAA naar GAG). Hoewel de BpiI-site wordt weergegeven in frame met de start codon, deze aanpak zal werken, zelfs als de site niet in het frame (dat wil zeggen, zolang de site wordt verstoord, en de eiwitsequentie bewaard). De locaties van de BpiI restrictie sites en uitsteeklengten in de primers zijn gemarkeerd in respectievelijk rood en blauw. De DNA-template en de vertaalde eiwitsequentie worden geel gemarkeerd. De gloei gebieden van de primers met de DNA-template en hun aanbevolen smelttemperaturen (Tm) zijn geïndiceerd. Het oranje paar wordt gebruikt om het 5 ′-uiteinde van de sequentie met uitsteeklengten AATG en TGAA (fragment 1) te versterken, terwijl het groene paar wordt gebruikt om het 3 ′-uiteinde te versterken met uitsteeklengten TGAA en GCTT (fragment 2). Voor het bestellen van de primers, de getrouwheid van de tgaa fusie uitsteeklengte voor fragment 1 en 2 werd zorgvuldig gecontroleerd52. Slecht ontworpen fusie uitsteeklengten kunnen leiden tot assemblage falen (d.w.z. geen kolonies na transformatie; Figuur 5) of valse positieven (bijvoorbeeld afgekapt of foutieve assembly's). Dit laatste kan worden opgelost door een groter aantal witte kolonies te screenen om een correct geassembleerde constructie te identificeren. B) de amplicons van fragmenten 1 en 2 na beperking met bpii tijdens Golden Gate assembly. C) de gedomesticeerde sequentie die is geassembleerd in het niveau 0 CDS1 acceptor vector. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: blauw-witte kolonie vertoning van E. coli transformanie na Golden Gate assembly. De getoonde platen bevatten LB agar (1% [w/v]) aangevuld met X-gal, IPTG en antibiotica in geschikte concentraties. A) geenkolonies, wat duidt op een mislukte assemblage reactie en/of E. coli -transformatie. B) meestal blauwe kolonies, wat duidt op een succesvolle assemblage, maar dat de efficiëntie van het restrictie-enzym dat in de assemblage reactie werd gebruikt, laag was. C) meestal witte kolonies, indicatief voor een typische, succesvolle assemblage reactie. D) geen blauwe kolonies, wat duidt op een zeer efficiënte assemblage. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: verificatie van een geassembleerd niveau T vector door beperking vertering. De vectoren werden verteerd met HindIII en BamHI. (A) sequentie kaart van lege PPMQAK1-T acceptor vector (CT. 0) en niveau T-eenheid (cpcba-eyfp) die componenten van de Eyfp Expression cassette (PCpc560-eyfp-Trrnb) weergeeft. De posities van de beperkings locaties voor HindIII en BamHI zijn geïndiceerd. Na dubbele vertering worden de voorspelde maten van de DNA-fragmenten aangegeven: (1) 5.847 BP, (2) 2.004 BP, (3) 30 BP, (4) 374 BP, (5) 1.820 BP, (6) 1.289 BP, en (7) 156 BP.B) een agarose-gel (0,8% [w/v]) loopt op 125 v voor 60 min geladen met het verteerde niveau T-assemblage (Cpcba-eyfp) met banden 1, 5 en 6, de verteerde lege PPMQAK1-T acceptor vector (CT. 0) met bands 1 en 2 en een DNA-ladder (tabel van de materialen). Merk op dat de banden 3, 4 en 7 te klein waren om te visualiseren op de gel. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: groei van transgene Synechocystis pcc 6803 kolonies na succesvolle conjugatie. Voorbeelden van membranen na incubatie op BG11 + Kan50 agar-platen worden getoond. (A) overgroei na zeer efficiënte conjugatie-de Synechocystis PCC 6803 kolonies hebben ontwikkeld tot een gazon zonder individuele kolonies. B) een goede conjugatie-efficiëntie die enkele honderden individuele kolonies na 12 dagen weergeeft. (C) groei van een Axenische-stam na 14 dagen na verschillende rondes van opnieuw streaking op een verse BG11 + Kan50 agar-plaat. Afwezigheid van bacteriële besmetting gaf aan dat de Synechocystis pcc 6803 transconjugant axenic was. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 6
Figuur 6: representatieve groeigegevens en genormaliseerde eYFP fluorescentie waarden met behulp van een plaat lezer. A) groei vergelijking van stammen die cpcba-eyfp of de lege pPMQAK1-T vector (CT. 0, negatieve controle) uitvoeren in synechocystis PCC 6803 en S. elongatus utex 2973. Waarden zijn de gemiddelden ± SE van vier biologische replicaten. Synechocystis PCC 6803 en S. elongatus utex 2973 werden gekweekt voor 72 h bij 30 ° c met continu licht (100 μmol fotonen m-2s-1) en 40 °c met 300 μmol fotonen m-2s-1, respectievelijk. B) genormaliseerde oogfp-fluorescentie waarden voor Synechocystis PCC 6803 of S. elongatus utex 2973 geconjugeerd met cpcba-eyfp bij 72 h. waarden zijn het middel ± se van vier biologische replicaten. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 7
Figuur 7: representatieve eYFP fluorescentie waarden met behulp van een flow cytometer. (A) spreidings plot (FSC-h) en zijkant (SSC-h) uit de "blanco" medium oplossing (BG11 en PBS). B) spreidings plot voor een Synechocystis PCC 6803-monster (rechts). De cirkel geeft het geselecteerde gebied aan dat de populatie van cyanobacteriën van de rest van het monster signaal Geert. C) histogram van het gated gebied voor een stam die de lege PPMQAK1-T vector (CT. 0, negatieve controle) draagt. D) histogram van het gated gebied voor een stam die cpcba-eyfp draagt. E) eyfp-fluorescentie waarden per cel in Synechocystis PCC 6803 en S. elongatus utex 2973 bij 72 h. de fluorescentie van de negatieve controle is afgetrokken. Waarden zijn de gemiddelden ± SE van vier biologische replicaten. Klik hier om een grotere versie van dit cijfer te bekijken.

No. Vector-ID Naam Beschrijving 5 ' uitsteeklengte 3 ' uitsteeklengte
1 pICH41233 Pro Promotor GGAG Tact
2 pICH41295 Pro + 5U Promotor en 5 unvertaalde regio GGAG AATG
3 pAGM1251 Pro + 5U (f) Promotor en 5 "unvertaalde sequentie voor N terminale fusies" GGAG CCAT
4 pICH41246 5u 5 niet-vertaalde regio Tact CCAT
5 pAGM1263 5U (f) 5 ′ onvertaalde sequentie voor N terminale fusies Tact CCAT
6 pICH41246 5U + NT1 5 regio en N-Terminal coderende regio Tact CCAT
7 pAGM1276 NT1 N terminale tag of lokalisatie signaal CCAT AATG
8 pICH41258 Sp Signaal peptide AATG AGGT
9 pICH41258 NT2 N terminale tag of lokalisatie signaal AATG AGGT
10 pAGM1287 CDS1 NS Codeer regio zonder stop codon AATG TTCG
11 pICH41308 CDS1 stop Codeer regio met stop codon AATG GCTT
12 pAGM1299 CDS2 NS Codeer regio-zonder start en stop codon AGGT TTCG
13 pICH41264 CDS2 stop Codeer regio-zonder start en met stop codon AGGT GCTT
14 pAGM1301 Ct C Terminal tag of lokalisatie signaal TTCG GCTT
15 pICH53388 3U 3 niet-vertaalde regio GCTT GGTA
16 pICH53399 Ter Terminator GGTA CGCT
17 pICH41276 3U + ter 3 niet-vertaalde regio en Terminator GCTT CGCT
18 pICH41331 Cgm Acceptor voor complete gen cassettes GGAG CGCT
19 pCA 0.002 Pro (laag exemplaar) Promotor, low-Copy nummer acceptor (pSC101 ori) GGAG Tact
20 pCA 0,001 Pro TSS De organisator is afgekapt bij de Startsite voor transcriptie GGAG TAGC
21 Direct naar niveau 1 srRNA Klein regulerend RNA (voor translationeel silencing) TAGC GTTT
22 Direct naar niveau 1 sgRNA Enkelvoudige geleider RNA (voor CRISPRi) TAGC GTTT
23 pICH41295 UP FLANK Flankerende sequentie stroomopwaarts van doel homologeuze recombinatie plaats GGAG AATG
24 pICH41276 DOWN FLANK Flankerende sequentie stroomafwaarts van doel homologeuze recombinatie plaats GCTT CGCT

Tabel 1: een lijst van beschikbare niveau 0 acceptor vectoren en uitsteeklengten. Vectoren 1 − 18 zijn afkomstig van de plant MoClo Kit15. Vectoren 19 − 22 zijn afkomstig van de CyanoGate Kit12. Voor srRNA-en sgRNA-onderdelen worden gesynthetiseerde sequenties of PCR-producten rechtstreeks geassembleerd in niveau 1 acceptor vectoren. Vectoren 23 − 24 zijn afkomstig van de plant MoClo Kit die opnieuw is gepurposeerd voor transformatie door homologe recombinatie met behulp van de CyanoGate Kit.

BpiI assemblagecomponenten (niveau 0, T) BsaI assemblagecomponenten (niveau 1)
50 − 100 ng acceptor vector 50 − 100 ng acceptor vector
Gebruik voor elke vector/onderdeel om in te voegen een 2:1 ratio van insert: acceptor vector. Gebruik voor elke vector/onderdeel om in te voegen een 2:1 ratio van insert: acceptor vector.
2 μL 10 mM ATP (tabel van de materialen) 2 μL 10 mM ATP (tabel van de materialen)
2 μL buffer G (buffer voor BpiI/BsaI) 2 μL buffer G (buffer voor BpiI/BsaI)
2 μL BSA (10x) (tabel van materialen) 2 μL BSA (10x) (tabel van materialen)
10 eenheden BpiI (1 μL10 U/μL BpiI, Inhoudsopgave) 10 eenheden BsaI (1 μL 10 U/μL BsaI, tabel van de materialen)
Breng tot 20 μL met dH2O. Breng tot 20 μL met dH2O.
200 eenheden T4 DNA ligase (1 μL 200 U/μL, tabel van de materialen) 200 eenheden T4 DNA ligase (1 μL 200 U/μL, tabel van de materialen)
Thermocycler-Protocol (niveau 0, T) Thermocycler-Protocol (niveau 1)
37 °C gedurende 10 min cyclus x 5 37 °C gedurende 10 min cyclus x 5
16 °C gedurende 10 minuten 16 °C gedurende 10 minuten
37 °C gedurende 20 min 37 °C gedurende 20 min
65 °C gedurende 10 min 65 °C gedurende 10 min
16 °C (vasthouden) 16 °C (vasthouden)

Tabel 2: protocollen voor Golden Gate assemblies in de niveaus 0, 1 en T. Assembly in niveau 0 en niveau T acceptor vectoren gebruikt restrictie enzym BpiI (links). Montage in niveau 1 acceptor vectoren gebruikt restrictie enzym BsaI (rechts). Deze tafel is aangepast van Vasudevan et al.12.

Primer nr. Sequentie (5 '-3 ') Lengte (BP) Beschrijving
L0T forward GEASPTE
TTTGAATG
28 Voor versterking van niveau 0 en niveau T
L1 reverse Een van de meest GEKKEN
ACATAC
26 Voor versterking vanaf niveau 1
L1 voorwaarts CTGGTGGCAGGATATATTGT
GGTG
24 Voor versterking vanaf niveau 1
L0T reverse EEN van de meest. 20 Voor versterking van niveau 0 en niveau T

Tabel 3: lijst van primers voor PCR-validatie of sequencing van niveau 0, 1 en T vectoren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Golden Gate Assembly heeft verschillende voordelen ten opzichte van andere vector assemblage methoden, met name in termen van schaalbaarheid20,21. Niettemin, het opzetten van de Golden Gate systeem in een Lab vergt tijd om een vertrouwdheid met de verschillende onderdelen en acceptor vector bibliotheken en algemene assemblageprocessen te ontwikkelen. Een zorgvuldige planning is vaak nodig voor complexere assemblages of bij het parallel uitvoeren van een groot aantal complexe assemblages (bijv. het maken van een suite van niveau T-vectoren die meerdere genexpressie cassettes bevatten). We raden aan eerst alle benodigde combinaties van de genexpressie cassette te vermelden en vervolgens de workflow te koppelen van niveau 0 tot niveau T in silico. Tijdens dit proces, moeten gebruikers overwegen de niveau 1 "dummy"-onderdelen die beschikbaar zijn in de plant MoClo Kit die het mogelijk maken voor de assemblage van niet-sequentiële niveau 1 vectoren in niveau T (bijvoorbeeld, niveau 1 positie 1 en positie 3 vectoren kunnen samen met "dummy" deel worden geassembleerd Niveau 1 positie 2), wat het totale aantal assemblage reacties en de benodigde stappen voor klonen kan verminderen15.

DNA-synthese is meestal de eenvoudigste methode voor het bouwen van nieuwe niveau 0-onderdelen. Echter, wanneer klonen is vereist (bijvoorbeeld van plasmiden of genomisch DNA), is het optimaliseren van het ontwerp van de primers gebruikt voor amplificatie belangrijk voor het maximaliseren van de efficiëntie van volgende niveau 0 vector assemblage. De twee meest kritische stappen in de primer ontwerp zijn: 1) controleren of de juiste uitsteeklengten zijn opgenomen en in de juiste richting voor de voorwaartse en omgekeerde primers (Figuur 1 en tabel 1), en 2) zorgen dat de lengte van de primer de sequentie die de sjabloon gloelt, is lang genoeg (18 − 30 BP) en de Tm -waarde voor deze sequentie (idealiter 58 − 62 °c) is vergelijkbaar voor het primer paar (Figuur 1A). Als voor een reeks domesticatie vereist is, zijn er verschillende strategieën beschikbaar. Voor korte sequenties (bijv. < 200 BP) kunnen een paar lange voorwaartse en omgekeerde primers worden ontworpen waarin de 3 ′-uiteinden met elkaar worden verbonden (d.w.z. een overlapping van > 20 BP) en een dubbele, gestrande sequentie vormen na versterking. Voor langere sequenties kunnen afzonderlijke fragmenten van de sequentie worden versterkt die illegale beperkings sites verwijderen en vervolgens worden geassembleerd met behulp van een Golden Gate assembly-benadering (Figuur 2). Als assemblage-efficiëntie met PCR-producten slecht is, kunnen afzonderlijke fragmenten van een niveau 0-sequentie worden gekloond in de niveau 1-universele acceptor-vector (pAGM1311), gevalideerd en vervolgens samengevoegd in het passende niveau 0 acceptor Vector15. Een 2:1 insert: acceptor vector molaire verhouding wordt aanbevolen voor efficiënte Golden Gate assembly. Voor assemblages van slechts 2-3 vectoren (bijvoorbeeld twee niveau 0-onderdelen en een niveau 1-acceptor vector), leidt het combineren van ~ 100 ng van elk regelmatig tot geslaagde assembly's. De efficiëntie van assemblages heeft de neiging te dalen naarmate het aantal vectoren dat per reactie wordt gebruikt toeneemt, wat resulteert in een afname van het aantal witte kolonies na transformatie (Figuur 3).

Voorafgaand aan conjugatie wordt de validatie van de gefinaliseerde niveau T-vectoren door restrictie Digest en PCR aanbevolen. Conjugal DNA-overdracht is een goed stabilisatie techniek voor cyanobacteriële stammen, waaronder die welke niet van nature transformeerbaar zijn41,45. Belangrijke stappen in het conjugatie protocol zijn: 1) zorgvuldige behandeling van de helper E. coli stam na nachtelijke groei (bv, Vermijd vortexing)35, 2) het verzorgen van volledig verwijderen van sporen van de antibiotica gebruikt om te groeien helper en lading E. coli stammen, 3) een geschikte incubatietijd voor het mengsel van lading-en helperstammen en cyanobacteriën (bijv. een langere incubatieperiode was van cruciaal belang voor S. elongatus utex 2973), en 4) de initiële overdrachtsperiode van de cel mengsel op membranen in LB-BG11 agar platen ontbreekt antibiotica voor 24 h.

Geïsoleerde cyanobacteriale kolonies moeten zich binnen twee weken ontwikkelen op het membraan voor Synechocystis pcc 6803 en S. elongatus utex 2973, anders is het waarschijnlijk dat conjugatie is mislukt. Verschillende wijzigingen van het protocol kunnen vervolgens worden getest, waaronder 1) met behulp van een cyanobacteriële cultuur met een hogere begin dichtheid (bijv. OD750 = 1,5 − 2); 2) verhoging van de incubatietijd vóór overdracht aan het membraan; en 3) verlenging van de initiële incubatietijd op het membraan van 24 uur tot 48 uur (d.w.z. om meer tijd te geven voor de uitdrukking van het antibioticumresistentie-gen op de overgedragen vector). Als conjugatie nog steeds mislukt, alternatieve methoden zoals electroporatie kan worden geprobeerd53. Het bevestigen van een transgene cyanobacteriële stam is Axenische is belangrijk alvorens verder te experimenteren. Ten slotte is het een goede gewoonte om de grootte van de heterologeuze vector in de transgene cyanobacteriële stam te bevestigen. Deze laatste vereist DNA-extractie (sectie 5), omzetting in E. coli en selectie (punt 2,1), en vector validatie (paragraaf 2,4).

De uitgestippelde promotor karakterisatie protocol maakt gebruik van kleine cultuur volumes (dat wil zeggen, 2 mL) als een middel om een hoge doorvoer screenings methodologie. Grotere volumes kunnen worden gebruikt, afhankelijk van de bioreactor ruimte beschikbaar, die zou helpen om cultuur verdamping problemen te verzachten. Als een hoge doorvoer screening met kleine cultuur volumes vereist is, is het essentieel om een hoge luchtvochtigheid in de groei kamer te hebben voor de remming van de verdamping. Verdamping tijdens een groei-experiment kan nadelig zijn voor de nauwkeurigheid en geldigheid van monster metingen. Controleer het cultuur volume tijdens en na het experiment om te bevestigen hoeveel verdamping heeft plaatsgevonden.

Voorplaat lezers metingen is het belangrijk om culturen te meten bij lage dichtheden, idealiter OD750 < 1, om te zorgen voor de aanschaf van betrouwbare en reproduceerbaar groei-en fluorescentie gegevens. Een lineaire relatie tussen het celnummer en de OD750 wordt alleen waargenomen binnen een bepaald bereik54. Om dit bereik vast te stellen, raden we aan een seriële verdunning uit te voeren (bijvoorbeeld van OD750 = 0,1 − 1.0) met behulp van een bekende transformant waarbij eyfp fluorescentie is bevestigd. Het uitzetten van absolute fluorescentie tegen genormaliseerde fluorescentie (eYFP fluorescentie/OD750) zal helpen om het lineaire werkbereik van cultuur dichtheden te identificeren. Verschillende plaat lezers bevatten een "gain"-functie om de gevoeligheid van de fluorescentiedetector te wijzigen. In dit geval moet de versterkingswaarde worden ingesteld op een passend niveau voordat u begint met het experiment en niet wordt gewijzigd tussen verschillende experimentele uitvoeringen of de gegevens niet direct vergelijkbaar zijn.

Hoewel de werking van verschillende Flow-Cytometers zal variëren tussen fabrikanten, is het belangrijk om een blanco lezing van de medium oplossing te nemen om de identificatie en het gating van de doel cyanobacteriële populatie te vergemakkelijken van elk achtergrond signaal in het medium (Figuur 7A, B). Als gevolg hiervan zal het aftrekken van de fluorescentie waarde van het negatieve controlemonster (bv. een wild type stam) helpen om inheemse autofluorescentie te verwijderen (Figuur 7C, D). De parameter voor fotomultiplicator (PMT) spanning in een flow-cytometer heeft een vergelijkbare functie als de versterking in een plaat lezer, d.w.z. het vergroten of verkleinen van de gevoeligheid van de detector voor de intensiteit van het fluorescentie signaal. Net als bij de plaat lezer, moet bet spanning worden ingesteld op een geschikt niveau voordat u begint met het experiment55. Eenmaal ingesteld, de bet voltage waarde moet worden gehandhaafd tussen verschillende experimentele runs of de gegevens zullen niet direct vergelijkbaar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs zijn dankbaar voor de FYCONET biotechnologie en biologische wetenschappen Research Council (BBSRC) netwerk in de industriële biotechnologie en bio-energie (NIBB) en de industriële biotechnologie Innovation Centre (IBioIC) voor financiële ondersteuning. GARG, AASO en AP erkennen financieringssteun van het BBSRC EASTBIO CASE PhD programma (grantnummer BB/M010996/1), het Consejo Nacional de Ciencia y Tecnología (CONACYT) PhD programma, en het IBioIC-BBSRC collaborative training Partnership (CTP) PhD programma, Respectievelijk. We danken Conrad Mullineaux (Queen Mary University of London), en Poul Eric Jensen en Julie Anne Marie Zita Zedler (Universiteit van Kopenhagen) voor plasmide vector-en Protocol bijdragen en advies.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
Genetische modificatie van cyanobacteriën door conjugatie met behulp van de CyanoGate modulaire kloon Toolkit
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter