Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Modificazione genetica dei cianobatteri mediante congiugazione utilizzando il toolkit di clonazione modulare CyanoGate

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Qui, presentiamo un protocollo che descrive come i) assemblare un vettore auto-replicante utilizzando il toolkit di clonazione modulare CyanoGate, ii) introdurre il vettore in un ospite cianobatterico per coniugazione, e iii) caratterizzano ceppi di cianobatteri transgenici utilizzando un lettore di lamele o citometria di flusso.

Abstract

I cianobatteri sono un gruppo eterogeneo di organismi fotosintetici procyotici che possono essere geneticamente modificati per la produzione rinnovabile di beni industriali utili. I recenti progressi nella biologia sintetica hanno portato allo sviluppo di diversi toolkit di clonazione come CyanoGate, un sistema di clonazione modulare standardizzato per la costruzione di vettori plasmidi per la successiva trasformazione o trasferimento coniugale nei cianobatteri. Qui delineamo un metodo dettagliato per assemblare un vettore auto-replicante (ad esempio, portando una cassetta di espressione marcatore fluorescente) e il trasferimento coniugale del vettore nei ceppi cianobatterici Synechocystis sp. PCC 6803 o Synechococcus elongatus UTEX 2973. Inoltre, illustreremo come caratterizzare le prestazioni di una parte genetica (ad esempio, un promotore) utilizzando un lettore di lastre o una citometria di flusso.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I cianobatteri sono batteri autotrofici che possono essere utilizzati per la biosintesi di un'ampia varietà di prodotti metabolici naturali ed eterologhi di alto valore1,2,3,4,5, 6. Diversi ostacoli devono ancora essere superati per espandere la loro redditività commerciale, in particolare, le rese relativamente scarse rispetto alle bio-piattaforme eterotrofiche (ad esempio, Escherichia coli e lievito)7. La recente espansione degli strumenti di ingegneria genetica disponibili e l'assorbimento del paradigma della biologia sintetica nella ricerca cianobatterica sta contribuendo a superare tali sfide e a sviluppare ulteriormente i cianobatteri come biofabbriche efficienti8, 9,10.

I principali approcci per introdurre il DNA nei cianobatteri sono la trasformazione, la coniugazione e l'elettroporazione. I vettori trasferiti ai cianobatteri mediante trasformazione o elettroporazione sono vettori "suicidio" (cioè vettori integrativi che facilitano la ricombinazione omologa), mentre i vettori auto-replicanti possono essere trasferiti ai cianobatteri trasformazione, coniugazione o elettroporazione. Per il primo, è disponibile un protocollo per le specie di modelli di ingegneria suscettibili alla trasformazione naturale11. Più recentemente, è stato sviluppato un kit di strumenti modulare di clonazione (MoClo) per cianobatteri chiamato CyanoGate che impiega un metodo standardizzato di assemblaggio vettoriale Golden Gate per l'ingegneria utilizzando la trasformazione naturale, l'elettroporazione o la coniugazione12.

Le tecniche di assemblaggio di tipo Golden Gate sono diventate sempre più popolari negli ultimi anni, e gli standard di assemblaggio e le librerie di parti sono ora disponibili per una varietà di organismi13,14,15,16 ,17. Golden Gate utilizza enzimi di restrizione IIS di tipo (ad esempio, BsaI, BpiI, BsmBI, Btg-I e AarI) e un'azione di accettatori e sbalzi univoci per facilitare l'assemblaggio gerarchico direzionale di sequenze multiple in una reazione di assemblaggio "one pot". Gli enzimi di restrizione IIS di tipo Riconoscono una sequenza asimmetrica unica e tagliano una distanza definita dai loro siti di riconoscimento per generare un taglio sfalsato e "estremità appiccicosa" (in genere una sporgenza di 4 nucleotidi [NT]), che può essere successivamente sfruttata per guidare il DNA ordinato reazioni di assemblaggio15,18. Ciò ha facilitato lo sviluppo di grandi librerie di parti modulari di livello 0 (ad esempio, promotori, frame di lettura aperti e terminatori) definiti da una sintassi comune, come lo standard PhytoBricks19. Le parti di livello 0 possono quindi essere facilmente assemblate in cassette di espressione di livello 1, in seguito alle quali gli assiemi di ordine superiore più complessi (ad esempio, costrutti di espressione multigenetica) possono essere compilati in un vettore di accettazione scelto12,15. Un vantaggio chiave delle tecniche di assemblaggio di tipo Golden Gate è la loro amenabilità all'automazione in impianti ad alta produttività, come le fonderie di DNA20,21, che possono consentire il test di progetti sperimentali complessi che non può essere facilmente raggiunto con il lavoro manuale.

CyanoGate si basa sul sistema Plant MoClo12,15. Per incorporare una nuova parte in CyanoGate, la sequenza di parti deve prima essere addomesticata, cioè i siti di riconoscimento "illegali" per BsaI e BpiI devono essere rimossi. Nel caso di una parte codifica per un frame di lettura aperto (cioè una sequenza di codifica, CDS), i siti di riconoscimento possono essere interrotti generando mutazioni sinonimi nella sequenza (cioè, cambiando un codone in un'alternativa che codifica per lo stesso residuo di amminoacidi). Ciò può essere ottenuto da una varietà di approcci, che vanno dalla sintesi del DNA alla reazione a catena polimerasi (PCR) strategie basate sull'amplificazione come Gibson assembly22. A seconda dell'espressione host utilizzato, si dovrebbe fare attenzione a evitare l'introduzione di codoni rari che potrebbero inibire l'efficienza della traduzione23. La rimozione dei siti di riconoscimento nelle sequenze promotore e terminatore è in genere un'impresa più rischiosa, poiché le modifiche possono influire sulla funzione e la parte potrebbe non funzionare come previsto. Ad esempio, le modifiche ai siti di binding del fattore di trascrizione putativa o al sito di legame del ribosoma all'interno di un promotore potrebbero alterare la forza e la reattività all'induzione/repressione. Allo stesso modo, le modifiche alle caratteristiche strutturali principali del terminatore (ad esempio, il gambo ricco di GC, il loop e la coda poli-U) possono modificare l'efficienza di terminazione e l'espressione genica effetto24,25. Sebbene siano disponibili diverse risorse online per prevedere l'attività delle sequenze promotore e terminatore e informare se una mutazione proposta influirà sulle prestazioni26,27, questi strumenti sono spesso scarsi predittori di prestazioni in cianobatteri28,29,30 . Di conseguenza, si raccomanda ancora la caratterizzazione in vivo delle parti modificate per confermare l'attività. Per facilitare la clonazione delle sequenze recalcitranti, CyanoGate include un vettore dell'accettatore di clonazione a bassa copia basato sul vettore BioBrick pSB4K512,16,31. Inoltre, un portale "Design and Build" è disponibile attraverso la Edinburgh Genome Foundry per aiutare con la progettazione vettoriale (dab.genomefoundry.org). Infine, e soprattutto, CyanoGate include due progetti di vettori dell'accettatore di livello T (equivalenti ai vettori dell'acceleratore di livello 2)15 per l'introduzione di DNA nei cianobatteri utilizzando vettori suicidi o vettori di gamma ospite di ampio tipo in grado di auto-replicarsi in diverse specie cianobatteriche32,33,34.

Qui ci concentreremo sulla descrizione di un protocollo per la generazione di vettori auto-replicanti di livello T e la modificazione genetica di Synechocystis PCC 6803 e Synechococcus elongatus UTEX 2973 (Synechocystis PCC 6803 e S. elongatus UTEX 2973 in seguito) per coniugazione (noto anche come accoppiamento triparentale). Il trasferimento coniugale di DNA tra cellule batteriche è un processo ben descritto ed è stato precedentemente utilizzato per l'ingegneria di specie cianobatteriche, in particolare quelle che non sono naturalmente competenti, come S. elongatus UTEX 297335, 36,37,38,39,40,41. In breve, le colture cianobatteriche vengono incubate con un ceppo E. coli che trasporta il vettore da trasferire (il vettore "cargo") e vettori (nella stessa deformazione E. coli o in ceppi aggiuntivi) per consentire la coniugazione ("mobilizer" vettori "helper"). Per il trasferimento coniugale sono necessarie quattro condizioni chiave: 1) il contatto diretto tra le cellule coinvolte nel trasferimento del DNA, 2) il vettore di carico deve essere compatibile con il sistema di coniugazione (cioè deve contenere un'origine adeguata del trasferimento (oriT), noto anche come bom (base di mobilità) sito), 3) una proteina di nicking del DNA (ad esempio, codificata dal gene della mafia) che intacca il DNA all'oriT per avviare il trasferimento a filamento del DNA nel cianobatterio deve essere presente ed esprimere vettori di carico o di supporto, e 4) il DNA trasferito non deve essere distrutto nel cianobatterio ricevente (cioè, deve essere resistente alla degradazione da, ad esempio, restrizione endonuclease attività)35,42. Affinché il vettore di carico persista, l'origine della replica deve essere compatibile con il cianobatterio ricevente per consentire l'auto-replicazione e la proliferazione nelle cellule figlie dopo la divisione. Per aiutare con le condizioni 3 e 4, diversi vettori helper sono disponibili attraverso Addgene e altre fonti commerciali che codificano per la mafia così come diverse metile per proteggere da endonucleasi nativi nel cianobatterio ospite43. In questo protocollo, la coniugazione è stata facilitata da un ceppo MC1061 E. coli che trasporta vettori mobilitatori e aiutanti pRK24 (www.addgeneorg/51950) e pRL528 (www.addgene.org/58495). Quando si scelgono i vettori da utilizzare per il trasferimento coniugale, occorre prestare attenzione. Ad esempio, nel kit CyanoGate il vettore cargo auto-replicante pPMQAK1-T codifica per una proteina Mob12. Tuttavia, pSEVA421-T non44e come tale, mob deve essere espresso da un vettore helper adatto. Anche i vettori utilizzati devono essere appropriati per l'organismo bersaglio. Ad esempio, un trasferimento efficiente dei coniugali in Anabaena sp. PCC 7120 richiede un vettore helper che protegga il vettore mobilitante dalla digestione (ad esempio, pRL623, che codifica per le tre metilasi AvaiM, Eco47iiM ed Ecot22iM)45, 46.

In questo protocollo viene ulteriormente descritto come caratterizzare le prestazioni delle parti (cioè promotori) con un marcatore fluorescente utilizzando un lettore di lastre o un citometro di flusso. I citometri di flusso sono in grado di misurare la fluorescenza su una singola base cellulare per una grande popolazione. Inoltre, i citometri di flusso consentono agli utenti di "portare" i dati acquisiti e rimuovere il rumore di fondo (ad esempio, dal particolato nella coltura o nella contaminazione). Al contrario, i lettori di placche acquisiscono una misurazione a fluorescenza aggregata di un dato volume di cultura, tipicamente in diversi pozzi replicanti. I principali vantaggi dei lettori di placche rispetto ai citometri includono il costo più basso, una maggiore disponibilità e in genere nessun requisito per software specializzato per l'analisi dei dati a valle. I principali inconvenienti dei lettori di placche sono la sensibilità relativamente più bassa rispetto ai citometri e potenziali problemi con la densità ottica delle culture misurate. Per le analisi comparative, i campioni di lettori di placche devono essere normalizzati per ogni pozzo (ad esempio, ad una misurazione della densità di coltura, generalmente presa come assorbimento alla densità ottica a 750 nm [OD750]), il che può portare a imprecisioni per i campioni troppo denso e/o non ben miscelato (ad es. quando è soggetto ad aggregazione o flocculazione).

Come panoramica, qui dimostriamo in dettaglio i principi di generazione di parti di livello 0, seguiti dall'assemblaggio gerarchico utilizzando il kit CyanoGate e la clonazione in un vettore adatto per il trasferimento coniugale. Dimostriamo quindi il processo di trasferimento coniugale, la selezione di ceppi transconiugici transconiugici che esprimono un marcatore fluorescente e la successiva acquisizione di dati di fluorescenza utilizzando un citometro di flusso o un lettore di lastre.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Assemblaggio vettoriale con i toolkit Plant MoClo e CyanoGate

NOTA: Prima di procedere con l'assemblaggio vettoriale, si consiglia vivamente agli utenti di familiarizzare con le strutture a livello vettoriale dei sistemi Plant e CyanoGate MoClo12,15.

  1. Costruzione di parti di livello 0
    NOTA: le parti di livello 0 possono essere sintetizzate come vettori completi o sequenze lineari per l'assieme con accettatori di livello 0 (ad esempio, gBlocks, IDT). In alternativa, le sequenze possono essere amplificate da un modello di origine (ad esempio, un vettore o un DNA genomico purificato). Qui viene descritto come generare una nuova parte di livello 0 da un prodotto amplificato. Una panoramica del processo di assemblaggio di Golden Gate dal livello 0 al livello T è mostrata inFigura 1.
    1. Progettare i primer.
      1. Decidere quale modulo di livello 0 assemblare e identificare le sporgengie appropriate 5 e 3 (Tabella 1)12,15. Controllare la sequenza di DNA da clonare per la presenza di siti di restrizione BpiI o BsaI.
        NOTA: una sequenza contenente uno di questi siti deve essere addomesticata modificando uno o più NT nella sequenza del sito di restrizione. Una strategia per eseguire questa operazione utilizzando l'assembly Golden Gate è descritta nella Figura 2.
      2. Per amplificare una sequenza di DNA, progettare una coppia di primer in avanti e indietro appropriata. Per il primer in avanti, selezionare 18-30 bp complementari all'estremità 5 o più della sequenza del modello di DNA. Per il primer inverso, selezionare 18-30 bp reverse complementare all'estremità 3 o più della sequenza del modello di DNA.
        NOTA: I motociclisti con temperature di fusione (Tm) di 58,62 gradi centigradi danno in genere i risultati di amplificazione più coerenti (Figura 1A).
      3. Aggiungere quanto segue all'estremità 5' del primer in avanti: 1) una stringa casuale di 4-6 NT alla fine 5 del sito BpiI, 2) il sito di restrizione BpiI (GAAGAC), 3) due NT casuali e 4) la sporgenza 5 o più selezionata nel passaggio 1.1.1.1. Aggiungere quanto segue all'estremità 5' del primer inverso: 1) una stringa casuale di 4-6 NT alla fine 5 del sito BpiI, 2) il sito di restrizione BpiI (GAAGAC), 3) due NT casuali e 4) la sporgenza di 3 gradi selezionata nel passaggio 1.1.1.1. Una volta finalizzate, ordinare le coppie di primer.
        NOTA: Vedere la figura 1A per un esempio di coppia di primer in avanti e inversa.
    2. Amplifica una sequenza di DNA dal DNA genomico.
      1. Estrarre il DNA genomico come descritto nella sezione 5. Amplifica i prodotti PCR utilizzando una polimerasi del DNA ad alta fedeltà (Tabella dei materiali).
        NOTA: Ad esempio, impostare le reazioni PCR (20-50 gradi centigradi) secondo le istruzioni del produttore. Usa 100 dollari di DNA genomico per reazione. Utilizzare un programma di ciclismo termico costituito da una fase iniziale di denaturazione di 98 gradi centigradi per 30 s, seguita da non più di 25 cicli di denaturazione a 98 gradi centigradi per 10 s, primer annealing a 58 s per 15 s e l'estensione del prodotto a 72 s per 30 s (modificare quest'ultimo a seconda del dimensioni del prodotto/tipo di polimerasi del DNA utilizzato), seguita da una fase di estensione finale di 72 gradi centigradi per 2 min.
      2. Se il prodotto PCR deve essere purificato in gel, eseguire l'intera reazione PCR su un gel di agarose come descritto nella sezione 6. Tagliare la banda di interesse dal gel di agarose e purificarla utilizzando un kit di estrazione gel (Tabella dei materiali).
      3. Alternativa al passaggio 1.1.2.2, se il prodotto PCR deve essere utilizzato senza purificazione del gel, verificare la dimensione della banda eseguendo un campione di reazione PCR (5 dollari ll) su un gel di agarose. Se il gel mostra solo la banda appropriata e nessuna prova di dimeri primer, purificare il prodotto PCR utilizzando un kit di purificazione del DNA (Tabella dei materiali).
      4. Elute DNA purificato in un piccolo volume di acqua deionizzata (ad es., 10 l) per ottenere un'alta concentrazione di DNA (>20 ng/L è in genere sufficiente).
    3. Assemblare il prodotto (o i prodotti del DNA amplificato, vedere la figura 2) nel livello 0. Preparare un mix di reazione di 20 -L con BpiI (Figura 1B) e impostare il programma del ciclore termico come descritto nella tabella 2. Procedere alla trasformazione di E. coli utilizzando 5 :L della miscela di reazione assemblata di livello 0 (come descritto nella sezione 2).
  2. Costruzione di assiemi di livello 1
    1. Decidere quali parti di livello 0 assemblare (Figura 1C e Tabella 1). Scegliere un vettore di accettazione di livello 1 appropriato15.
      NOTA: In questa fase è importante sapere quale sarà il design finale del vettore nel livello T, in quanto ciò influirà sulla scelta del vettore dell'accettatore di livello 1. La posizione di livello 1 (Avanti) vettore di accettazione (pICH47732) può essere utilizzato come predefinito se l'obiettivo è quello di avere un singolo assieme di livello 1 (ad esempio, una cassetta di espressione genica) nel livello T. Tuttavia, se due o più assiemi di livello 1 devono essere assemblati nel livello T, è necessario considerare la posizione e la direzione di ogni assieme di livello 1. È possibile assemblare fino a sette assiemi di livello 1 in un vettore dell'acceleratore di livello T utilizzando vettori di acceleratore di livello 1 con posizioni appropriate12.
    2. Assemblare le parti di livello 0 nel livello 1. Preparare un mix di reazione di 20 -L con BsaI e impostare il programma del ciclore termico come descritto nella tabella 2. Procedere alla trasformazione di E. coli utilizzando 5 :L della miscela di reazione di livello 1 assemblata (come descritto nella sezione 2).
  3. Costruzione di assiemi di livello T
    1. Decidere quali assiemi di livello 1 assemblare (Figura 1D). Scegliere un vettore di accettazione di livello T appropriato.
      NOTA: pUC19A-T (resistenza all'ampicillina) e pUC19S-T (resistenza alla spettronomicina) sono vettori integrativi di numero ad alta copia che non sono in grado di replicarsi nei cianobatteri e sono utilizzati principalmente per l'integrazione genomica (ad esempio, knock-in o knock-out di geni) tramite ricombinazione omologa12. La consegna di vettori integrativi può procedere con la trasformazione naturale in amabili specie cianobatteriche11. pPMQAK1-T è un ampio range host, vettore replicativo fornito tramite trasferimento coniugale (sezione 3).
    2. Scegliere un fine-link appropriato per sigarare l'estremità di 3 gradi dell'assieme di livello 1 finale alla backbone Livello T15.
      NOTA: il Collegamento finale richiesto è lo stesso numero della posizione della parte finale. Ad esempio, un vettore di livello T con una sola parte di posizione di livello 1 (avanti o indietro) richiederà End-Link 1 (pICH50872) per la legatura nella backbone di livello T.
    3. Assemblare uno o più assiemi di livello 1 nel livello T. Preparare una combinazione di reazione con BpiI e il vettore End-Link richiesto e impostare il programma del ciclore termico come descritto nella tabella 2. Procedere alla trasformazione di E. coli utilizzando 5 :L del mix di reazione di livello T assemblato (come descritto nella sezione 2).

2. Trasformazione di E. coli e purificazione vettoriale

  1. Trasformazione di E. coli (giorno 1)
    1. Scongelare un'aliquota (25- L) di cellule E. coli chimicamente competenti (Tabella dei materiali) e pipetta delicatamente in un tubo da 1,5 mL sul ghiaccio. Aggiungete 5-L della miscela di assiemi (Livello 0, 1 o T) e incubate il tubo sul ghiaccio per altri 30-60 min.
    2. Le cellule di shock termico incubano il tubo in un bagno d'acqua a 42 gradi centigradi per 30 s, quindi riporre il tubo sul ghiaccio per 2 min. Incubare il tubo a 37 gradi centigradi per 1 h a 225 giri in un'incubatrice agitazione.
    3. Piastra 40 -L della coltura su una piastra di agar LB contenente l'appropriata concentrazione finale di antibiotici (100 g/mL per la spettromicina didihydrochloride pentahydrate [Livello 0], 100 g/mL di carcillina disodio [Livello 1], o 50 g/mL di solfato di canamicina [ Livello T]), 1 mM isopropil-beta-D-thiogalactopyranoside (IPTG) e 40 g/mL di 5-bromo-4-chloro-3-indolyl-z-D-galactopyranoside (X-Gal) per lo screening blu-bianco. Incubare la piastra per una notte a 37 gradi centigradi.
      NOTA: La quantità di coltura placcata può essere variata a seconda dell'efficienza delle cellule competenti di E. coli e della reazione di legatura. Piastrare un volume maggiore se si osservano colonie <10 dopo l'incubazione notturna.
  2. Selezione delle colonie bianche e preparazione delle colture liquide (giorno 2)
    NOTA: a seconda dell'efficienza della reazione di assemblaggio e della successiva trasformazione, le piastre di agar LB non possono contenere colonie, colonie blu o colonie bianche (Figura 3). Le colonie blu sono indicative di vettori accettanti che non hanno subito restrizioni (cioè, è ancora presente una copia funzionale di lac. Le colonie bianche indicano che la cassetta dell'espressione lac è stata persa e sostituita da una parte/assemblaggio.
    1. Facoltativamente, verificare che le colonie bianche contengano il vettore previsto eseguendo la PCR come descritto nella sezione 7.
    2. Scegli colonie bianche singole (o colonie verificate PCR) con una punta di 10 gradini e trasferiscili su un tubo di centrifuga da 15 mL contenente un supporto LB (5 mL) e concentrazioni antibiotiche appropriate (fase 2.1.3). Incubare i tubi a 37 gradi durante la notte a 225 giri/min in un'incubatrice che trema.
  3. Purificazione vettoriale plasmide (giorno 3)
    1. Facoltativamente, preparare uno stock di glicerolo della cultura e. coli durante la notte per criostoccaggio a lungo termine di vettori. Aggiungete 500 llitri di coltura batterica a 500 - L del 50% (v/v) glicerolo in un tubo appropriato da 1,5,2,0 mL per crioregistratolo a -80 gradi centigradi. Mescolare delicatamente invertendo 5-10x. Congelare i campioni in azoto liquido e conservarli in un congelatore a -80 gradi centigradi.
    2. Scartare le colture in tubi centrifuga da 15 mL a 3.000 x g per 5-10 min. Scartare il supernatante senza disturbare il pellet cellulare. Purificare il vettore utilizzando un kit di purificazione plasmide (Tabella dei materiali). Vettore purificato in 35 - L di acqua deionizzata.
      NOTA: Utilizzare volumi di eluizione inferiori per aumentare ulteriormente la concentrazione vettoriale. Lo stesso eluente può essere messo attraverso una colonna di purificazione due volte per aumentare i rendimenti.
    3. Misurare la concentrazione del vettore nell'eluente utilizzando uno spettrofotometro (Tabella dei materiali).
      NOTA: I vettori di numero di copia alti in E. coli, ad esempio pUC19, in genere forniscono rendimenti di 50/300 ng/L. Vettori di numeri di copia bassi, ad esempio pPMQAK1-T, in genere danno rendimenti di 15/60 ng/L.
  4. Convalida vettoriale
    NOTA: i vettori possono essere verificati mediante digestione delle restrizioni (passaggio 2.4.1) e/o sequenziamento (passaggio 2.4.2).
    1. Limitare 0,5 o 1 g di vettore con uno o più enzimi di restrizione appropriati e verificare le dimensioni previste della banda, come descritto nella sezione 6(Figura 4).
      NOTA: le dimensioni delle bande errate indicano in genere un assieme errato, nel qual caso è possibile vagliare più colonie bianche o ripetere l'assemblaggio. BsaI e BpiI possono essere utilizzati per convalidare la dimensione corretta dell'inserto rispettivamente per gli assiemi di livello 0 e livello 1. BsaI o BpiI possono essere utilizzati in combinazione con un ulteriore enzima di restrizione compatibile che taglia all'interno dell'inserto e/o della spina dorsale vettoriale per produrre una serie distinta di bande ben separate dopo la digestione.
    2. Sequenziare il vettore mediante sequenziamento Sanger utilizzando un'appropriata primer a monte della regione assemblata utilizzando l'impianto di sequenziamento commerciale (Tabella 3).
      NOTA: tutte le nuove parti di livello 0 devono essere sequenziate per confermare l'identità della sequenza prevista. La convalida della sequenza dei vettori di livello 1 e T non è in genere necessaria se assemblata da parti di livello 0 precedentemente sequenziate.

3. Generazione di mutanti per coniugazione

NOTA: Qui, viene descritto un protocollo per il trasferimento coniugale di un vettore cargo auto-replicante in Synechocystis PCC 6803 o S. elongatus UTEX21,47. Questo protocollo è applicabile ad altre specie modello (ad esempio, S. elongatus PCC 7942 e Synechococcus sp. PCC 7002). Tutto il lavoro con i cianobatteri (e i preparati tamponati associati) deve essere fatto in condizioni sterili in una cappa a flusso laminare.

  1. Crescita della coltura cianobatterica (giorno 1)
    1. Preparare il mezzo BG11 secondo le piastre Lea-Smith et al.11e le piastre di agar con l'LB-BG11 e il BG11-Kan50 (sezione 8).
    2. Impostare una nuova coltura di Synechocystis PCC 6803 o S. elongatus UTEX 2973 inoculando un fiaschetta conica da 100 ml di mezzo BG11 fresco (50 mL) con cellule provenienti da una piastra di agar BG11 ascia ascia ascia. Coltiva le colture Synechocystis PCC 6803 a 30 gradi centigradi, 100 fotoni m-2s-1 a 100 giri/m e coltiva S. elongatus UTEX 2973 a 40 gradi, 300 fotoni mol m-2s -1 a 100 giri/m. Crescere le culture fino a quando OD750 - 0,5-1,5 (tipicamente 1/2 giorni).
      NOTA: le colture S. elongatus UTEX 2973 possono essere coltivate a 40 gradi centigradi in alta intensità luminosa (ad es., 2000 fotoni mol m-2s-1)48.
  2. Crescita dei ceppi helper e cargo E. coli (giorno 2)
    1. Inoculato LB medio contenente ampicillina (concentrazione finale 100 g/mL) e cloramfenicolo (concentrazione finale 25 g/mL) con un ceppo MC1061 E. coli contenente vettori pRK24 e pRL528 (cioè il ceppo di supporto) e crescono a 37 gradi durante la notte a 225 m in un incubatore tremante. Crescere un volume sufficiente di coltura di deformazione aiutante, supponendo che 1 mL di coltura è necessario per coniugazione.
    2. Inoculare LB medio (5 mL) contenente antibiotici appropriati con la coltura E. coli che trasporta il vettore di carico (cioè un vettore di livello T). Coltivare la coltura a 37 gradi centigradi durante la notte a 225 giri/min in un'incubatrice tremante.
  3. Trasferimento coniugale (accoppiamento triparentale) (giorno 3)
    1. Preparare l'aiutante E. coli e ceppi di carico. Centrifugare l'aiutante e il carico E. coli durante la notte colture a 3.000 x g per 10 min a temperatura ambiente. Scartare il supernatante senza disturbare il pellet cellulare.
    2. Lavare il pellet aggiungendo un mezzo LB fresco senza antibiotici. Utilizzare lo stesso volume delle impostazioni cultura iniziali. Risospendere il pellet pipettando delicatamente su e giù. Non vorticare la cultura. Ripetere questo passaggio 3x per rimuovere gli antibiotici residui dalla coltura durante la notte.
    3. Centrifugare la coltura risospesa (come nel passaggio 3.3.1), eliminare il supernatante e rispendere a metà il volume del supporto LB del volume di coltura iniziale (ad esempio, 2,5 mL se la cultura durante la notte era di 5 mL). Unire 450 l del ceppo di ausilio con 450 l della deformazione del carico in un tubo da 2 mL e mettere da parte (lasciare a RT) fino al punto 3.3.6.
    4. Preparare la coltura cianobatterica. Per ogni reazione di coniugazione, usate 1 mL di coltura cianobatterica (OD750 - 0,5,5).
    5. Centrifugare il volume totale richiesto di coltura cianobatterica a 1.500 x g per 10 min a RT, quindi scartare il supernatante con attenzione senza disturbare il pellet cellulare. Lavare il pellet aggiungendo un nuovo mezzo BG11 dello stesso volume iniziale. Risospendere il pellet da pipeting delicatamente su e giù, non vorticare la coltura. Ripetere questo passaggio 3x e mettere da parte la coltura lavata.
    6. Aggiungete una varietà di coltura cianobatterica lavata (900) ai ceppi combinati di E. coli (helper e cargo) (900 l) in un tubo da 2 mL. Mescolare le culture pipeting delicatamente su e giù. Non vortice. Incubare la miscela a RT per 30 min per Synechocystis PCC 6803 o 2 h per S. elongatus UTEX 2973.
    7. Centrifugare la miscela a 1.500 x g per 10 min a RT. Rimuovere 1,6 mL del sovrentrato. Risospendere il pellet nei restanti 200 dollari l'una di super-natante. Posizionare un filtro di membrana da 0,45 m su una piastra di agar LB-BG11 priva di antibiotici (sezione 8). Diffondere con cura 200 -L della coltura E. coli/cyanobacterial mix sulla membrana con uno spalmatore sterile o una punta sterile piegata e sigillare la piastra con pellicola di paraffina.
    8. Incubare la piastra LB-BG11 con la membrana per 24 h. Mantenere le membrane con colture Synechocystis PCC 6803 a 30 , 100 di fotoni mol m-2s-1. Mantenere le membrane con le colture S. elongatus UTEX 2973 a 40 gradi centigradi in 150 fotoni mol m-2s-1.
  4. Trasferimento di membrana
    1. Dopo 24 h, trasferire con attenzione la membrana utilizzando pinze sterilizzate a fiamma in una piastra di agar BG11 fresca contenente antibiotici appropriati (sezione 8) da selezionare per il vettore di carico. Sigillare la piastra con pellicola di paraffina.
    2. Incubare la placca di agar BG11 in condizioni di crescita appropriate, come descritto sopra per Synechocystis PCC 6803 o S. elongatus UTEX 2973, fino a quando non compaiono colonie.
      NOTA: le colonie appaiono in genere dopo 7-14 giorni per Synechocystis PCC 6803 e 3/7 giorni per S. elongatus UTEX 2973.
  5. Selezione di coniugati
    NOTA: Solo le colonie cianobatteriche che trasportano il vettore di carico saranno in grado di crescere sulla membrana (Figura 5).
    1. Utilizzando un ciclo sterile di calore, selezionare almeno due colonie individuali dalla membrana e striscia su una nuova piastra di agar BG11 contenente antibiotici appropriati (Figura 5C).
      NOTA: le colonie appena striate possono ancora essere contaminate da E. coli trasportate dalla coniugazione (cioè se piccole colonie bianche sono evidenti sulla piastra), quindi due o tre ulteriori giri di re-streaking su piastre fresche di agar BG11 sono tipicamente necessario per ottenere una coltura cianobatterica ascia.
    2. Confermare l'assenza di contaminazione da E. coli inoculando una striscia di coltura cianobatterica in un tubo centrifugato rel da 15 mL contenente 5 mL di LB medio e incubando a 37 gradi durante la notte a 225 giri/m in un'incubatrice tremante. Dopo un periodo di crescita sufficiente (7 giorni), scegli singole colonie axeniche per creare colture liquide per criostorage a lungo termine o sperimentazioni successive.
  6. Crioconservazione dei ceppi cianobatterici
    1. Coltiva una coltura liquida cianobatterica in BG11 (come descritto nella sezione 3.1) fino all'OD750 x 1,5-3,0. Centrifuga 10 mL di coltura per 10 min a 1.500 x g, rimuovere il supernatante e risospendere le cellule in 5 mL di medio BG11 fresco.
    2. Aggiungere 3,5 mL di autoclave sterilizzato 50% (v/v) glicerolo per una concentrazione finale di glicerolo di49. Questo approccio funziona bene per Synechocystis PCC 6803. In alternativa, aggiungere 5 mL di filtro sterilizzato BG11 contenente 16% (v/v) di zolfo dimetilo (DMSO) per una concentrazione finale di DMSO di 8% (v/v)50. Questo approccio è consigliato per la maggior parte dei ceppi, tra cui S. elongatus UTEX 2973.
      AVVISO: il DMSO è tossico e deve essere gestito con un'adeguata protezione.
    3. Mescolare delicatamente invertendo 5-10x. Subaliquot 1 mL di coltura in tubi a cappuccio a vite da 1,5 mL separati (Tabella dei materiali). Collocare i tubi in un congelatore a -80 gradi centigradi per la crioconservazione. Non congelare in azoto liquido.
      NOTA: si raccomandano almeno tre scorte per ceppo.
    4. Per il recupero, rimuovere un tubo dal congelatore -80 gradi centigradi e scongelare la coltura in un bagno d'acqua a 35 gradi mentre si mescola delicatamente. Aggiungere la cultura scongelata a 50 mL di medio BG11 fresco e crescere come coltura liquida (come descritto nella sezione 3.1).
      NOTA: In alternativa, la coltura può essere striata e coltivata su un piatto fresco di agar BG11. Le colture transgeniche che trasportano marcatori di selezione devono essere rivitalizzate inizialmente su piastre di agar BG11 senza antibiotici e poi restriate su piastre di agar BG11 con antibiotici appropriati.

4. Promotore caratterizzazione

NOTA: Qui viene descritto un approccio standard per analizzare la forza di una parte promotrice misurando i livelli di espressione di un marcatore fluorescente (eYFP) in seguito a un periodo di crescita di 72 h utilizzando un lettore di lastre o un citometro di flusso12.

  1. Crescita culturale
    1. Impostare colture di semi inoculando 10 mL di mezzo BG11 contenente antibiotici appropriati con una singola colonia del ceppo cianobatterico transgenico che porta la cassetta di espressione marcatore fluorescente. Preparare anche le colture di semi per ceppi di controllo negativi appropriati (ad esempio, un ceppo di tipo selvaggio e/o un ceppo transgenico che trasporta la stessa spina dorsale vettoriale ma privo della cassetta di espressione del marcatore fluorescente).
      NOTA: si raccomandano almeno quattro repliche biologiche.
    2. Coltiva le colture di semi per 48 h o fino a quando oD750
    3. Per tenere traccia dell'espressione del promotore nel tempo, misurare innanzitutto l'OD750 di ogni cultura del seme. Calcolare i requisiti di diluizione per portare ogni coltura a un OD750 iniziale - 0,2. Impostare campioni di coltura sperimentale diluiti (volume totale di 2 mL) in una piastra piatta di 24 pozze (Tabella dei materiali).
    4. Incubare la piastra in un incubatore di agitazione con luci LED bianche (Tabella dei materiali) in condizioni di crescita appropriate. Misurare la densità di crescita della coltura (OD750)e la fluorescenza delle proteine fluorescenti gialle (eYFP) potenziate utilizzando un lettore di lastre (sezione 4.2) o un citometro di flusso (sezione 4.3).
      NOTA: le impostazioni cultura Synechocystis PCC 6803 e S. elongatus UTEX 2973 possono essere coltivate come nel passaggio 3.1.2. Si raccomanda vivamente che la piastra sia mantenuta sotto un'elevata umidità (95%) per evitare l'evaporazione dei campioni di coltura.
  2. Lettore di piastre
    1. Mescolare brevemente le culture nella piastra 24-well (passaggio 4.1.4) con pipettaggio delicato. Trasferire un sottocampione di ciascuna coltura in una piastra nera piatta 96 po ' (Tabella dei materiali). Diluire se necessario (100 o l volume finale). Evitare la formazione di bolle in quanto questo può interferire con la precisione di misurazione.
      NOTA: Si consiglia di eseguire tutte le misurazioni su campioni in un intervallo OD750 di 0,2.1.0. Poiché la densità delle colture nel pozzo 24 aumenterà nel tempo, si raccomandano le seguenti diluizioni in base agli aumenti previsti delle condizioni di crescita standard: nessuna diluizione a 0 h, 1:4 a 24 h, 1:10 a 48 h e 1:10 a 72 h. Ad esempio, a 24 h raccogliere 25 - L di coltura e mescolare con 75 -L di BG11 medio.
    2. Includere due pozze vuote nella piastra del pozzo 96 (cioè 100 -L di Mezzo BG11). Mettere la piastra da 96-po in un lettore di piastra (Tabella dei materiali). Agitare la piastra per 60 s a 500 rpm utilizzando lo shaker orbitale nel lettore di piastre per mescolare i pozzetti.
      NOTA: Le colture cianobatteriche possono aggregarsi e/o flocculate, quindi una buona miscelazione è fondamentale prima della lettura per misurazioni accurate.
    3. Misurare la fluorescenza OD750 e eYFP con lunghezze d'onda di eccitazione/emissione a 485 nm/520 nm.
    4. Sottrarre la media delle misurazioni OD750 dei due pozzi vuoti dalla misura OD750 di ogni pozzo campione contenente coltura cianobatterici.
    5. Normalizzare i valori di fluorescenza di ogni campione di coltura dividendo la misurazione della fluorescenza eYFP (passaggio 4.2.3) per l'OD750 regolato della coltura (passaggio 4.2.4). Quindi, sottrarre il valore medio di fluorescenza eYFP normalizzato (eYFP fluorescenza/OD750)delle repliche biologiche di un adeguato ceppo di controllo negativo dai ceppi transgenici che trasportano la cassetta di espressione eYFP.
      NOTA: I cianobatteri fluorescenza naturale a causa della presenza di pigmenti, come clorofilla e phycobiliproteine.
    6. Crescita della coltura di trama nel tempo (Figura 6A) e i valori medi di fluorescenza eYFP normalizzati di ogni coltura sperimentale nei punti temporali desiderati (ad esempio, 72 h; Figura 6B).
  3. Cilindro di flusso
    1. Scegliere una piastra compatibile per il sistema di movimentazione del liquido del citometro a flusso. Ad esempio, utilizzare una piastra di 96 pozzeri abbondante (Tabella dei materiali) con il citometro di flusso ( Tabella deimateriali) utilizzato in questo protocollo.
    2. Mescolare brevemente le culture nella piastra 24-well (passaggio 4.1.4) con pipettaggio delicato. Diluire le colture a OD750 - 0,1,0,2 per evitare ostruzioni nel sistema di movimentazione dei liquidi. Aggiungere un volume appropriato di campione di coltura alla piastra di 96 pozze e portare ad un volume finale di 250 gradi con salina con buffer fosfato sterilizzato a filtro 1x (PBS) con buffer di fosfato. Includere un pozzetto bianco per la soluzione media sulla piastra contenente 60 -L di BG11 e 190 -L di 1x PBS.
      NOTA: questo volume è consigliato nel caso in cui sia necessario eseguire nuovamente i campioni. I volumi superiori a 250 L non sono raccomandati in quanto il volume massimo di ogni pozzo è di 300 .
    3. Una volta che il citometro di flusso è pronto per l'uso, posizionare la piastra da 96 pozzetto con campioni di coltura nella stazione di movimentazione dei liquidi. Impostare il protocollo software per il citometro di flusso per raccogliere le misurazioni di 10.000 singoli eventi (ad esempio, le celle). Misurare la fluorescenza eYFP con lunghezze d'onda di eccitazione/emissione di 488 nm/515-545 nm. Misurare innanzitutto e controllare la lettura dal pozzo vuoto (Figura 7A), quindi eseguire i campioni.
    4. Cancellare la popolazione di cellule cianobatteriche all'interno dei set di dati di dispersione in avanti e laterale, escluse le regioni comuni con la lettura in bianco (Figura 7B). Sottrarre i valori medi di fluorescenza eYFP delle repliche biologiche di un adeguato ceppo di controllo negativo dai ceppi transgenici che trasportano l'espressione eYFP cassetta (Figura 7C,D). Tracciare la media dei valori di fluorescenza mediana per cellula per ogni coltura sperimentale nei punti temporali desiderati (ad esempio, 72 h; Figura 7E).

5. Estrazione del DNA genomico dai cianobatteri

NOTA: il protocollo riportato di seguito utilizza un kit di estrazione del DNA commerciale (Tabella dei materiali).

  1. Coltiva una coltura liquida cianobatterica in BG11 (come descritto nella sezione 3.1) fino all'OD750 x 1,5-3,0. Girare giù di 10 mL di coltura a 3.000 x g per 10 min e scartare il supernatante. Congelare il pellet incubando i tubi a -20 gradi centigradi per 30 min.
  2. Aggiungere 400 l of lysis buffer (buffer AP1) e 400 L di soluzione ribonucleato (RNase A) e 50% (w/v) di perline di vetro (diametro di 0,5 mm). Interrompere i campioni utilizzando un mulino a perline (Tabella dei materiali) a 30 Hz (cioè, equivalente a 1.800 oscillazioni/min) per 6 min.
  3. Girare il campione a 17.000 x g per 5 min e trasferire con attenzione il supernatante in un nuovo tubo e scartare il pellet. Procedere secondo le istruzioni del fabbricante (Tabella dei materiali).

6. Elettroforesi gel di agarose

  1. Lanciare un gel di agarose dell'1% (w/v) contenente 0,02% (v/v) bromuro di etidio. Caricare i campioni e un riferimento appropriato alla scala del DNA.
  2. Eseguire i campioni per 50 min a 125 V. Controllare la separazione della banda su un transilluminatore ultravioletto (UV).
    NOTA: il tempo di esecuzione e la percentuale di gel di agarose possono essere modificati per adattarsi alle dimensioni della banda previste. Ad esempio, una percentuale più alta di gel di agarose e tempi di esecuzione più lunghi possono migliorare la risoluzione della banda e la separazione dei prodotti DNA <500 bp.

7. Colonia PCR

  1. Impostare una combinazione di reazione PCR utilizzando un kit standard (Tabella dei materiali) e una combinazione appropriata di primer (ad esempio, primer che fiancheggiano la regione di assemblaggio o sono specifici delle sequenze all'interno della regione di assemblaggio ( Tabella3). Pipetta 10 - L in un tubo PCR.
  2. Toccare delicatamente la parte superiore di una singola colonia bianca con uno stuzzicadenti sterile o una punta di pipetta da 10 l'e inoculare un tubo PCR contenente il mix di reazione PCR. Fare attenzione a contrassegnare la colonia e abbinare con il tubo PCR specifico. Mescolare delicatamente il mix di reazione per garantire che le cellule E. coli vengano versate nella soluzione.
  3. Amplifica i prodotti pcR. Utilizzare un programma costituito da una fase iniziale di denaturazione di 95 gradi centigradi per 60 s, 30 colpi di 95 s per 15 s, 58 gradi centigradi per 15 s (pochi gradi al di sotto dei valori Tm dei primer) , 72 gradi centigradi per 30 s (30 s/kb di inserto) , seguito da un passaggio di estensione finale di 72 gradi centigradi per 5 min.

8. Preparazione del supporto BG11 e piastre

  1. Preparare soluzioni stock di 100x BG11 medio, ferro (citrato ferrico ammonio), oligoelementi, fosfato (K2HPO4), Na2CO3 e TES buffer secondo Lea-Smith et al.11. Autoclave fosfato e Na2CO3 stock. Utilizzare filtri da 0,2 m per filtrare sterilizzare il buffer TES (pH 8.2) e le soluzioni stock NaHCO3.
  2. Preparare 1 L di BG11 medio. Mescolare 10 mL di 100x BG11, 1 mL di oligoelementi e 1 mL di brodo di ferro e autoclave la soluzione con 976 mL di acqua. Una volta che la soluzione si è raffreddata a RT, aggiungere 1 mL di brodo di fosfato, 1 mL di Na2CO3 stock e 10 mL di NaHCO3e regolare al pH 7.6.7.8 con 1 M HCl.
  3. Piastre di agar LB-BG11 (1,5% [w/v])
    1. Unire 700 mL di acqua deionizzata e 15 g di agar in una fiaschetta di vetro. In un secondo flacone, aggiungere 186 mL di acqua, 10 mL di 100x BG11, 1 mL di oligoelementi e 1 mL di brodo di ferro. Autoclave entrambe le soluzioni.
    2. Una volta che le soluzioni si sono raffreddate a circa 60 gradi centigradi, combinarle e aggiungere 1 mL di brodo di fosfato, 1 mL di Na2CO3 stock, 10 mL di NaHCO3 stock e 50 mL di supporto sterile LB, che dovrebbe dare un volume finale di 1 L. Cast Petri piatti con 25 mL del mezzo agar LB-BG11.
  4. Piastre di agar BG11-Kan50 (1,5% [w/v])
    1. Unire 700 mL di acqua deionizzata e 15 g di agar in una fiaschetta di vetro. In un secondo flacone, aggiungere 3 g di tiosulfo di sodio (Na2S2O3),226 mL di acqua, 10 mL di 100x bG11 stock, 1 mL di oligoelementi e 1 mL di brodo di ferro. Autoclave entrambe le soluzioni.
    2. Una volta che le soluzioni si sono raffreddate a circa 60 gradi centigradi, combinarle e aggiungere 1 mL di stock di fosfato, 1 mL di stock di Na2CO3, 10 mL di brodo buffer TES e 10 mL di stock NaHCO3, che dovrebbe dare un volume finale di 1 L. Add kanamycin solfato ad una concentrazione finale di 50 g/mL e piatti Petri cast con 35 mL di media.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Per illustrare il flusso di lavoro dell'assieme Golden Gate, una cassetta di espressione è stata assemblata nel vettore dell'accettatore di livello 1 (Avanti) (pICH47732) contenente le seguenti parti di livello 0: promotore dell'operone C-phycocyaninPpc560 (pC0.005), la sequenza di codifica per eYFP (pC0.008) e il doppio terminatore TrrnB (pC0.082)12. In seguito alla trasformazione della reazione di assemblaggio, le assemblee riuscite sono state identificate utilizzando lo screening blu-bianco standard delle colonie di E. coli (Figura 3). La cassetta di espressione eYFP nel vettore Level 1 e il vettore End-Link 1 (pICH50872) sono stati poi assemblati in un vettore dell'acceleratore di livello T (pPMQAK1-T) per dare al vettore cpcBA-eYFP (Figura 4A). Il vettore cpcBA-eYFP assemblato è stato verificato mediante digestione delle restrizioni (Figura 4B).

Il successo del trasferimento coniugale di cpcBA-eYFP o del vettore vuoto pPMQAK1-T (cioè un controllo negativo privo della cassetta dell'espressione eYFP) ha portato alla crescita di diverse centinaia di colonie sulla membrana per Synechocystis PCC 6803 e S. elongatus UTEX 2973 rispettivamente dopo 7-14 giorni e 3-7 giorni (Figura 5). Le colonie individuali furono raccolte e striate su piastre fresche di agar BG11-Kan50; Per generare colture asceniche erano necessarie 2-3 ri-strisce.

Come previsto per il forte promotore Pcpc560 51, i valori per la fluorescenza eYFP normalizzata dal lettore di lastre e la fluorescenza eYFP per cella dal citometro di flusso erano elevati rispetto al controllo negativo (Figura 6 e Figura 7). I valori di fluorescenza erano più alti in S. elongatus UTEX 2973 che in Synechocystis PCC 680312.

Figure 1
Figura 1: Panoramica del processo di assemblaggio Golden Gate in CyanoGate. Viene mostrato l'assemblaggio di una cassetta di espressione genica, a partire dall'amplificazione di una sequenza di interesse dal DNA del modello all'assieme in un vettore di livello T (le parti non vengono disegnate in scala). (A) Progettazione di primer in avanti e inverso per l'amplificazione di una parte CDS1 dal DNA del modello (ad esempio, DNA genomico o plasmide). Le posizioni dei siti di restrizione BpiI e delle sporgenzazioni necessarie per l'inserimento nel vettore dell'acceptor (cioè 5 e 3 o più della sequenza del modello) sono evidenziate rispettivamente in rosso e blu. La lettera "n" indica che qualsiasi NT può essere utilizzato in questa posizione. Sono indicate le regioni annealing dei primer con il modello di DNA e le loro temperature di fusione raccomandate (Tm). (B) Assieme di livello 0 del prodotto PCR nel vettore dell'accettatore di livello 0 CDS1 pICH41308. La sequenza che verrà assumata da BpiI e si legherà nel vettore dell'accettabiliore è evidenziata in blu. (C) Assemblaggio di livello 1 di una cassetta per l'espressione genica contenente tre parti di livello 0 (Pro , 5U, CDS1 e 3U ) nella posizione 1 (avanti) del vettore accettatore pICH47732 con BsaI. (D) Assieme di livello T dell'assieme di livello 1 e End-Link 1 (pICH50872, chiamato "Level M End-link 1" in Engler et al.15) in un vettore dell'acceleratore di livello T (ad esempio, pPMQAK1-T) utilizzando BpiI. (E) Il vettore finale di livello T assemblato. Abbreviazioni: AmpR, cassetta di resistenza ampicillin; CarbR, cassetta di resistenza carbenicillin; CDS1, sequenza di codifica nella sintassi di livello 015; EL1, Fine-Link 1 parte; KanR, cassetta di resistenza kanamycin; lac ,la cassetta di espressione z-galactosidase; SpecR, cassetta di resistenza spettronomica. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Una strategia di domesticazione basata su PCR per la rimozione di un sito di restrizione IIS di tipo illegale. (A) Diagramma schematico che mostra due coppie di primer (rispettivamente in verde e arancione) per la modifica di un sito BpiI (GAAGAC) in GAGGAC in una sequenza di DNA di codifica delle proteine destinata all'assemblaggio nel vettore dell'accettatore CDS1 di livello 0 (pICH41308). Si noti che la modifica conserva il codone per l'acido glutammico (Glu) (cioè da GAA a GAG). Anche se il sito BpiI è mostrato in frame con il codone iniziale, questo approccio funzionerà anche se il sito non è in frame (cioè, finché il sito viene interrotto e la sequenza proteica conservata). Le posizioni dei siti di restrizione BpiI e le sporgengie nei primer sono evidenziate rispettivamente in rosso e blu. Il modello di DNA e la sequenza proteica tradotta sono evidenziati in giallo. Sono indicate le regioni annealing dei primer con il modello di DNA e le loro temperature di fusione raccomandate (Tm). La coppia arancione viene utilizzata per amplificare l'estremità 5 della sequenza con sporgenze AATG e TGAA (frammento 1), mentre la coppia verde viene utilizzata per amplificare l'estremità 3 con sporgeri EGAA e GCTT (frammento 2). Prima di ordinare i primer, la fedeltà della sporgenza di fusione TGAA per frammenti 1 e 2 è stata attentamente controllata52. Sbalzi di fusione mal progettati possono portare a guasti di assemblaggio (cioè, nessuna colonia dopo la trasformazione; Figura 5) o falsi positivi (ad esempio, assiemi troncati o errati). Quest'ultimo può essere risolto come screening di un maggior numero di colonie bianche per identificare un costrutto assemblato correttamente. (B) Ampli dei frammenti 1 e 2 dopo la restrizione con BpiI durante l'assemblaggio del Golden Gate. (C) La sequenza addomesticata assemblata nel vettore dell'accettatore CDS1 di livello 0. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: screening della colonia blu-bianco dei trasformatori di E. coli dopo l'assemblaggio del Golden Gate. Le piastre mostrate contengono agar LB (1% [w/v]) integrato con X-Gal, IPTG e antibiotici a concentrazioni appropriate. (A) Nessuna colonia, suggerendo una reazione di montaggio fallita e/o trasformazione di E. coli. (B) Per lo più colonie blu, che indica un assemblaggio di successo, ma che l'efficienza dell'enzima di restrizione utilizzato nella reazione di assemblaggio era bassa. (C) Per lo più colonie bianche, indicative di una tipica reazione di assemblaggio di successo. (D) Nessuna colonia blu, che indica un montaggio molto efficiente. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: Verifica di un vettore di livello T assemblato mediante la digestione delle restrizioni. I vettori sono stati digeriti con HindIII e BamHI. (A) Mappa di sequenza del vettore dell'accettatore pPMQAK1-T vuoto (CT.0) e dell'assieme Level T (cpcBA-eYFP) che mostra i componenti della cassetta dell'espressione eYFP (Pcpc560-eYFP-TrrnB). Sono indicate le posizioni dei siti di restrizione per HindIII e BamHI. Dopo la doppia digestione, le dimensioni previste dei frammenti di DNA sono indicate: (1) 5.847 bp, (2) 2.004 bp, (3) 30 bp, (4) 374 bp, (5) 1.820 bp, (6) 1.289 bp e (7) 156 bp. (B) Un gel agarose (0,8% [w/v]) viene eseguito a 125 V per 60 min caricato con il livello digerito T assembly (cpcBA-eYFP) che mostra le bande 1, 5 e 6, il vettore di accettazione pPMQAK1-T (CT.0) digerito che mostra le bande 1 e 2 e una scala di DNA (Tabella dei materiali). Si noti che le bande 3, 4 e 7 erano troppo piccole per visualizzare sul gel. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: Crescita delle colonie transgeniche Synechocystis PCC 6803 a seguito di coniugazione di successo. Esempi di membrane a seguito di incubazione su piastre di agar BG11-Kan50 sono mostrati. (A) La crescita eccessiva dopo coniugazione molto efficiente- le colonie Synechocystis PCC 6803 si sono sviluppate in un prato senza colonie individuali. (B) Una buona efficienza coniugata che mostra diverse centinaia di colonie individuali dopo 12 giorni. (C) Crescita di un ceppo axenico dopo 14 giorni dopo diversi giri di re-streaking su una piastra di agar fresca BG11-Kan50. L'assenza di contaminazione batterica ha indicato che il transconjugant Synechocystis PCC 6803 era axenico. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 6
Figura 6: Dati di crescita rappresentativi e valori di fluorescenza eYFP normalizzati utilizzando un lettore di lastre. (A) Confronto della crescita dei ceppi che trasportano cpcBA-eYFP o del vettore pPMQAK1-T vuoto (CT.0, controllo negativo) in Synechocystis PCC 6803 e S. elongatus UTEX 2973. I valori sono i mezzi : SE da quattro repliche biologiche. Synechocystis PCC 6803 e S. elongatus UTEX 2973 sono stati coltivati per 72 h a 30 gradi centigradi con luce continua (100 fotoni mol m-2s-1) e 40 gradi centigradi con 300 fotoni m-2s-1, rispettivamente. (B) I valori di fluorescenza eYFP normalizzati per Synechocystis PCC 6803 o S. elongatus UTEX 2973 coniugati con cpcBA-eYFP a 72 h. I valori sono i mezzi : SE da quattro replica biologici. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 7
Figura 7: Valori di fluorescenza eYFP rappresentativi utilizzando un citometro a flusso. (A) Grafico a dispersione in avanti (FSC-H) e laterale (SSC-H) dalla soluzione media "vuota" (BG11 e PBS). (B) Grafico a dispersione per un campione di Synechocystis PCC 6803 (a destra). Il cerchio indica la regione selezionata che gaizza la popolazione di cianobatteri dal resto del segnale del campione. (C) Istogramma della regione recintata per un ceppo che trasporta il vettore vuoto pPMQAK1-T (CT.0, controllo negativo). (D) Istogramma della regione recintata per un ceppo che trasporta cpcBA-eYFP. (E) eYFP fluorescenza per cellula in Synechocystis PCC 6803 e S. elongatus UTEX 2973 a 72 h. È stata sottratta la fluorescenza dal controllo negativo. I valori sono i mezzi : SE da quattro repliche biologiche. Fare clic qui per visualizzare una versione più grande di questa figura.

No. ID vettore nome descrizione Sbalzo da 5' 3' sporgenza
1 PICH41233 pro e i contro Promotore Il Numero di PigMa tatto
2 PICH41295 Pro 5U Promoter e regione non tradotta Il Numero di PigMa AATG
3 pAGM1251 Pro - 5U (f) Promotore e sequenza non tradotta 5 o più per Le fusioni terminali N Il Numero di PigMa CCAT
4 PICH41246 5u Regione non tradotta tatto CCAT
5 pAGM1263 5U (f) 5 sequenza non tradotta per fusioni di terminali N tatto CCAT
6 PICH41246 5U : NT1 Regione non tradotta e regione di codifica terminale N tatto CCAT
7 pAGM1276 NT1 N tag terminale o segnale di localizzazione CCAT AATG
8 PICH41258 Sp Peptide segnale AATG AGGT
9 PICH41258 NT2 N tag terminale o segnale di localizzazione AATG AGGT
10 pAGM1287 CDS1 ns Regione di codifica senza stop codon AATG TTCG
11 PICH41308 Arresto CDS1 Regione di codifica con stop codon AATG Metodo GCTT
12 PAGM1299 CDS2 ns Regione di codifica - senza inizio e arresto codon AGGT TTCG
13 PICH41264 Arresto CDS2 Regione di codifica - senza inizio e con stop codon AGGT Metodo GCTT
14 pAGM1301 Ct Segnale di localizzazione o tag terminale C TTCG Metodo GCTT
15 PICH53388 3u Regione non tradotta Metodo GCTT GGTA
16 PICH53399 Ter Terminator GGTA CGCT
17 PICH41276 3U - Ter Regione e terminatore non tradotti Metodo GCTT CGCT
18 PICH41331 Cgm Accettatore per cassette gene complete Il Numero di PigMa CGCT
19 pCA0.002 (informazioni in due) Pro (copia bassa) Promotore, accettatore di numero di copia basso (pSC101 ori) Il Numero di PigMa tatto
20 pCA0.001 (informazioni in due) Pro TSS Promotore troncato al sito iniziale della trascrizione Il Numero di PigMa TAGC (TAGC)
21 Diretto al livello 1 srRNA Piccolo RNA regolatore (per il silenziamento traslazionale) TAGC (TAGC) GTTT (TT)
22 Diretto al livello 1 sgRNA RNA a guida singola (per CRISPRi) TAGC (TAGC) GTTT (TT)
23 PICH41295 FIANCO IN ALTO Sequenza di fianco a monte del sito di ricombinazione omologa di destinazione Il Numero di PigMa AATG
24 PICH41276 FIONDA Sequenza di fiancheggiamento a valle del sito di ricombinazione omologa di destinazione Metodo GCTT CGCT

Tabella 1: un elenco di vettori e sbalzi di livello 0 disponibili. I vettori 1/18 provengono dal kit Plant MoClo15. I vettori 19-22 provengono dal kit CyanoGate12. Per le parti srRNA e sgRNA, le sequenze sintetizzate o i prodotti PCR vengono assemblati direttamente in vettori di accettabilità di livello 1. I vettori 23-24 provengono dal kit Plant MoClo che sono stati riproposti per la trasformazione mediante il kit CyanoGate.

Componenti dell'assieme BpiI (Livello 0, T) Componenti dell'assieme BsaI (livello 1)
50-100 ng di vettore di accettatore 50-100 ng di vettore di accettatore
Per ogni vettore/parte da inserire, utilizzare un rapporto 2:1 di insert: acceptor vector. Per ogni vettore/parte da inserire, utilizzare un rapporto 2:1 di insert: acceptor vector.
2 ATP da 10 mM (tabella dei materiali) 2 ATP da 10 mM (tabella dei materiali)
2 G buffer L (buffer per BpiI/BsaI) 2 G buffer L (buffer per BpiI/BsaI)
2 BSA (10x) (Tabella dei materiali) 2 BSA (10x) (Tabella dei materiali)
10 unità BpiI (1 - L10 U/L BpiI, Tabella dei materiali) 10 unità BsaI (1 SL 10 U/L BsaI, Tabella dei Materiali)
Portare a 20 l con dH2O. Portare a 20 l con dH2O.
200 unità T4 DNA ligase (1 -L 200 U/L, Tabella dei Materiali) 200 unità T4 DNA ligase (1 -L 200 U/L, Tabella dei Materiali)
Protocollo termociclista (Livello 0, T) Protocollo termociclista (livello 1)
37 gradi centigradi per 10 min ciclo x 5 37 gradi centigradi per 10 min ciclo x 5
16 gradi centigradi per 10 min 16 gradi centigradi per 10 min
37 gradi centigradi per 20 min 37 gradi centigradi per 20 min
65 gradi centigradi per 10 min 65 gradi centigradi per 10 min
16 gradi centigradi (tieni premuto) 16 gradi centigradi (tieni premuto)

Tabella 2: Protocolli per gli assiemi Golden Gate nei livelli 0, 1 e T. Assemblaggio nei vettori di accetto di livello 0 e livello T utilizza l'enzima di restrizione BpiI (a sinistra). Assemblaggio nei vettori accettatori di livello 1 utilizza enzima di restrizione BsaI (a destra). Questo tavolo è stato adattato da Vasudevan et al.12.

Primer No. Sequenza (5'-3') Lunghezza (bp) descrizione
L0T in avanti GTCTCATGAGACGGATACATA
TTTGAATG
28 Per amplificazione dal livello 0 e livello T
L1 inverso GAACCCTGTGGGGGCATGC
ACATAC
26 Per amplificazione dal livello 1
L1 in avanti CTGGTGGBARGGATATTGT
GGTG
24 Per amplificazione dal livello 1
L0T inversa TTGAGTGAGCTGCT 20 Per amplificazione dal livello 0 e livello T

Tabella 3: Elenco dei primer per la convalida PCR o la sequenza dei vettori di livello 0, 1 e T.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'assemblaggio Golden Gate presenta diversi vantaggi rispetto ad altri metodi di assemblaggio vettoriale, in particolare in termini di scalabilità20,21. Tuttavia, la configurazione del sistema Golden Gate in laboratorio richiede tempo per sviluppare una familiarità con le varie parti e le librerie vettoriali dell'accettatore e i processi di assemblaggio complessivi. È spesso necessaria un'attenta pianificazione per assiemi più complessi o quando si esegue un numero elevato di assiemi complessi in parallelo (ad esempio, creando una suite di vettori di livello T contenenti più cassette di espressione genica). Si consiglia di elencare prima tutte le combinazioni di cassette di espressione genica necessarie e quindi di mappare il flusso di lavoro dal livello 0 al livello T in silico. Durante questo processo, gli utenti dovrebbero considerare le parti di livello 1 "Dummy" disponibili nel kit Plant MoClo che consentono l'assemblaggio di vettori di livello 1 non sequenziali in livello T (ad esempio, la posizione 1 1 e i vettori di posizione 3 possono essere assemblati insieme alla parte "Dummy" Livello 1 posizione 2), che può ridurre il numero complessivo di reazioni di assemblaggio e passaggi di clonazione necessari15.

La sintesi del DNA è in genere il metodo più semplice per la costruzione di nuove parti di livello 0. Tuttavia, quando è richiesta la clonazione (ad esempio, da plasmidi o DNA genomico), l'ottimizzazione della progettazione dei primer utilizzati per l'amplificazione è importante per massimizzare l'efficienza del successivo assemblaggio vettoriale di livello 0. I due passaggi più critici nella progettazione di primer sono: 1) verifica ndole sporgenzazioni corrette e nell'orientamento appropriato per i primer in avanti e inverso(Figura 1 e Tabella 1)e 2) assicurando che la lunghezza del primer sequenza che le anneals al modello è sufficientemente lunga (18,30 bp) e che il valore DiM m per questa sequenza (idealmente 58-62 ) è simile per la coppia primer (Figura 1A). Se una sequenza richiede l'addomesticamento, sono disponibili diverse strategie. Per le sequenze brevi (ad esempio, <200 bp), è possibile progettate una coppia di primer lungo avanti e indietro in cui le 3 terminano anneal tra loro (ad esempio, una sovrapposizione di >20 bp) e formare una doppia sequenza bloccata dopo l'amplificazione. Per sequenze più lunghe, è possibile amplificare frammenti separati della sequenza che rimuovono siti di restrizione illegali e quindi assemblati utilizzando un approccio assembly Golden Gate (Figura 2). Se l'efficienza di assemblaggio con i prodotti PCR è scarsa, i singoli frammenti di una sequenza di livello 0 possono essere clonati nel vettore dell'acceleratore universale di livello 1 (pAGM1311), convalidati e quindi assemblati insieme nel vettore dell'acceleratore di livello 015appropriato. Un rapporto di molare vettoriale 2:1 è consigliato per un assemblaggio efficiente Golden Gate. Tuttavia, per gli assiemi di soli 2-3 vettori (ad esempio, due parti di livello 0 e un vettore di accettare di livello 1), la combinazione di 100 ng di ciascuno di essi genera in genere un esito positivo. L'efficienza degli assiemi tende a diminuire con l'aumentare del numero di vettori utilizzati per reazione, con conseguente riduzione del numero totale di colonie bianche in seguito alla trasformazione (Figura 3).

Prima della coniugazione, si consiglia la convalida dei vettori di livello T finalizzati per digest di restrizione e PCR. Il trasferimento del DNA coniugale è una tecnica ben pugnalata per i ceppi cianobatterici, compresi quelli che non sono naturalmente trasformabili41,45. Passi importanti nel protocollo di coniugazione includono: 1) un'attenta manipolazione del ceppo aiutante E. coli dopo la crescita notturna (ad esempio, evitare il vortice)35, 2) fare attenzione a rimuovere completamente le tracce degli antibiotici utilizzati per coltivare l'aiutante e cargo E. coli ceppi, 3) un periodo di incubazione adeguato per la miscela di ceppi di carico e di supporto e cianobatteri (ad esempio, un periodo di incubazione più lungo è stato critico per S. elongatus UTEX 2973), e 4) il periodo di trasferimento iniziale della cellula miscela sulle membrane nelle piastre di agar LB-BG11 privo di antibiotici per 24 h.

Colonie cianobatteriche isolate dovrebbero svilupparsi sulla membrana entro due settimane per Synechocystis PCC 6803 e S. elongatus UTEX 2973, altrimenti è probabile che la coniugazione sia fallita. Si potrebbero quindi testare diverse modifiche al protocollo, tra cui 1) utilizzando una coltura cianobatterica con una densità iniziale più alta (ad esempio, OD750 x 1,5,2); 2) aumentando il periodo di incubazione prima del trasferimento alla membrana; e 3) estendere il periodo di incubazione iniziale sulla membrana da 24 h a 48 h (cioè, per consentire più tempo per l'espressione del gene di resistenza agli antibiotici sul vettore trasferito). Se la coniugazione continua a fallire, metodi alternativi come l'elettroporazione potrebbero essere provati53. La conferma di un ceppo cianobatterico transgenico è importante prima di ulteriori sperimentazioni. Infine, è buona norma confermare le dimensioni del vettore eteologo nel ceppo cianobatterico transgenico. Quest'ultimo richiede l'estrazione del DNA (sezione 5), la trasformazione in E. coli e la selezione (sezione 2.1) e la convalida vettoriale (sezione 2.4).

Il protocollo di caratterizzazione del promotore illustrato utilizza piccoli volumi di coltura (cioè 2 mL) come mezzo per ottenere una metodologia di screening ad alta produttività. Volumi maggiori potrebbero essere utilizzati a seconda dello spazio fotobioreattore disponibile, il che contribuirebbe a mitigare i problemi di evaporazione della coltura. Se è necessario uno screening ad alta produttività con piccoli volumi di coltura, è essenziale avere un'elevata umidità all'interno della camera di crescita per inibire l'evaporazione. L'evaporazione durante un esperimento di crescita può essere dannosa per l'accuratezza e la validità delle misurazioni del campione. Controllare i volumi di coltura durante e dopo l'esperimento per confermare la quantità di evaporazione.

Per le misurazioni del lettore di lastre, è importante misurare le colture a basse densità, idealmente OD750 < 1, per garantire l'acquisizione di dati affidabili e riproducibili sulla crescita e la fluorescenza. Una relazione lineare tra il numero di cella e l'OD750 viene osservata solo all'interno di un intervallo specifico54. Per stabilire questo intervallo, si consiglia di eseguire una diluizione seriale (ad esempio, da OD750 x 0,1,0) utilizzando un trasformazionatore noto in cui la fluorescenza eYFP è stata confermata. Tracciare la fluorescenza assoluta contro la fluorescenza normalizzata (eYFP fluorescenza/OD750) aiuterà a identificare la gamma di lavoro lineare delle densità di coltura. Diversi lettori di placche includono una funzione "guadagno" per modificare la sensibilità del rilevatore di fluorescenza. In questo caso, il valore del guadagno deve essere impostato su un livello appropriato prima di iniziare l'esperimento e non essere modificato tra le diverse esecuzioni sperimentali o i dati non saranno direttamente comparabili.

Anche se il funzionamento di diversi citometri di flusso varierà da un produttore all'altro, è importante prendere una lettura in bianco della soluzione media per facilitare l'identificazione e l'analisi della popolazione cianobatterica bersaglio da qualsiasi segnale di fondo in medio(Figura 7A,B). In seguito, la sottrazione del valore di fluorescenza del campione di controllo negativo (ad esempio, un ceppo di tipo selvaggio) aiuterà a rimuovere l'autofluorescenza nativa (Figura 7C,D). Il parametro di tensione del tubo fotomoltiplicatore (PMT) in un citometro di flusso ha una funzione simile al guadagno in un lettore di lamiere, cioè aumentando o diminuendo la sensibilità del rivelatore all'intensità del segnale di fluorescenza. Come con il lettore di piastre, la tensione PMT deve essere impostata su un livello appropriato prima di iniziare l'esperimento55. Una volta impostato, il valore di tensione PMT deve essere mantenuto tra diverse esecuzioni sperimentali o i dati non saranno direttamente confrontabili.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Gli autori sono grati alla rete PHYCONET PhyCONET Biotechnology and Biological Sciences Research Council (BBSRC) in Industrial Biotechnology and Bioenergy (NIBB) e all'Industrial Biotechnology Innovation Centre (IBioIC) per il sostegno finanziario. GARG, AASO e AP riconoscono il sostegno al finanziamento del programma BBSRC EASTBIO CASE PhD (numero di sovvenzione BB/M010996/1), del programma di dottorato Consejo Nacional de Ciencia y Tecnolog-a (CONACYT) e del programma di dottorato IBioIC-BBSRC Collaborative Training Partnership (CTP), rispettivamente. Ringraziamo Conrad Mullineaux (Queen Mary University of London) e Poul Eric Jensen e Julie Annemarie (Università di Copenaghen) per i contributi e i consigli sui vettori e sui protocolli plasmici.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
Modificazione genetica dei cianobatteri mediante congiugazione utilizzando il toolkit di clonazione modulare CyanoGate
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter