Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Modificación genética de las cianobacterias por conjugación utilizando el kit de herramientas de clonación modular CyanoGate

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Aquí, presentamos un protocolo que describe cómo i) ensamblar un vector autorreplicante usando el kit de herramientas de clonación modular CyanoGate, ii) introducir el vector en un host cianobacteriano por conjugación, y iii) caracterizar las cepas de cianobacterias transgénicas usando un lector de placas o citometría de flujo.

Abstract

Las cianobacterias son un grupo diverso de organismos fotosintéticos procariotas que pueden ser modificados genéticamente para la producción renovable de productos industriales útiles. Los recientes avances en biología sintética han llevado al desarrollo de varios kits de herramientas de clonación como CyanoGate, un sistema de clonación modular estandarizado para la construcción de vectores de plásmidos para su posterior transformación o transferencia conyugal a cianobacterias. Aquí delineamos un método detallado para ensamblar un vector autorreplicante (por ejemplo, llevar un casete de expresión de marcador fluorescente) y la transferencia conyugal del vector en las cepas cianobacterianas Synechocystis sp. PCC 6803 o Synechococcus elongatus UTEX 2973. Además, describimos cómo caracterizar el rendimiento de una pieza genética (por ejemplo, un promotor) utilizando un lector de placas o citometría de flujo.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Las cianobacterias son bacterias autotróficas que se pueden utilizar para la biosíntesis de una amplia variedad de productos metabólicos naturales y heterológicos de alto valor1,2,3,4,5, 6. Todavía es necesario superar varios obstáculos para ampliar su viabilidad comercial, sobre todo, los rendimientos relativamente pobres en comparación con las bioplataformas heterotróficas (por ejemplo, Escherichia coli y levadura)7. La reciente expansión de las herramientas de ingeniería genética disponibles y la asunción del paradigma de la biología sintética en la investigación cianobacteriana está ayudando a superar tales desafíos y a desarrollar más cianobacterias como biofábricas eficientes8, 9,10.

Los principales enfoques para introducir el ADN en las cianobacterias son la transformación, la conjugación y la electroporación. Los vectores transferidos a las cianobacterias por transformación o electroporación son vectores "suicidas" (es decir, vectores integradores que facilitan la recombinación homóloga), mientras que los vectores autorreplicantes pueden transferirse a cianobacterias por transformación, conjugación o electroporación. Para el primero, un protocolo está disponible para las especies de modelos de ingeniería susceptibles a la transformación natural11. Más recientemente, se ha desarrollado un kit de herramientas de clonación modular (MoClo) para cianobacterias llamado CyanoGate que emplea un método de ensamblaje vectorial Golden Gate estandarizado para la ingeniería utilizando la transformación natural, electroporación o conjugación12.

Las técnicas de montaje tipo Golden Gate se han vuelto cada vez más populares en los últimos años, y los estándares de montaje y las bibliotecas de piezas están ahora disponibles para una variedad de organismos13,14,15,16 ,17. Golden Gate utiliza enzimas de restricción IIS de tipo (por ejemplo, BsaI, BpiI, BsmBI, BtgZI y AarI) y un traje de aceptadores y voladizos únicos para facilitar el montaje jerárquico direccional de múltiples secuencias en una reacción de montaje "una olla". Las enzimas de restricción de tipo IIS reconocen una secuencia asimétrica única y cortan una distancia definida de sus sitios de reconocimiento para generar un corte escalonado y "final pegajoso" (normalmente un voladizo de 4 nucleótidos [NT]), que puede ser explotado posteriormente para impulsar el ADN ordenado reacciones de montaje15,18. Esto ha facilitado el desarrollo de grandes bibliotecas de piezas modulares de nivel 0 (por ejemplo, promotores, marcos de lectura abiertos y terminadores) definidas por una sintaxis común, como el estándar PhytoBricks19. Las piezas de nivel 0 se pueden ensamblar fácilmente en casetes de expresión de nivel 1, tras lo cual se pueden construir ensamblajes de orden superior más complejos (por ejemplo, construcciones de expresión multigénea) en un vector aceptador de elección12,15. Una ventaja clave de las técnicas de montaje tipo Golden Gate es su capacidad para la automatización en instalaciones de alto rendimiento, como las fundiciones de ADN20,21, que pueden permitir la prueba de diseños experimentales complejos que fácilmente mediante el trabajo manual.

CyanoGate se basa en el sistema establecido Plant MoClo12,15. Para incorporar una nueva pieza en CyanoGate, la secuencia de la pieza debe ser domesticada primero, es decir, los sitios de reconocimiento "ilegales" para BSaI y BpiI deben ser eliminados. En el caso de una codificación de pieza para un marco de lectura abierto (es decir, una secuencia de codificación, CDS), los sitios de reconocimiento pueden verse interrumpidos mediante la generación de mutaciones sinónimos en la secuencia (es decir, cambiar un codón a una alternativa que codifica para el mismo residuo de aminoácidos). Esto se puede lograr mediante una variedad de enfoques, que van desde la síntesis de ADN hasta estrategias basadas en la amplificación de la reacción en cadena de la polimerasa (PCR) como el ensamblaje de Gibson22. Dependiendo de la expresión que se utilice el host, se debe tener cuidado de evitar la introducción de codones raros que podrían inhibir la eficiencia de la traducción23. La eliminación de sitios de reconocimiento en secuencias de promotor y terminador suele ser un esfuerzo más arriesgado, ya que las modificaciones pueden afectar a la función y la parte podría no funcionar como se esperaba. Por ejemplo, los cambios en los sitios de unión del factor de transcripción putativa o en el sitio de unión ribosoma dentro de un promotor podrían alterar la fuerza y la capacidad de respuesta a la inducción/represión. Del mismo modo, las modificaciones a las características estructurales clave del terminador (por ejemplo, el tallo rico en GC, el bucle y la cola poli-U) pueden cambiar la eficiencia de terminación y afectar la expresión génica24,25. Aunque hay varios recursos en línea disponibles para predecir la actividad de las secuencias de promotor es y terminador, e informar si una mutación propuesta afectará el rendimiento26,27, estas herramientas son a menudo malos predictores de rendimiento en cianobacterias28,29,30.. Como tal, todavía se recomienda la caracterización in vivo de las piezas modificadas para confirmar la actividad. Para ayudar con la clonación de secuencias recalcitrantes, CyanoGate incluye un vector de aceptación de clonación de copia baja basado en el vector bioBrick pSB4K512,16,31. Además, un portal "Diseño y construcción" está disponible a través de la Fundición del Genoma de Edimburgo para ayudar con el diseño de vectores (dab.genomefoundry.org). Por último, y lo más importante, CyanoGate incluye dos diseños vectoriales de aceptación de nivel T (equivalentes a vectores de aceptación de nivel 2)15 para introducir ADN en cianobacterias utilizando vectores suicidas, o vectores de amplio alcance de host capaces de autorreplicación en varias especies cianobacterianas32,33,34.

Aquí nos centraremos en describir un protocolo para generar vectores autorreplicantes de nivel T y la modificación genética de Synechocystis PCC 6803 y Synechococcus elongatus UTEX 2973 (Synechocystis PCC 6803 y S. elongatus UTEX 2973 en adelante) por conjugación (también conocida como apareamiento triparental). La transferencia conyugal del ADN entre células bacterianas es un proceso bien descrito y se ha utilizado previamente para la ingeniería de especies cianobacterianas, en particular aquellas que no son naturalmente competentes, como S. elongatus UTEX 297335, 36,37,38,39,40,41. En resumen, los cultivos cianobacterianos se incuban con una cepa de E. coli que transporta el vector a transferir (el vector "carga") y vectores (ya sea en la misma cepa de E. coli o en cepas adicionales) para permitir la conjugación ("movilizador" y vectores "ayudantes"). Se requieren cuatro condiciones clave para que se produzca la transferencia conyugal: 1) contacto directo entre las células implicadas en la transferencia de ADN, 2) el vector de carga debe ser compatible con el sistema de conjugación (es decir, debe contener un origen adecuado de transferencia (oriT), también conocido como un sitio bom (base de movilidad),), 3) una proteína de negación del ADN (por ejemplo, codificada por el gen de la mafia) que nicks DNA en el oriT para iniciar la transferencia de una sola cadena del ADN en la cianobacterium debe estar presente y expresado de la carga o de los vectores auxiliares, y 4) el ADN transferido no debe destruirse en el ciabacterium receptor (es decir, debe ser resistente a la degradación, por ejemplo, la actividad de endonucleasa de restricción)35,42. Para que el vector de carga persista, el origen de la replicación debe ser compatible con el cianobacterium receptor para permitir la autorreplicación y la proliferación en células hijas después de la división. Para ayudar con las condiciones 3 y 4, varios vectores auxiliares están disponibles a través de Addgene y otras fuentes comerciales que codifican para la mafia, así como varias metilosas para proteger de endonucleasas nativas en el host cianobacterium43. En este protocolo, la conjugación fue facilitada por una cepa MC1061 E. coli que transportaba movilizadores y vectores auxiliares pRK24 (www.addgeneorg/51950) y pRL528 (www.addgene.org/58495), respectivamente. Se debe tener cuidado al elegir los vectores que se utilizarán para la transferencia conyugal. Por ejemplo, en el kit CyanoGate el vector de carga autorreplicante pPMQAK1-T codifica para una proteína Mob12. Sin embargo, pSEVA421-T no44, y como tal, la mafia debe expresarse desde un vector auxiliar adecuado. Los vectores utilizados también deben ser apropiados para el organismo objetivo. Por ejemplo, la transferencia conyugal eficiente en Anabaena sp. PCC 7120 requiere un vector auxiliar que proteja el vector movilizador contra la digestión (por ejemplo, pRL623, que codifica para las tres metiluas AvaiM, Eco47iiM y Ecot22iM)45, 46.

En este protocolo se describe además cómo caracterizar el rendimiento de las piezas (es decir, promotores) con un marcador fluorescente utilizando un lector de placas o un citómetro de flujo. Los citómetros de flujo son capaces de medir la fluorescencia en una sola célula para una población grande. Además, los citometros de flujo permiten a los usuarios "gatear" los datos adquiridos y eliminar el ruido de fondo (por ejemplo, de partículas en el cultivo o la contaminación). Por el contrario, los lectores de placas adquieren una medición de fluorescencia agregada de un volumen determinado de cultivo, normalmente en varios pozos de réplica. Las principales ventajas de los lectores de placas sobre los citometros incluyen el menor costo, mayor disponibilidad y, por lo general, ningún requisito de software especializado para análisis de datos aguas abajo. Los principales inconvenientes de los lectores de placas son la sensibilidad relativamente menor en comparación con los citometros y los posibles problemas con la densidad óptica de los cultivos medidos. Para los análisis comparativos, las muestras del lector de placas deben normalizarse para cada pocal (por ejemplo, para una medición de la densidad de cultivo, que normalmente se toma como absorbancia en la densidad óptica a 750 nm [OD750]), lo que puede dar lugar a imprecisiones para las muestras que son demasiado densa y/o no bien mezclada (por ejemplo, cuando es propensa a la agregación o a la floculación).

Como resumen, aquí demostramos en detalle los principios de generación de piezas de nivel 0, seguidos por el ensamblaje jerárquico utilizando el kit CyanoGate y la clonación en un vector adecuado para la transferencia conyugal. A continuación, demostramos el proceso de transferencia conyugal, la selección de cepas transconjugantes axenicas que expresan un marcador fluorescente y la posterior adquisición de datos de fluorescencia utilizando un citómetro de flujo o un lector de placas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Ensamblaje vectorial utilizando los kits de herramientas Plant MoClo y CyanoGate

NOTA: Antes de proceder con el montaje vectorial, se recomienda encarecidamente que los usuarios se familiaricen con las estructuras de nivel vectorial de los sistemas Plant y CyanoGate MoClo12,15.

  1. Construcción de piezas de nivel 0
    NOTA: Las piezas de nivel 0 se pueden sintetizar como vectores completos o como secuencias lineales para el ensamblaje con aceptadores de nivel 0 (por ejemplo, gBlocks, IDT). Alternativamente, las secuencias se pueden amplificar a partir de una plantilla de origen (por ejemplo, un VECTOR o ADN genómico purificado). Aquí, se describe cómo generar una nueva parte de nivel 0 a partir de un producto amplificado. Se muestra una visión general del proceso de ensamblaje de Golden Gate desde el nivel 0 hasta el nivel TFigura 1.
    1. Diseña las imprimaciones.
      1. Decida qué módulo de Nivel 0 ensamblar e identificar los voladizos apropiados de 5o y 3o(Tabla 1)12,15. Compruebe la secuencia de ADN para clonar para detectar la presencia de sitios de restricción bipI o BsaI.
        NOTA: Una secuencia que contiene uno de estos sitios debe domesticarse modificando uno o más NT en la secuencia del sitio de restricción. En la Figura 2se describe una estrategia para hacer esto mediante el ensamblaje de Golden Gate.
      2. Para amplificar una secuencia de ADN, diseñe un par de imprimación hacia adelante y hacia atrás apropiado. Para la imprimación delantera, seleccione 18 a 30 bp complementario al extremo de 5o de la secuencia de la plantilla de ADN. Para la imprimación inversa, seleccione 18 x 30 bp de conexión inversa complementaria al extremo de 3o de la secuencia de la plantilla de ADN.
        NOTA: Los imprimadores con temperaturas de fusión (Tm) de 58 a 62 oC suelen dar los resultados de amplificación más consistentes(Figura 1A).
      3. Agregue lo siguiente al extremo de 5o de la imprimación delantera: 1) una cadena aleatoria de 4 x 6 NTs en el extremo de 5o del sitio bpiI, 2) el sitio de restricción de BpiI (GAAGAC), 3) dos NTs aleatorios y 4) el voladizo de 5o seleccionado en el paso 1.1.1.1. Agregue lo siguiente al extremo de 5o de la imprimación inversa: 1) una cadena aleatoria de 4 x 6 NTs en el extremo de 5o del sitio bpiI, 2) el sitio de restricción de BpiI (GAAGAC), 3) dos NTs aleatorios y 4) el voladizo de 3o seleccionado en el paso 1.1.1.1. Cuando esté terminado, pida los pares de imprimación.
        NOTA: Consulte la Figura 1A para ver un ejemplo de un par de imprimación hacia delante y hacia atrás.
    2. Amplificar una secuencia de ADN a partir de ADN genómico.
      1. Extraiga el ADN genómico como se describe en la sección 5. Amplificar los productos por PCR utilizando una polimerasa de ADN de alta fidelidad(Tabla de Materiales).
        NOTA: Como ejemplo, configure las reacciones de PCR (20 a 50 l) de acuerdo con las instrucciones del fabricante. Utilice 100 ng de ADN genómico por reacción. Utilizar un programa de ciclo térmico que consista en un paso inicial de desnaturalización de 98oC para 30s, seguido de no más de 25 ciclos de desnaturalización a 98oC durante 10 s, recocido de imprimación a 58oC para 15s y extensión del producto a 72oC para 30 s (modificar este último en función de la tamaño del producto/tipo de ADN polimerasa utilizado), seguido de un paso de extensión final de 72 oC durante 2 min.
      2. Si el producto PCR va a ser purificado en gel, ejecute toda la reacción de PCR en un gel de agarosa como se describe en la sección 6. Cortar la banda de interés del gel de agarosa y purificarlo usando un kit de extracción de gel(Tabla de Materiales).
      3. Alternativa al paso 1.1.2.2, si el producto PCR se va a utilizar sin purificación de gel, verifique el tamaño de la banda ejecutando una alícuota de la muestra de reacción de PCR (-5 l) en un gel de agarosa. Si el gel muestra sólo la banda apropiada y ninguna evidencia de dimers de imprimación, purificar el producto PCR utilizando un kit de purificación de ADN(Tabla de materiales).
      4. Eluir el ADN purificado en un pequeño volumen de agua desionizada (p. ej., 10 l) para obtener una alta concentración de ADN (>20 ng / L es típicamente suficiente).
    3. Ensamble el producto de ADN amplificado (o productos, consulte la Figura 2)en el nivel 0. Prepare una mezcla de reacción de 20 l con BpiI(figura 1B)y configure el programa de ciclor térmico como se describe en la Tabla 2. Proceda a la transformación de E. coli utilizando 5 l de la mezcla de reacción de nivel 0 montada (como se describe en la sección 2).
  2. Construcción de montajes de Nivel 1
    1. Decida qué piezas de nivel 0 ensamblar(Figura 1C y Tabla 1). Elija un vector de aceptación de nivel 1 apropiado15.
      NOTA: En esta etapa es importante saber cuál será el diseño vectorial final en el nivel T, ya que esto afectará a la elección del vector aceptador de nivel 1. El vector de aceptación de nivel 1 (adelante) (pICH47732) se puede utilizar como valor predeterminado si el objetivo es tener un único conjunto de nivel 1 (por ejemplo, un casete de expresión génica) en el nivel T. Sin embargo, si se van a ensamblar dos o más ensamblajes de nivel 1 en el nivel T, se debe tener en cuenta la posición y la dirección de cada ensamblaje de nivel 1. Se pueden ensamblar hasta siete conjuntos de nivel 1 en un vector de aceptación de nivel T utilizando vectores de aceptación de nivel 1 con las posiciones adecuadas12.
    2. Ensamble las piezas de nivel 0 en el nivel 1. Preparar una mezcla de reacción de 20 l con BsaI y configurar el programa de ciclor térmico como se describe en la Tabla 2. Proceda a la transformación de E. coli utilizando 5 l de la mezcla de reacción de nivel 1 montada (como se describe en la sección 2).
  3. Construcción de conjuntos de Nivel T
    1. Decida qué ensamblados de nivel 1 ensamblar(Figura 1D). Elija un vector de aceptación de nivel T adecuado.
      NOTA: pUC19A-T (resistencia a la ampicilina) y pUC19S-T (resistencia a la espectinomicina) son vectores integradores de alto número de copia que no son capaces de replicarse en cianobacterias y se utilizan principalmente para la integración genómica (es decir, knock-in o knock-out de genes) a través de genes) a través de genes) a través de recombinación homóloga12. La entrega de vectores integrativos puede proceder por transformación natural en la especie cianobacteriana amenable11. pPMQAK1-T es un amplio rango de host, vector replicativo que se entrega mediante transferencia conyugal (sección 3).
    2. Elija un enlace final adecuado para ligar el extremo de 3o del ensamblaje final de nivel 1 a la columna vertebral de nivel T15.
      NOTA: El enlace final requerido es el mismo número que la posición de la pieza final. Por ejemplo, un vector de nivel T con una sola posición de nivel 1 (hacia adelante o hacia atrás) parte requerirá End-Link 1 (pICH50872) para la ligadura en la columna vertebral de nivel T.
    3. Montar uno o más conjuntos de nivel 1 en el nivel T. Preparar una mezcla de reacción con BpiI y el vector End-Link requerido y configurar el programa de ciclor térmico como se describe en la Tabla 2. Proceda a la transformación de E. coli utilizando 5 l de la mezcla de reacción de nivel T montada (como se describe en la sección 2).

2. Transformación de E. coli y purificación vectorial

  1. Transformación de E. coli (día 1)
    1. Descongelar una alícuota (25 l) de células de E. coli químicamente competentes(Tabla de materiales)y pipetear suavemente en un tubo de 1,5 ml sobre hielo. Añadir 5 s de la mezcla de montaje (Nivel 0, 1 o T) e incubar el tubo sobre hielo durante otros 30 x 60 min.
    2. Células de choque térmico incubando el tubo en un baño de agua a 42 oC durante 30 s, luego coloque el tubo de nuevo en hielo durante 2 minutos. Añadir caldo súper óptimo a temperatura ambiente (RT) con represión catabolizada (S.O.C.) medio (250 sL) al tubo. Incubar el tubo a 37oC durante 1 h a 225 rpm en una incubadora de agitación.
    3. Placa 40 l del cultivo en una placa de agar LB que contenga la concentración final adecuada de antibióticos (100 g/ml para dihidrocloruro de espectromicina pentahidrato [Nivel 0], 100 g/ml de carbenicilina disódico [Nivel 1], o 50 g/ml de sulfato de kanacina pentacina [ Nivel T]), 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) y 40 g/ml de 5-bromo-4-cloro-3-indolyl--D-galactopyranoside (X-Gal) para cribado azul-blanco. Incubar la placa durante la noche a 37oC.
      NOTA: La cantidad de cultivo chapado puede variar dependiendo de la eficiencia de las células competentes de E. coli y la reacción de ligadura. Placa un volumen mayor si se observan colonias <10 después de la incubación durante la noche.
  2. Selección de colonias blancas y preparación de cultivos líquidos (día 2)
    NOTA: Dependiendo de las eficiencias de la reacción de montaje y posterior transformación, las placas de agar LB pueden no contener colonias, colonias azules o colonias blancas(Figura 3). Las colonias azules son indicativas de vectores acceptores que no han sufrido restricciones (es decir, todavía hay una copia funcional de lacZ). Las colonias blancas indican que el casete de expresión lacZ se ha perdido y reemplazado por una pieza/ensamblaje.
    1. Opcionalmente, valide que las colonias blancas contienen el vector esperado realizando la PCR como se describe en la sección 7.
    2. Escoja colonias blancas únicas (o colonias verificadas por PCR) con una punta de 10 l y transfiera a un tubo centrífugo de 15 ml que contenga un medio de LB (5 ml) y concentraciones de antibióticos adecuadas (paso 2.1.3). Incubar los tubos a 37oC durante la noche a 225 rpm en una incubadora de agitación.
  3. Purificación vectorial plásmido (día 3)
    1. Opcionalmente, prepare un stock de glicerol del cultivo nocturno de E. coli para el crioalmacenamiento a largo plazo de vectores. Añadir 500 ml de cultivo bacteriano a 500 ml de glicerol al 50% (v/v) en un tubo apropiado de 1,5 x 2,0 ml para crioalmacenamiento a -80 oC. Mezcle suavemente invirtiendo 5 x 10x. Muestras de congelación de flash en nitrógeno líquido y almacenar en un congelador de -80 oC.
    2. Espíre cultivos en tubos centrífugos de 15 ml a 3.000 x g durante 5 x 10 minutos. Deseche el sobrenadante sin molestar el pellet celular. Purificar el vector utilizando un kit de purificación de plásmido (Tabla de Materiales). Eluda el vector purificado en 35 ml de agua desionizada.
      NOTA: Utilice volúmenes de elución más bajos para aumentar aún más la concentración vectorial. El mismo eluyente se puede poner a través de una columna de purificación dos veces para aumentar los rendimientos.
    3. Mida la concentración del vector en el eluyán utilizando un espectrofotómetro (Tabla de materiales).
      NOTA: Los vectores de alto número de copia en E. coli, como pUC19, suelen dar rendimientos de 50 a 300 ng/L. Los vectores de número de copia bajo, como pPMQAK1-T, suelen dar rendimientos de 15 a 60 ng/L.
  4. Validación de vectores
    NOTA: Los vectores pueden ser verificados por la digestión de la restricción (paso 2.4.1) y/o la secuenciación (paso 2.4.2).
    1. Restringir 0,5 x 1 g de vector con una enzima(s) de restricción apropiada y verificar los tamaños de banda esperados como se describe en la sección 6 (Figura 4).
      NOTA: Los tamaños de banda incorrectos suelen indicar un ensamblaje erróneo, en cuyo caso se pueden examinar más colonias blancas o repetir el ensamblaje. BsaI y BpiI se pueden utilizar para validar el tamaño correcto de la plaquita para los ensamblajes de nivel 0 y nivel 1, respectivamente. BSaI o BpiI se puede utilizar junto con una enzima de restricción adicional y compatible que corta dentro de la plaquita y/o la columna vertebral vectorial para producir un conjunto distinto de bandas bien separadas después de la digestión.
    2. Secuenciar el vector mediante la secuenciación de Sanger utilizando una imprimación apropiada aguas arriba de la región ensamblada utilizando la instalación de secuenciación comercial (Tabla 3).
      NOTA: Todas las nuevas partes de nivel 0 deben secuenciarse para confirmar la identidad de secuencia esperada. La validación de secuencia de vectores de nivel 1 y T no suele ser necesaria si se ensambla a partir de piezas de nivel 0 secuenciadas anteriormente.

3. Generación de mutantes por conjugación

NOTA: Aquí, se describe un protocolo para la transferencia conyugal de un vector de carga autorreplicante a Synechocystis PCC 6803 o S. elongatus UTEX 297311,47. Este protocolo es aplicable a otras especies modelo (por ejemplo, S. elongatus PCC 7942 y Synechococcus sp. PCC 7002). Todo el trabajo con cianobacterias (y preparaciones tampón asociadas) debe realizarse en condiciones estériles en una campana de flujo laminar.

  1. Crecimiento del cultivo cianobacteriano (día 1)
    1. Prepare el medio BG11 según Lea-Smith et al.11, y las placas de agar con LB-BG11 y BG11+Kan50 (sección 8).
    2. Establecer un nuevo cultivo de Synechocystis PCC 6803 o S. elongatus UTEX 2973 inoculando un matraz cónico de 100 ml de medio BG11 fresco (50 ml) con células procedentes de una placa de agar axenic BG11. Cultivar cultivos de Synechocystis PCC 6803 a 30 oC, 100 m-2s-1 a 100 rpm y crecer S. elongatus UTEX 2973 a 40 oC, 300 oMmol de fotones m-2s-1 a 100 rpm. Cultivar cultivos hasta laD.O. 750 a 0,5 x 1,5 (normalmente de 1 a 2 días).
      NOTA: Los cultivos de S. elongatus UTEX 2973 se pueden cultivar a 40oC en altas intensidades de luz (p. ej., fotones de 2000 mol m-2s-1)48.
  2. Crecimiento de cepas de ayuda y carga E. coli (día 2)
    1. Inocular el medio LB que contiene ampicilina (concentración final 100 g/ml) y cloranfenicol (concentración final 25 g/ml) con una cepa MC1061 E. coli que contiene vectores pRK24 y pRL528 (es decir, la cepa auxiliar) y crecen a 37 oC durante la noche a 225 rpm en una incubadora temblorosa. Crecer un volumen suficiente de cultivo de cepa auxiliar, suponiendo que se requiere 1 ml de cultivo por conjugación.
    2. Inocular el medio LB (5 ml) que contiene antibióticos apropiados con el cultivo de E. coli que transporta el vector de carga (es decir, un vector de nivel T). Cultivar el cultivo a 37 oC durante la noche a 225 rpm en una incubadora de agitación.
  3. Transferencia conyugal (apareamiento triparental) (día 3)
    1. Preparar el ayudante de E. coli y las cepas de carga. Centrifugar el ayudante y la carga E. coli cultivos nocturnos a 3.000 x g durante 10 min a temperatura ambiente. Deseche el sobrenadante sin molestar el pellet celular.
    2. Lave el pellet añadiendo un medio fresco de LB sin antibióticos. Utilice el mismo volumen que la referencia cultural inicial. Resuspende el pellet pipeteando suavemente hacia arriba y hacia abajo. No vórtice la cultura. Repita este paso 3x para eliminar los antibióticos residuales del cultivo nocturno.
    3. Centrifugar el cultivo resuspendido (como en el paso 3.3.1), desechar el sobrenadante y resuspender a la mitad el volumen del medio LB del volumen de cultivo inicial (por ejemplo, 2,5 ml si el cultivo nocturno era de 5 ml). Combinar 450 l de la cepa auxiliar con 450 l de la tensión de carga en un tubo de 2 ml y reservar (dejar en RT) hasta el paso 3.3.6.
    4. Preparar el cultivo cianobacteriano. Para cada reacción de conjugación, utilice 1 ml de cultivo cianobacteriano (OD750 x 0,5 x 1,5).
    5. Centrifugar el volumen total requerido de cultivo cianobacteriano a 1.500 x g durante 10 minutos en RT, luego deseche el sobrenadante cuidadosamente sin perturbar el pellet celular. Lave el pellet añadiendo un medio BG11 fresco del mismo volumen inicial. Resuspender el pellet pipeteando suavemente hacia arriba y hacia abajo, no vórtice la cultura. Repita este paso 3x y deje a un lado el cultivo lavado.
    6. Añadir una alícuota de cultivo cianobacteria lavado (900 l) a las cepas combinadas de E. coli (ayudante y carga) (900 l) en un tubo de 2 ml. Mezcle los cultivos pipeteando suavemente hacia arriba y hacia abajo. No vórtice. Incubar la mezcla a RT durante 30 min para Synechocystis PCC 6803 o 2 h para S. elongatus UTEX 2973.
    7. Centrifugar la mezcla a 1.500 x g durante 10 min a RT. Retire 1,6 ml del sobrenadante. Resuspenda el gránulo en el resto de 200 s de sobrenadante. Coloque un filtro de membrana de 0,45 m en una placa de agar LB-BG11 que carezca de antibióticos (sección 8). Esparza cuidadosamente 200 l de la mezcla de cultivo de E. coli/cianobacterial en la membrana con un esparcidor estéril o una punta estéril doblada y sella la placa con película de parafina.
    8. Incubar la placa LB-BG11 con la membrana durante 24 h. Mantener las membranas con cultivos Synechocystis PCC 6803 a 30 oC, 100 fotons de mol m-2s-1. Mantener las membranas con cultivos S. elongatus UTEX 2973 a 40oC en fotones de 150 omol m-2s-1.
  4. Transferencia de membrana
    1. Después de 24 h, transfiera cuidadosamente la membrana utilizando fórceps esterilizados por llama a una nueva placa de agar BG11 que contenga antibióticos apropiados (sección 8) para seleccionar el vector de carga. Selle el plato con película de parafina.
    2. Incubar la placa de agar BG11 en condiciones de crecimiento adecuadas, como se describió anteriormente para Synechocystis PCC 6803 o S. elongatus UTEX 2973, hasta que aparezcan las colonias.
      NOTA: Las colonias suelen aparecer después de 7 a 14 días para Synechocystis PCC 6803 y 3 a 7 días para S. elongatus UTEX 2973.
  5. Selección de conjugantes
    NOTA: Sólo las colonias cianobacterianas que transporten el vector de carga podrán crecer en la membrana(Figura 5).
    1. Usando un lazo estéril térmico, seleccione al menos dos colonias individuales de la membrana y la raya en una nueva placa de agar BG11 que contenga antibióticos apropiados(Figura 5C).
      NOTA: Las colonias recién rayadas todavía pueden estar contaminadas con E. coli transportada por conjugación (es decir, si las pequeñas colonias blancas son evidentes en el plato), por lo que dos o tres rondas adicionales de re-streaking en placas de agar BG11 frescas son típicamente para obtener un cultivo cianobacteriaico axenés.
    2. Confirmar la ausencia de contaminación por E. coli inoculando una raya de cultivo cianobacteriano en un tubo centrífugo de 15 ml que contiene 5 ml de medio de LB e incubando a 37 oC durante la noche a 225 rpm en una incubadora de temblores. Después de un período de crecimiento suficiente (7 días), elija colonias axenicas individuales para establecer cultivos líquidos para crioalmacenamiento a largo plazo o experimentación posterior.
  6. Crioalmacenamiento de cepas cianobacterianas
    1. Cultivar un cultivo líquido cianobacteriano en BG11 (como se describe en la sección 3.1) hasta laD.O. 750 a 1,5 x 3,0. Centrífuga 10 ml de cultivo durante 10 min a 1.500 x g,retire el sobrenadante y vuelva a suspender las células en 5 ml de medio BG11 fresco.
    2. Añadir 3,5 ml de autoclave esterilizado 50% (v/v) glicerol para una concentración final de glicerol de 20% (v/v)49. Este enfoque funciona bien para Synechocystis PCC 6803. Alternativamente, añada 5 ml de filtro esterilizado BG11 que contenga 16% (v/v) dimetilsulfóxido (DMSO) para una concentración final de DMSO de 8% (v/v)50. Este enfoque se recomienda para la mayoría de las cepas, incluyendo S. elongatus UTEX 2973.
      ADVERTENCIA: DMSO es tóxico y debe manipularse con la protección adecuada.
    3. Mezcle suavemente invirtiendo 5 x 10x. Subaliquot 1 ml de cultivo en tubos de tapa de tornillo de 1,5 ml compatibles con crioalmacenamiento separados (Tabla de materiales). Coloque los tubos en un congelador de -80 oC para crioalmacenamiento. No congele con flash en nitrógeno líquido.
      NOTA: Se recomiendan al menos tres existencias por deformación unitaria.
    4. Para la recuperación, retire un tubo del congelador de -80 oC y descongele el cultivo en un baño de agua de 35 oC mientras se mezcla suavemente. Añadir el cultivo deswed a 50 mL de medio BG11 fresco y crecer como un cultivo líquido (como se describe en la sección 3.1).
      NOTA: Alternativamente, la cultura se puede rayar y cultivar en una placa de agar BG11 fresca. Los cultivos transgénicos que llevan marcadores de selección deben revivirse inicialmente en placas de agar BG11 sin antibióticos y luego volver a esgrafiar las placas de agar BG11 con antibióticos apropiados.

4. Caracterización del promotor

NOTA: Aquí se describe un enfoque estándar para analizar la fuerza de una parte promotora midiendo los niveles de expresión de un marcador fluorescente (eYFP) después de un período de crecimiento de 72 h utilizando un lector de placas o un citómetro de flujo12.

  1. Crecimiento de la cultura
    1. Establecer cultivos de semillas inoculando 10 ml de medio BG11 que contiene antibióticos apropiados con una sola colonia de la cepa cianobacteriana transgénica que lleva el casete de expresión del marcador fluorescente. También preparar cultivos de semillas para cepas de control negativas apropiadas (por ejemplo, una cepa de tipo salvaje y/o una cepa transgénica que lleve la misma columna vertebral vectorial pero que carezca del casete de expresión del marcador fluorescente).
      NOTA: Se recomiendan al menos cuatro réplicas biológicas.
    2. Cultivar los cultivos de semillas durante 48 h o hasta laD.O. 750 a 1,5 en condiciones de crecimiento adecuadas para la cepa de la especie.
    3. Para realizar un seguimiento de la expresión del promotor a lo largo del tiempo, mida primero el OD750 de cada cultivo de semillas. Calcule los requisitos de dilución para llevar cada cultivo a un OD a partir de750 o 0,2 a partir de la salida de aire a partir de la fecha. Configurar muestras de cultivo experimental diluidas (2 ml de volumen total) en una placa de fondo plano de 24 pocillos(Tabla de materiales).
    4. Incubar la placa en una incubadora de agitación con luces LED blancas(Tabla de Materiales)en condiciones de crecimiento adecuadas. Mida la densidad de crecimiento del cultivo (OD750)y la fluorescencia mejorada de la proteína fluorescente amarilla (eYFP) utilizando un lector de placas (sección 4.2) o un citómetro de flujo (sección 4.3).
      NOTA: Las culturas Synechocystis PCC 6803 y S. elongatus UTEX 2973 se pueden cultivar como en el paso 3.1.2. Se recomienda encarecidamente que la placa se mantenga bajo una alta humedad (95%) para evitar la evaporación de las muestras de cultivo.
  2. Lector de placas
    1. Mezclar brevemente los cultivos en la placa de 24 pocillos (paso 4.1.4) con pipeteo suave. Transfiera una submuestra de cada cultivo a una placa negra de fondo plano de 96pocillos (Tabla de materiales). Diluir si es necesario (volumen final de 100 l). Evite la formación de burbujas, ya que esto puede interferir con la precisión de la medición.
      NOTA: Se recomienda que todas las mediciones se realicen en muestras en un rango de750 OD de 0,2 a 1,0. Como la densidad de los cultivos en el pozo 24 aumentará con el tiempo, se recomiendan las siguientes diluciones sobre la base de los aumentos esperados en las condiciones de crecimiento estándar: sin dilución a 0 h, 1:4 a 24 h, 1:10 a 48 h y 1:10 a 72 h. Así, por ejemplo, a 24 h cosecha 25 éL de cultivo y mezclar con 75 éL de medio BG11.
    2. Incluya dos pozos en blanco en la placa de 96 pocillos (es decir, 100 ml de medio BG11). Coloque la placa de 96 pocillos en un lector de placas(Tabla de materiales). Agitar la placa durante 60 s a 500 rpm utilizando el agitador orbital en el lector de placas para mezclar los pozos.
      NOTA: Los cultivos cianobacterianos pueden agregar y/o flocular, por lo que una buena mezcla es fundamental antes de leer para mediciones precisas.
    3. Mida la fluorescencia OD750 y eYFP con longitudes de onda de excitación/emisión a 485 nm/520 nm.
    4. Restar el promedio de las mediciones OD750 de los dos pozos en blanco de la medición OD750 de cada pozo de muestra que contiene el cultivo de cianobacterias.
    5. Normalice los valores de fluorescencia de cada muestra de cultivo dividiendo la medición de fluorescencia eYFP (paso 4.2.3) por la DoS750 ajustada del cultivo (paso 4.2.4). A continuación, reste el valor medio normalizado de fluorescencia eYFP (fluorescencia eYFP/OD750) de las réplicas biológicas de una cepa de control negativa adecuada de las cepas transgénicas que llevan el casete de expresión eYFP.
      NOTA: Las cianobacterias son naturalmente fluoradas debido a la presencia de pigmentos, como clorofila y ficobiliproteínas.
    6. Crecimiento del cultivo de la parcela a lo largo del tiempo(Figura 6A)y los valores medios normalizados de fluorescencia eYFP de cada cultivo experimental en los momentos deseados (por ejemplo, 72 h; Figura 6B).
  3. Caquímetro de flujo
    1. Elija una placa compatible para el sistema de manipulación de líquidos del catómetro de flujo. Por ejemplo, utilice una placa de 96 pocillos de fondo redondo(Tabla de materiales)con el catómetro de flujo(Tabla de materiales)utilizado en este protocolo.
    2. Mezclar brevemente los cultivos en la placa de 24 pocillos (paso 4.1.4) con pipeteo suave. Diluir los cultivos aOD 750 a 0,1 x 0,2 para evitar bloqueos de boquillas en el sistema de manipulación de líquidos. Agregue un volumen adecuado de la muestra de cultivo a la placa de 96 pocillos y lleve a un volumen final de 250 l con solución salina con búfer de fosfato (PBS) esterilizada por filtro 1x con fosfato. Incluya un pozo en blanco para la solución media en la placa que contenga 60 ml de BG11 y 190 l de 1x PBS.
      NOTA: Este volumen se recomienda en caso de que sea necesario volver a ejecutar muestras. No se recomiendan volúmenes superiores a 250 l, ya que el volumen máximo de cada pozo es de 300 ml.
    3. Una vez que el catómetro de flujo esté listo para su uso, coloque la placa de 96 pocillos con muestras de cultivo en la estación de manipulación de líquidos. Configure el protocolo de software para que el catómetro de flujo recopile las mediciones de 10.000 eventos individuales (por ejemplo, celdas). Mida la fluorescencia eYFP con longitudes de onda de excitación/emisión de 488 nm/515-545 nm. Primero mida y compruebe la lectura del pozo en blanco(Figura 7A) y, a continuación, ejecute las muestras.
    4. Atraviesa la población de células de cianobacterias dentro de los conjuntos de datos de dispersión hacia adelante y lateral, excluyendo las regiones comunes con la lectura en blanco(Figura 7B). Restar los valores medios de fluorescencia eYFP de las réplicas biológicas de una cepa de control negativa adecuada de las cepas transgénicas que llevan el casete de expresión eYFP(Figura 7C,D). Trazar el promedio de los valores medios de fluorescencia por célula para cada cultivo experimental en los puntos de tiempo deseados (por ejemplo, 72 h; Figura 7E).

5. Extracción de ADN genómico de cianobacterias

NOTA: El siguiente protocolo utiliza un kit de extracción de ADN comercial(Tabla de materiales).

  1. Cultivar un cultivo líquido cianobacteriano en BG11 (como se describe en la sección 3.1) hasta laD.O. 750 a 1,5 x 3,0. Gire hacia abajo 10 mL de cultivo a 3.000 x g durante 10 min y deseche el sobrenadante. Congele el pellet incubando los tubos a -20 oC durante 30 min.
  2. Añadir 400 l de tampón de lisis (buffer AP1) y 400 l de solución ribonucleasa (RNase A), y 50% (p/v) de perlas de vidrio (0,5 mm de diámetro). Interrumpa las muestras utilizando un molino de perlas(Tabla de materiales)a 30 Hz (es decir, equivalente a 1.800 oscilaciones/min) durante 6 min.
  3. Gire la muestra a 17.000 x g durante 5 min y transfiera cuidadosamente el sobrenadante a un tubo nuevo y deseche el pellet. Proceda de acuerdo con las instrucciones del fabricante(Tabla de materiales).

6. Electroforesis de gel de agarosa

  1. Lanzar un gel de agarosa del 1% (p/v) que contenga un bromuro de etidio al 0,02% (v/v). Cargue muestras y una referencia de escalera de ADN apropiada.
  2. Ejecute las muestras durante 50 minutos a 125 V. Compruebe la separación de la banda en un transiluminador ultravioleta (UV).
    NOTA: El tiempo de funcionamiento y el porcentaje de gel de agarosa se pueden modificar para adaptarse al tamaño de banda esperado. Por ejemplo, un mayor porcentaje de gel de agarosa y un tiempo de funcionamiento más largo pueden mejorar la resolución de la banda y la separación de los productos de ADN <500 bp.

7. PCR de colonia

  1. Configure una mezcla de reacción PCR utilizando un kit estándar(Tabla de materiales) y una combinación adecuada de imprimaciones (por ejemplo, imprimaciones que flanqueen la región de ensamblaje o sean específicas de secuencias dentro de la región de ensamblaje (Tabla 3). Pipetear 10 l en un tubo PCR.
  2. Toque suavemente la parte superior de una colonia blanca con un palillo estéril o una punta de pipeta de 10 ml e inocular un tubo PCR que contenga una mezcla de reacción de PCR. Tenga cuidado de marcar la colonia y coincidir con el tubo PCR específico. Revuelva suavemente la mezcla de reacción para asegurarse de que las células de E. coli se arrojen en la solución.
  3. Amplificar los productos por PCR. Utilice un programa que consista en un paso inicial de desnaturalización de 95 oC para 60 s, 30 rondas de 95 oC para 15 s, 58 oC para 15 s (pocos grados por debajo de los valoresT m de las imprimaciones), 72 oC para 30 s (30 s/kb de inserción) , seguido de un paso de extensión final de 72 oC durante 5 min.

8. Preparación de medios BG11 y placas

  1. Preparar soluciones de stock de 100x BG11 medio, hierro (citrato férrico de amonio), oligoelementos, fosfato (K2HPO4), Na2CO3 y tampón TES según Lea-Smith et al.11. Autoclave fosfato y Na2CO3 stocks. Utilice filtros de 0,2 m para filtrar la esterilización del búfer TES (pH 8.2) y las soluciones de stock de NaHCO3.
  2. Preparar 1 L de medio BG11. Mezclar 10 ml de 100x BG11, 1 mL de oligoelementos y 1 ml de stock de hierro y autoclave la solución con 976 ml de agua. Una vez que la solución se haya enfriado a RT, añadir 1 ml de stock de fosfato, 1 ml de stock de Na2CO3 y 10 ml de NaHCO3,y ajustar a pH 7,6 x 7,8 con 1 M HCl.
  3. Placas de agar LB-BG11 (1,5% [p/v])
    1. Combinar 700 ml de agua desionizada y 15 g de agar en un matraz de vidrio. En un segundo matraz, añadir 186 ml de agua, 10 ml de 100x BG11, 1 ml de oligoelementos y 1 ml de material de hierro. Autoclave ambas soluciones.
    2. Una vez que las soluciones se hayan enfriado a alrededor de 60 oC, combínalas y añade 1 ml de stock de fosfato, 1 ml de stock de Na2CO3, 10 ml de stock naHCO 3 y 50 ml de medio estéril LB, que debe dar un volumen final de 1 L. Debutar platos Petri con 25 55 mL de stock NaHCO3 y 50 ml de medio estéril LB, que debe dar un volumen final de 1 L. Cast Petri platos con 25 55 mL de medio de agar LB-BG11.
  4. Placas de agar BG11+Kan50 (1,5% [w/v])
    1. Combinar 700 ml de agua desionizada y 15 g de agar en un matraz de vidrio. En un segundo matraz, añadir 3 g de tiosulfato sódico (Na2S2O3), 226 ml de agua, 10 ml de 100x BG11, 1 ml de oligoelementos y 1 ml de material de hierro. Autoclave ambas soluciones.
    2. Una vez que las soluciones se hayan enfriado a alrededor de 60 oC, combínelas y añada 1 ml de stock de fosfato, 1 ml de stock de Na2CO3, 10 ml de stock tampón TES y 10 ml de stock de NaHCO3, que debe dar un volumen final de 1 L. Añadir sulfato de kanamicina a una concentración final de 50 g/ml y moldear platos de Petri con 35 ml de medio.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Para demostrar el flujo de trabajo del ensamblaje de Golden Gate, se ensambló un casete de expresión en el vector de aceptación de nivel 1 posición 1 (adelante) (pICH47732) que contiene las siguientes partes de nivel 0: el promotor de la operon C-ficasetina Pcpc560 (pC0.005), la secuencia de codificación para eYFP (pC0.008) y el doble terminador TrrnB (pC0.082)12. Tras la transformación de la reacción de montaje, se identificaron conjuntos exitosos mediante el cribado estándar de blanco azul de las colonias de E. coli (Figura 3). El casete de expresión eYFP en el vector de nivel 1 y el vector End-Link 1 (pICH50872) se ensamblaron en un vector de aceptación de nivel T (pPMQAK1-T) para dar al vector cpcBA-eYFP(Figura 4A). El vector cpcBA-eYFP ensamblado fue verificado por la digestión de la restricción(Figura 4B).

La transferencia conyugal exitosa de cpcBA-eYFP o el vector pPMQAK1-T vacío (es decir, un control negativo que carecía del casete de expresión eYFP) dio lugar al crecimiento de hasta varios cientos de colonias en la membrana para Synechocystis PCC 6803 y S. elongatus UTEX 2973 después de 7-14 días y 3-7 días, respectivamente(Figura 5). Las colonias individuales fueron recogidas y rayadas en placas frescas de agar BG11+Kan50; Se requerían 2 o 3 re-streaks para generar cultivos axenéticos.

Como se esperaba para el fuerte promotor Pcpc560 51, los valores de fluorescencia eYFP normalizada del lector de placas y fluorescencia eYFP por célula del citómetro de flujo fueron altos en comparación con el control negativo(Figura 6 y Figura 7). Los valores de fluorescencia fueron más altos en S. elongatus UTEX 2973 que en Synechocystis PCC 680312.

Figure 1
Figura 1: Descripción general del proceso de ensamblaje de Golden Gate en CyanoGate. Se muestra el montaje de un casete de expresión génica, a partir de la amplificación de una secuencia de interés desde el ADN de la plantilla hasta el ensamblaje en un vector de nivel T (las partes no se dibujan a escala). (A) Diseño de imprimaciones delanteras y inversas para amplificación de una pieza CDS1 a partir de ADN de plantilla (por ejemplo, ADN genómico o plásmido). Las ubicaciones de los sitios de restricción de BpiI y los voladizos necesarios para la inserción en el vector de aceptación (es decir, 5o y 3o de la secuencia de plantilla) se resaltan en rojo y azul, respectivamente. La letra "n" indica que cualquier NT se puede utilizar en esta posición. Se indican las regiones de recocido de las imprimaciones con la plantilla de ADN y sus temperaturas de fusión recomendadas (Tm). (B) Montaje de nivel 0 del producto PCR en el vector de aceptación de nivel 0 CDS1 pICH41308. La secuencia que será extirpada por BpiI y ligada en el vector del aceptador se resalta en azul. (C) Montaje de nivel 1 de un casete de expresión génica que contiene tres partes de nivel 0 (Pro + 5U, CDS1 y 3U + Ter) en el vector de aceptación de nivel 1 (adelante) pICH47732 utilizando BsaI. (D) Montaje de nivel T del conjunto de nivel 1 y End-Link 1 (pICH50872, llamado "Level M End-link 1" en Engler et al.15) en un vector de aceptación de nivel T (por ejemplo, pPMQAK1-T) utilizando BpiI. (E) El vector de nivel T ensamblado final. Abreviaturas: AmpR, casete de resistencia a la ampicilina; CarbR, casete de resistencia a la carenicilina; CDS1, secuencia de codificación en la sintaxis de nivel 015; EL1, End-Link 1 parte; KanR, casete de resistencia a la kanamicina; casete de expresión de lacZ, -galactosidasa; Específica, casete de resistencia a la espectromicina. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Una estrategia de domesticación basada en PCR para la eliminación de un sitio de restricción iIS de tipo ilegal. (A) Diagrama esquemático que muestra dos pares de imprimación (en verde y naranja, respectivamente) para modificar un sitio BpiI (GAAGAC) a GAGGAC en una secuencia de ADN de codificación de proteínas destinada al ensamblaje en el vector de aceptación CDS1 Nivel 0 (pICH41308). Tenga en cuenta que la modificación conserva el codón para el ácido glutámico (Glu) (es decir, GAA a GAG). Aunque el sitio BpiI se muestra en marco con el codón de inicio, este enfoque funcionará incluso si el sitio no está en el marco (es decir, siempre y cuando el sitio se interrumpa y la secuencia de proteínas se conserve). Las ubicaciones de los sitios de restricción de BpiI y voladizos en las imprimaciones se resaltan en rojo y azul, respectivamente. La plantilla de ADN y la secuencia de proteínas traducida se resaltan en amarillo. Se indican las regiones de recocido de las imprimaciones con la plantilla de ADN y sus temperaturas de fusión recomendadas (Tm). El par naranja se utiliza para amplificar el extremo de 5o de la secuencia con voladizos AATG y TGAA (fragmento 1), mientras que el par verde se utiliza para amplificar el extremo de 3o con voladizos TGAA y GCTT (fragmento 2). Antes de pedir las imprimaciones, la fidelidad del voladizo de fusión TGAA para el fragmento 1 y 2 se comprobó cuidadosamente52. Los voladizos de fusión mal diseñados pueden provocar un fallo en el montaje (es decir, que no haya colonias después de la transformación; Figura 5) o falsos positivos (por ejemplo, ensamblados truncados o erróneos). Esto último se puede resolver para ser la detección de un mayor número de colonias blancas para identificar una construcción correctamente ensamblada. (B) Amplificar los fragmentos 1 y 2 después de la restricción con BpiI durante el ensamblaje de Golden Gate. (C) La secuencia domesticada ensamblada en el vector de aceptación CDS1 de nivel 0. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Examen de colonias azul-blancas de transformadores de E. coli después del ensamblaje de Golden Gate. Las placas mostradas contienen agar LB (1% [p/v]) complementado con X-Gal, IPTG y antibióticos a concentraciones adecuadas. (A) No hay colonias, lo que sugiere una reacción de montaje fallida y/o una transformación de E. coli. (B) Principalmente colonias azules, lo que indica un montaje exitoso, pero que la eficiencia de la enzima de restricción utilizada en la reacción de montaje fue baja. (C) Principalmente colonias blancas, indicativas de una reacción de montaje típica y exitosa. (D) No hay colonias azules, lo que indica un montaje muy eficiente. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: Verificación de un vector de nivel T ensamblado mediante la digestión de restricciones. Los vectores fueron digeridos con HindIII y BamHI. (A) Mapa de secuencia del vector de aceptación pPMQAK1-T vacío (CT.0) y ensamblaje de nivel T (cpcBA-eYFP) que muestra los componentes del casete de expresión eYFP (Pcpc560-eYFP-TrrnB ). Se indican las posiciones de los sitios de restricción para HindIII y BamHI. Después de la doble digestión, se indican los tamaños pronosticados de los fragmentos de ADN: (1) 5.847 bp, (2) 2.004 bp, (3) 30 bp, (4) 374 bp, (5) 1.820 bp, (6) 1.289 bp y (7) 156 bp. (B) Un gel de agarosa (0,8% [p/v]) funciona a 125 V durante 60 minutos cargados con el nivel digerido Conjunto T (cpcBA-eYFP) que muestra las bandas 1, 5 y 6, el vector de aceptación pPMQAK1-T vacío digerido (CT.0) que muestra las bandas 1 y 2 y una escalera de ADN(Tabla de materiales). Tenga en cuenta que las bandas 3, 4 y 7 eran demasiado pequeñas para visualizar en el gel. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Crecimiento de colonias transgénicas de Synechocystis PCC 6803 después de una conjugación exitosa. Se muestran ejemplos de membranas después de la incubación en placas de agar BG11+Kan50. (A) Crecimiento excesivo después de una conjugación muy eficiente- las colonias Synechocystis PCC 6803 se han convertido en un césped sin colonias individuales. (B) Una buena eficiencia de conjugación que muestra varios cientos de colonias individuales después de 12 días. (C) Crecimiento de una cepa axenica después de 14 días después de varias rondas de re-streaking en una placa de agar BG11+Kan50 fresco. La ausencia de contaminación bacteriana indicaba que el transconjugante Synechocystis PCC 6803 era axenico. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6: Datos de crecimiento representativos y valores normalizados de fluorescencia eYFP utilizando un lector de placas. (A) Comparación de crecimiento de cepas que transportan cpcBA-eYFP o el vector pPMQAK1-T vacío (CT.0, control negativo) en Synechocystis PCC 6803 y S. elongatus UTEX 2973. Los valores son los medios de se de cuatro réplicas biológicas. Synechocystis PCC 6803 y S. elongatus UTEX 2973 fueron cultivados durante 72 h a 30oC con luz continua (100m-2s-1) y 40oC con fotones de 300 omol m-2s-1, respectivamente. (B) Valores normalizados de fluorescencia eYFP para Synechocystis PCC 6803 o S. elongatus UTEX 2973 conjugados con cpcBA-eYFP a 72 h. Los valores son los medios de se de cuatro réplicas biológicas. Haga clic aquí para ver una versión más grande de esta figura.

Figure 7
Figura 7: Valores representativos de fluorescencia eYFP utilizando un catómetro de flujo. (A) Gráfico de dispersión hacia delante (FSC-H) y lateral (SSC-H) de la solución media "en blanco" (BG11 y PBS). (B) Gráfico de dispersión para una muestra de Synechocystis PCC 6803 (derecha). El círculo indica la región seleccionada que gaquea la población de cianobacterias del resto de la señal de muestra. (C) Histograma de la región cerrada para una cepa que lleva el vector pPMQAK1-T vacío (CT.0, control negativo). (D) Histograma de la región cerrada para una cepa que transporta cpcBA-eYFP. (E) valores de fluorescencia eYFP por célula en Synechocystis PCC 6803 y S. elongatus UTEX 2973 a 72 h. Se ha restado la fluorescencia del control negativo. Los valores son los medios de se de cuatro réplicas biológicas. Haga clic aquí para ver una versión más grande de esta figura.

No. ID vectorial Nombre Descripción 5' voladizo 3' voladizo
1 pICH41233 Pro Promotor GGAG Tacto
2 pICH41295 Pro + 5U Promotor y región no traducida de 5o GGAG AATG
3 pAGM1251 Pro + 5U (f) Promotor y secuencia no traducida de 5o para fusiones de terminales N GGAG CCAT
4 pICH41246 5u Región no traducida de 5o Tacto CCAT
5 pAGM1263 5U (f) Secuencia no traducida de 5o para fusiones de terminales N Tacto CCAT
6 pICH41246 5U + NT1 Región no traducida de 5o y región de codificación de terminales N Tacto CCAT
7 pAGM1276 NT1 N etiqueta terminal o señal de localización CCAT AATG
8 pICH41258 Sp Péptido de señal AATG AGGT
9 pICH41258 NT2 N etiqueta terminal o señal de localización AATG AGGT
10 pAGM1287 CDS1 ns Región de codificación sin codón de parada AATG TTCG
11 pICH41308 Parada de CDS1 Región de codificación con codón de parada AATG GCTT
12 pAGM1299 CDS2 ns Región de codificación - sin iniciar y detener el codón AGGT TTCG
13 pICH41264 Parada de CDS2 Región de codificación - sin inicio y con stop codon AGGT GCTT
14 pAGM1301 Ct Etiqueta de terminal C o señal de localización TTCG GCTT
15 pICH53388 3U Región no traducida de 3o GCTT GGTA
16 pICH53399 Ter Terminator GGTA CGCT
17 pICH41276 3U + Ter Región y terminador sin traducir 3o GCTT CGCT
18 pICH41331 Cgm Aceptador para casetes genéticos completos GGAG CGCT
19 pCA0.002 Pro (copia baja) Promotor, aceptador de número de copia baja (pSC101 ori) GGAG Tacto
20 pCA0.001 Pro TSS Promotor truncado al sitio de inicio de transcripción GGAG TAGC
21 Directo al Nivel 1 srRNA ARN regulador pequeño (para silenciamiento traslacional) TAGC GTTT
22 Directo al Nivel 1 sgRNA ARN guía único (para CRISPRi) TAGC GTTT
23 pICH41295 FLANCO ARRIBA Secuencia de flanqueo aguas arriba del sitio de recombinación homóloga objetivo GGAG AATG
24 pICH41276 FLANCO ABAJO Secuencia de flanqueo aguas abajo del sitio de recombinación homóloga objetivo GCTT CGCT

Tabla 1: Una lista de vectores y voladizos de los usuarios de nivel 0 disponibles. Los vectores 1 a 18 son del kit MoClo de la planta15. Los vectores 19-22 son del kit CyanoGate12. Para las piezas srRNA y sgRNA, las secuencias sintetizadas o los productos PCR se ensamblan directamente en vectores de aceptación de nivel 1. Los vectores 23 a 24 son del kit Plant MoClo que han sido reutilizados para su transformación mediante la recombinación homóloga utilizando el kit CyanoGate.

Componentes de ensamblaje BpiI (Nivel 0, T) Componentes de ensamblaje BsaI (Nivel 1)
50-100 ng del vector del aceptador 50-100 ng del vector del aceptador
Para cada vector/parte que se va a insertar, utilice una relación 2:1 de inserto: vector aceptador. Para cada vector/parte que se va a insertar, utilice una relación 2:1 de inserto: vector aceptador.
2 L 10 mM ATP(Tabla de materiales) 2 L 10 mM ATP(Tabla de materiales)
Búfer G de 2 l (buffer para BpiI/BsaI) Búfer G de 2 l (buffer para BpiI/BsaI)
2 L De BSA (10x)(Tabla de Materiales) 2 L De BSA (10x)(Tabla de Materiales)
10 unidades de BpiI (1 L10 U/L BpiI, Tabla de Materiales) 10 unidades BsaI (1 L 10 U /L BsaI, Tabla de Materiales)
Llevar a 20 l con dH2O. Llevar a 20 l con dH2O.
200 unidades de ligada al ADN T4 (1 L 200 U/L, Tabla de Materiales) 200 unidades de ligada al ADN T4 (1 L 200 U/L, Tabla de Materiales)
Protocolo de termociclador (Nivel 0, T) Protocolo de termociclador (Nivel 1)
37oC durante 10 min ciclo x 5 37oC durante 10 min ciclo x 5
16 oC durante 10 min 16 oC durante 10 min
37 oC durante 20 min 37 oC durante 20 min
65oC durante 10 min 65oC durante 10 min
16 oC (mantener) 16 oC (mantener)

Tabla 2: Protocolos para conjuntos Golden Gate en los Niveles 0, 1 y T. El ensamblaje en vectores de aceptación de nivel 0 y nivel T utiliza la enzima de restricción BpiI (izquierda). El ensamblaje en vectores de aceptación de nivel 1 utiliza la enzima de restricción BsaI (derecha). Esta tabla ha sido adaptada de Vasudevan et al.12.

Primer No. Secuencia (5'-3') Longitud (bp) Descripción
L0T hacia adelante GTCTCATGAGCGGATAGATAGATA
TTTGAATG
28 Para amplificación desde el Nivel 0 y el Nivel T
L1 inverso GAACCCTGTGGTTGGCATGC
ACATAC
26 Para amplificación desde el Nivel 1
L1 hacia adelante CTGGTGGGGCAGGATATATTGT
GGTG
24 Para amplificación desde el Nivel 1
L0T inverso TTGAGTGAGCTGATACCGCT 20 Para amplificación desde el Nivel 0 y el Nivel T

Tabla 3: Lista de imprimaciones para la validación o secuenciación de PCR de vectores de nivel 0, 1 y T.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El ensamblaje de Golden Gate tiene varias ventajas en comparación con otros métodos de ensamblaje vectorial, particularmente en términos de escalabilidad20,21. Sin embargo, la configuración del sistema Golden Gate en un laboratorio requiere tiempo para desarrollar una familiaridad con las diversas partes y bibliotecas vectoriales de aceptación y procesos generales de montaje. A menudo se necesita una planificación cuidadosa para ensamblajes más complejos o cuando se realiza un gran número de ensamblajes complejos en paralelo (por ejemplo, hacer un conjunto de vectores de nivel T que contienen varios casetes de expresión génica). Recomendamos enumerar primero todas las combinaciones de casetes de expresión génica necesarias y, a continuación, mapear el flujo de trabajo del nivel 0 al nivel T en silico. Durante este proceso, los usuarios deben considerar las piezas "dummy" de Nivel 1 disponibles en el kit Plant MoClo que permiten el montaje de vectores de Nivel 1 no secuenciales en nivel T (por ejemplo, los vectores de nivel 1 de posición 1 y posición 3 se pueden ensamblar junto con la pieza "Dummy" Nivel 1 posición 2), que puede reducir el número total de reacciones de montaje y pasos de clonación requeridos15.

La síntesis de ADN es típicamente el método más simple para construir nuevas partes de Nivel 0. Sin embargo, cuando se requiere clonación (por ejemplo, a partir de plásmidos o ADN genómico), optimizar el diseño de las imprimaciones utilizadas para la amplificación es importante para maximizar la eficiencia del posterior ensamblaje vectorial de nivel 0. Los dos pasos más críticos en el diseño de imprimación son: 1) comprobar que se incluyen los voladizos correctos y están en la orientación adecuada para las imprimaciones delantera sano y reversa(Figura 1 y Tabla 1),y 2) asegurando que la longitud de la imprimación secuencia que se recocido a la plantilla es lo suficientemente larga (18-30 bp) y que el valorT m para esta secuencia (idealmente 58-62 oC) es similar para el par de imprimación(Figura 1A). Si una secuencia requiere domesticación, hay varias estrategias disponibles. Para secuencias cortas (por ejemplo, <200 bp), se puede diseñar un par de imprimaciones largas hacia adelante y hacia atrás en las que los extremos de 3o se relacionan entre sí (es decir, una superposición de >20 bp) y forman una secuencia de doble trenzado después de la amplificación. Para secuencias más largas, se pueden amplificar fragmentos separados de la secuencia que quitan sitios de restricción ilegales y, a continuación, se ensamblan mediante un enfoque de ensamblado de Golden Gate(Figura 2). Si la eficiencia del ensamblaje con productos de PCR es deficiente, los fragmentos individuales de una secuencia de nivel 0 se pueden clonar en el vector de aceptación universal de nivel 1 (pAGM1311), validarse y, a continuación, ensamblar juntos en el vector de aceptación de nivel 0 adecuado15. Se recomienda una relación molar vectorial insertor insert:1 2:1 para un montaje eficiente de Golden Gate. Sin embargo, para ensamblajes de solo 2-3 vectores (por ejemplo, dos partes de nivel 0 y un vector de aceptación de nivel 1), la combinación de 100 ng de cada uno con regularidad da como resultado ensamblajes exitosos. La eficiencia de los ensamblajes tiende a disminuir a medida que aumenta el número de vectores utilizados por reacción, lo que resulta en una reducción en el número total de colonias blancas después de la transformación(Figura 3).

Antes de la conjugación, se recomienda la validación de vectores de nivel T finalizados por resumen de restricción y PCR. La transferencia de ADN conyugal es una técnica bien estabilizada para cepas cianobacterianas, incluyendo aquellas que no son transformables naturalmente41,45. Algunos pasos importantes en el protocolo de conjugación incluyen: 1) manejo cuidadoso de la cepa auxiliar E. coli después del crecimiento nocturno (por ejemplo, evitar el vórtice)35, 2) teniendo cuidado de eliminar por completo los rastros de los antibióticos utilizados para crecer ayudante y carga E. coli cepas, 3) un período de incubación adecuado para la mezcla de carga y cepas auxiliares y cianobacterias (por ejemplo, un período de incubación más largo fue crítico para S. elongatus UTEX 2973), y 4) el período de transferencia inicial de la célula mezcla en membranas en placas de agar LB-BG11 que carecen de antibióticos durante 24 h.

Las colonias cianobacterianas aisladas deben desarrollarse en la membrana dentro de dos semanas para Synechocystis PCC 6803 y S. elongatus UTEX 2973, de lo contrario es probable que la conjugación haya fallado. Varias modificaciones en el protocolo podrían ser probadas, incluyendo 1) utilizando un cultivo cianobacteriano con una mayor densidad de arranque (por ejemplo, OD750 a 1,5 x 2); 2) aumentar el período de incubación antes de la transferencia a la membrana; y 3) extender el período de incubación inicial en la membrana de 24 h a 48 h (es decir, para dar más tiempo a la expresión del gen de resistencia a los antibióticos en el vector transferido). Si la conjugación sigue fallando, se podrían probar métodos alternativos como la electroporación53. Confirmar que una cepa cianobacteriana transgénica es axenica es importante antes de la experimentación posterior. Por último, es una buena práctica confirmar el tamaño del vector hetólogo en la cepa cianobacteriana transgénica. Este último requiere extracción de ADN (sección 5), transformación en E. coli y selección (sección 2.1), y validación vectorial (sección 2.4).

El protocolo de caracterización del promotor descrito utiliza pequeños volúmenes de cultivo (es decir, 2 ml) como un medio para lograr una metodología de cribado de alto rendimiento. Se podrían utilizar volúmenes más grandes dependiendo del espacio fotobiorreactor disponible, lo que ayudaría a mitigar los problemas de evaporación de la cultura. Si se requiere un cribado de alto rendimiento con pequeños volúmenes de cultivo, es esencial tener alta humedad dentro de la cámara de crecimiento para inhibir la evaporación. La evaporación durante un experimento de crecimiento puede ser perjudicial para la precisión y validez de las mediciones de la muestra. Compruebe los volúmenes de cultivo durante y después del experimento para confirmar cuánta evaporación se ha producido.

Para las mediciones del lector de placas, es importante medir cultivos a bajas densidades, idealmente OD750 < 1, para asegurar la adquisición de datos confiables y reproducibles de crecimiento y fluorescencia. Una relación lineal entre el número de celda y OD750 sólo se observa dentro de un rango específico54. Para establecer este rango, se recomienda realizar una dilución en serie (por ejemplo, a partir de laD.O. 750 a 0,1,0) utilizando un transformador conocido en el que se haya confirmado la fluorescencia de eYFP. La trazación de fluorescencia absoluta contra fluorescencia normalizada (fluorescencia eYFP/OD750) ayudará a identificar el rango de trabajo lineal de las densidades de cultivo. Varios lectores de placas incluyen una función de "ganancia" para modificar la sensibilidad del detector de fluorescencia. En este caso, el valor de ganancia debe establecerse en un nivel adecuado antes de comenzar el experimento y no cambiar entre diferentes ejecuciones experimentales o los datos no serán directamente comparables.

Aunque el funcionamiento de diferentes citometros de flujo variará entre los fabricantes, es importante tomar una lectura en blanco de la solución media para facilitar la identificación y la gating de la población cianobacteriana objetivo a partir de cualquier señal de fondo en el medio(Figura 7A,B). Después de esto, la resta del valor de fluorescencia de la muestra de control negativo (por ejemplo, una cepa de tipo salvaje) ayudará a eliminar la autofluorescencia nativa(Figura 7C,D). El parámetro de voltaje del tubo fotomultiplicador (PMT) en un citómetro de flujo tiene una función similar a la ganancia en un lector de placas, es decir, aumentando o disminuyendo la sensibilidad del detector a la intensidad de la señal de fluorescencia. Al igual que con el lector de placas, la tensión PMT debe ajustarse a un nivel adecuado antes de comenzar el experimento55. Una vez establecido, el valor de voltaje PMT debe mantenerse entre diferentes corridas experimentales o los datos no serán directamente comparables.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores agradecen el apoyo financiero a la Red PHYCONET Biotechnology and Biological Sciences Research Council (BBSRC) en Biotecnología Industrial y Bioenergía (NIBB) y al Centro de Innovación en Biotecnología Industrial (IBioIC) por su apoyo financiero. GARG, AASO y AP reconocen el apoyo financiero del programa de doctorado BBSRC EASTBIO CASE (número de subvención BB/M010996/1), el programa de doctorado del Consejo Nacional de Ciencia y Tecnología (CONACYT) y el programa de doctorado de la Asociación de Formación Colaborativa IBioIC-BBSRC (CTP), Respectivamente. Agradecemos a Conrad Mullineaux (Universidad Reina María de Londres), y poul Eric Jensen y Julie Annemarie Zita Zedler (Universidad de Copenhague) por las contribuciones y consejos de vectores y protocolos de plásmidos.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
Modificación genética de las cianobacterias por conjugación utilizando el kit de herramientas de clonación modular CyanoGate
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter