Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Genetisk modifiering av cyanobakterier genom konjugering med hjälp av den modulbaserade klonings verktygslådan Cyanogat

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Här presenterar vi ett protokoll som beskriver hur man i) monterar en självreplikerande vektor med hjälp av CyanoGate Modular kloning Toolkit, II) introducera vektorn i en cyanobakterial värd genom konjugering, och III) karakterisera transgena cyanobakterier-stammar med hjälp av en Plattläsare eller flödescytometri.

Abstract

Cyanobakterier är en mångskiftande grupp av prokaryotiska fotosyntetiska organismer som kan modifieras genetiskt för förnybar produktion av nyttiga industriråvaror. De senaste framstegen inom syntetisk biologi har lett till utveckling av flera klonings verktyg som CyanoGate, ett standardiserat modulärt klonings system för att bygga plasmid-vektorer för efterföljande omvandling eller konjugal överföring till cyanobakterier. Här beskriver vi en detaljerad metod för att montera en självreplikerande vektor (t. ex. med en fluorescerande markör uttrycks kassett) och äktenskapliga överföring av vektorn i cyanobakterial stammar synechocystis SP. PCC 6803 eller synechococcus elongatus utex 2973. Dessutom skisserar vi hur man karakteriserar utförandet av en genetisk del (t. ex. en promotor) med hjälp av en Plattläsare eller flödescytometri.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cyanobakterier är autotrofiska bakterier som kan användas för biosyntesen av en mängd olika naturliga och heterologösa, metaboliska produkter med högt värde1,2,3,4,5, 6. Flera hinder måste fortfarande övervinnas för att utvidga sin kommersiella lönsamhet, framför allt de relativt dåliga avkastningen jämfört med heterotrofiska bioplattformar (t. ex., Escherichia coli och jäst)7. Den senaste utvidgningen av tillgängliga gentekniska verktyg och upptaget av det syntetiska biologiska paradigmet inom cyanobakteriell forskning bidrar till att övervinna sådana utmaningar och vidareutveckla cyanobakterier som effektiva biogödsel8, 9,10.

De viktigaste metoderna för att införa DNA i cyanobakterier är omvandling, konjugering och elektroporation. De vektorer som överförs till cyanobakterier genom omvandling eller elektroporation är "självmord" vektorer (dvs. integrativa vektorer som underlättar homolog rekombination), medan självreplikerande vektorer kan överföras till cyanobakterier genom omvandling, konjugering eller elektroporation. För de förstnämnda finns ett protokoll för tekniska modell arter som kan vara mottagliga för naturlig omvandling11. På senare tid, en modulär kloning (MoClo) Toolkit för cyanobakterier kallas Cyanogat har utvecklats som sysselsätter en standardiserad Golden Gate Vector monteringsmetod för teknik med hjälp av naturliga omvandling, elektroporation eller konjugation12.

Golden Gate-typ monteringstekniker har blivit alltmer populära under de senaste åren, och montering standarder och del bibliotek finns nu tillgängliga för en mängd olika organismer13,14,15,16 ,17. Golden Gate använder typ IIS restriktioner enzymer (t. ex., BsaI, BpiI, BsmBI, BtgZI och AarI) och en kostym av acceptorer och unika överhäng för att underlätta riktad hierarkisk montering av flera sekvenser i en "One Pot" församling reaktion. Typ IIS begränsning enzymer erkänna en unik asymmetrisk sekvens och skär ett definierat avstånd från deras erkännande platser för att generera en vacklade, "klibbiga slutet" klippa (typiskt en 4 nukleotid [NT] överhäng), som senare kan utnyttjas för att köra beställt DNA Monterings reaktioner15,18. Detta har underlättat utvecklingen av stora bibliotek av modulära nivå 0-delar (t. ex. projektansvariga, öppna Läs ramar och Terminatorer) som definieras av en gemensam syntax, såsom PhytoBricks standard19. Nivå 0 delar kan sedan lätt monteras i nivå 1 uttrycks kassetter, varefter mer komplexa högre ordning församlingar (t. ex., multigene uttryck konstruktioner) kan byggas i en acceptor vektor val12,15. En viktig fördel med Golden Gate-typ monteringstekniker är deras mottaglighet för automatisering vid hög genomströmning anläggningar, såsom DNA gjuterier20,21, som kan möjliggöra testning av komplexa experimentella konstruktioner som lätt kan uppnås genom manuellt arbete.

Cyanogat bygger på den etablerade anläggningen moclo system12,15. För att införliva en ny del i Cyanogat måste dels sekvensen först tämjas, d.v.s. "olagliga" igenkännings platser för BsaI och BpiI måste avlägsnas. I fråga om en del kodning för en öppen läsbild (dvs en kodning sekvens, CD-skivor), erkännande platser kan störas genom att generera synonyma mutationer i sekvensen (dvs., ändra en kodon till ett alternativ som kodar för samma aminosyra rester). Detta kan uppnås genom en mängd olika metoder, allt från DNA-syntes till polymeras kedjereaktion (PCR) amplifiering-baserade strategier såsom Gibson Assembly22. Beroende på uttrycket värd som används, försiktighet bör iakttas för att undvika införandet av sällsynta kodons som kan hämma effektiviteten av översättningen23. Ta bort erkännande platser i promotorn och Terminator sekvenser är typiskt en mer riskfyllda strävan, som ändringar kan påverka funktionen och delen kanske inte fungerar som förväntat. Till exempel kan ändringar av bindnings platser för förmodade transkriptionsfaktorer eller den ribosom bindnings platsen inom en promotor förändra styrka och reaktionsförmåga till induktion/förtryck. Likaså ändringar av viktiga Terminator strukturella egenskaper (t. ex. GC Rich Stem, loop och Poly-U svans) kan ändra terminering effektivitet och effekt genuttryck24,25. Även om flera online-resurser är tillgängliga för att förutsäga aktiviteten av promotorn och Terminator sekvenser, och informera om en föreslagen mutation kommer att påverka prestanda26,27, dessa verktyg är ofta dåliga prediktorer för prestanda i cyanobakterier28,29,30.. Som sådan, in vivo karakterisering av modifierade delar rekommenderas fortfarande att bekräfta aktivitet. För att hjälpa till med kloning av motsträvare sekvenser, cyanogate innehåller en låg kopia kloning acceptor vektor baserad på biobrick Vector pSB4K512,16,31. Dessutom är en "design och bygga" portal tillgänglig via Edinburgh Genome Foundry för att hjälpa till med Vector design (dab.genomefoundry.org). Slutligen, och viktigast av allt, inkluderar Cyanogat två nivå T acceptor vektor konstruktioner (motsvarande nivå 2 acceptor vektorer)15 för att införa DNA i cyanobakterier med hjälp av självmords vektorer, eller breda vektorer för värd-Range som kan själv replikering i flera cyanobakteriella arter32,33,34.

Här kommer vi att fokusera på att beskriva ett protokoll för att generera nivå T självreplikerande vektorer och genetisk modifiering av Synechocystis pcc 6803 och Synechococcus elongatus Utex 2973 (synechocystis PCC 6803 och S. elongatus Utex 2973 hädanefter) genom konjugering (även känd som Tri-Parental parning). Conjugal överföring av DNA mellan bakterieceller är en väl beskriven process och har tidigare använts för tekniska cyanobakteriella arter, särskilt de som inte är naturligt kompetenta, såsom S. elongatus utex 297335, 36,37,38,39,40,41. I korthet, cyanobakterial kulturer inkuberas med en E. coli stam transporterar vektorn som skall överföras ("Last" vektor) och vektorer (antingen i samma E. coli stam eller i ytterligare stammar) för att möjliggöra konjugering ("mobilizer" och "hjälpare" vektorer). Fyra viktiga villkor krävs för att den äktenskapliga överföringen ska ske: 1) direkt kontakt mellan celler som är involverade i DNA-överföring, 2) Last vektorn måste vara förenlig med konjugeringssystemet (dvs. det måste innehålla ett lämpligt ursprung för överföring (Orit). även känd som en BOM (grund för rörlighet) plats), 3) ett DNA Hack protein (t. ex. kodas av Mob genen) att Nicks DNA vid Orit att initiera enkelsträngad överföring av DNA i Cyanobakterium måste vara närvarande och uttryckt från antingen lasten eller hjälp vektorer, och 4) den överförda DNA får inte förstöras i mottagaren Cyanobakterium (dvs måste vara resistenta mot nedbrytning av, till exempel, begränsning Endonuklease aktivitet)35,42. För att Last vektorn ska bestå måste replikens ursprung vara kompatibelt med mottagaren Cyanobakterium för att möjliggöra själv replikering och spridning till dotter cells post division. Till stöd med villkor 3 och 4, flera Helper vektorer är tillgängliga via Addgene och andra kommersiella källor som kodar för Mob samt flera metylaser för att skydda från infödda endonukleaser i värd Cyanobakterium43. I detta protokoll, konjugation underlättades av en MC1061 E. coli stam bärande person och Helper vektorer pRK24 (www. addgeneorg/51950) och pRL528 (www.addgene.org/58495), respectively. Försiktighet måste iakttas vid val av vektorer som skall användas föräktenskapliga överföring. Till exempel, i CyanoGate kit självreplikerande Cargo Vector pPMQAK1-T kodar för en Mob protein12. Men pSEVA421-T inte44, och som sådan, Mob måste uttryckas från en lämplig hjälpare vektor. De vektorer som används bör också vara lämpliga för målorganismen. Till exempel kräver effektiv konjugal överföring i Anabaena SP. PCC 7120 en hjälp vektor som skyddar person vektorn mot matsmältningen (t. ex. pRL623, som kodar för de tre metylaser avaim, Eco47iiM och Ecot22iM)45, 46.

I detta protokoll beskriver vi vidare hur man karakteriserar utförandet av delar (dvs. projektansvariga) med en fluorescerande markör med hjälp av en Plattläsare eller en flödescytometer. Flödescytometrar kan mäta fluorescens på en enda cellbasis för en stor population. Dessutom tillåter flödescytometrar användare att "utfärda utegångsförbud för" de förvärvade uppgifterna och ta bort bakgrundsbrus (t. ex. från partiklar i kulturen eller föroreningen). Däremot får plattläsarna en sammanlagd fluorescensmätning av en given volym kultur, vanligtvis i flera replikbrunnar. De viktigaste fördelarna med Plattläsare över cytometrar är lägre kostnad, högre tillgänglighet och vanligtvis inga krav på specialist programvara för nedströms dataanalyser. De huvudsakliga nackdelarna med Plattläsare är den relativt lägre känsligheten jämfört med cytometrar och potentiella problem med den optiska densiteten hos uppmätta kulturer. För jämförande analyser måste prov på Plattläsare normaliseras för varje brunn (t. ex. till en mätning av Odlingstätheten, som normalt tas som absorbans vid den optiska densiteten vid 750 nm [OD750]), vilket kan leda till felaktigheter för prover som är för täta och/eller inte väl blandade (t. ex. när de är benägna att aggregering eller flocympning).

Som en översikt, här visar vi i detalj principerna för att generera nivå 0 delar, följt av hierarkisk församling med hjälp av CyanoGate kit och kloning i en vektor som lämpar sig föräktenskapliga överföring. Vi visar sedan den äktenskapliga transfer processen, val av axenic transkonjugant stammar som uttrycker en fluorescerande markör, och efterföljande förvärv av fluorescensdata med hjälp av en flödescytometer eller en Plattläsare.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Vector montering med hjälp av växten MoClo och CyanoGate verktygslådor

Obs: innan du fortsätter med Vector församling, är det starkt rekommenderat att användarna bekanta sig med vektorn nivå strukturer av växten och cyanogate moclo system12,15.

  1. Konstruktion av nivå 0-delar
    Anmärkning: nivå 0-delar kan syntetiseras som kompletta vektorer eller som linjära sekvenser för montering med nivå 0-acceptorer (t. ex. gBlocks, IDT). Alternativt kan sekvenser amplifieras från en källmall (t. ex. en vektor eller renat genomiskt DNA). Här beskrivs hur du skapar en ny nivå 0-del från en förstärkt produkt. En översikt över monteringsprocessen för Golden Gate från nivå 0 till nivå T visas iFigur 1.
    1. Designa primers.
      1. Bestäm vilken nivå 0 modul att montera och identifiera lämpliga 5 ′ och 3 ′ överhäng (tabell 1)12,15. Kontrollera DNA-sekvens för att klona för förekomst av BpiI eller BsaI restriktioner webbplatser.
        Anmärkning: en sekvens som innehåller en av dessa platser måste vara domesticerade genom att ändra en eller flera NTs i begränsningen webbplatssekvens. En strategi för att göra detta med hjälp av Golden Gate-församlingen beskrivs i figur 2.
      2. För att förstärka en DNA-sekvens, designa en lämplig framåt och omvänd primer par. För framåt primer, Välj 18 − 30 BP komplement till 5 ′ slutet av DNA mallsekvensen. För omvänd primer, Välj 18 − 30 BP omvänd komplement till 3 ′ slutet av DNA mallsekvensen.
        Anmärkning: primers med smälttemperatur (Tm) på 58 − 62 ° c ger vanligtvis de mest konsekventa förstärknings resultaten (figur 1A).
      3. Lägg till följande till 5 ′ slutet av framåt primer: 1) en slumpmässig sträng av 4 − 6 NTs vid 5 ′ slutet av BpiI webbplats, 2) den BpiI begränsning webbplats (GAAGAC), 3) två slumpmässiga NTs, och 4) den 5 ' överhäng valt i steg 1.1.1.1. Lägg till följande till 5 ′ slutet av omvänd primer: 1) en slumpmässig sträng av 4 − 6 NTs vid 5 ′ slutet av BpiI webbplats, 2) den BpiI begränsning webbplats (GAAGAC), 3) två slumpmässiga NTs, och 4) den 3 ' överhäng valt i steg 1.1.1.1. Vid avslut, Beställ primer par.
        Anmärkning: se figur 1a för ett exempel på ett framåtblickande och omvänt primer-par.
    2. Amplifiera en DNA-sekvens från genomiskt DNA.
      1. Extrahera genomiskt DNA enligt beskrivningen i avsnitt 5. Amplifiera produkter med PCR med hjälp av en HiFi-DNA-polymeras (tabell över material).
        Observera: som ett exempel, Ställ in PCR-reaktioner (20 − 50 μL) enligt tillverkarens anvisningar. Använd ~ 100 ng av genomisk DNA per reaktion. Använd ett termiskt cykel program som består av ett initialt denatureringssteg på 98 ° c i 30 s, följt av högst 25 cykler av denaturering vid 98 ° c i 10 s, primer glödgning vid 58 ° c för 15 s och produkt förlängning vid 72 ° c i 30 s (modifiera den senare beroende på storlek på den produkt/typ av DNA-polymeras som används), följt av en slutlig förlängnings steg på 72 ° c i 2 minuter.
      2. Om PCR-produkten ska renas med gel, kör du hela PCR-reaktionen på en agaros-gel enligt beskrivningen i avsnitt 6. Skär bandet av intresse ur agaros gel och rena den med hjälp av en gel extraktion Kit (tabell över material).
      3. Alternativ till steg 1.1.2.2, om PCR-produkten ska användas utan gel rening, kontrollera band storleken genom att köra en alikvot av PCR-Reaktionsprovet (~ 5 μL) på en agaros gel. Om gelen visar endast lämpligt band och inga tecken på primer dimers, rena PCR-produkten med hjälp av en DNA-rening Kit (tabell över material).
      4. Elute renat DNA i en liten mängd avjoniserat vatten (t. ex. 10 μL) för att uppnå en hög DNA-koncentration (> 20 ng/μL är normalt tillräckligt).
    3. Montera den förstärkta DNA-produkten (eller produkterna, se figur 2) i nivå 0. Bered en 20 μL reaktionsblandning med BpiI (figur 1b) och Ställ in termocyklerprogrammet enligt beskrivningen i tabell 2. Fortsätt till E. coli -omvandling med 5 μl av den sammansatta reaktionsblandningen på nivå 0 (enligt beskrivningen i avsnitt 2).
  2. Konstruktion av nivå 1-aggregat
    1. Bestäm vilka nivå 0-delar som ska monteras (figur 1C och tabell 1). Välj en lämplig nivå 1-acceptorvektor15.
      Obs: i detta skede är det viktigt att veta vad den slutliga vektor designen kommer att vara i nivå T, eftersom detta kommer att påverka valet av nivå 1 acceptor vektor. Nivå 1 position 1 (framåt) acceptor Vector (pICH47732) kan användas som standard om målet är att ha en enda nivå 1-enhet (t. ex. en gen uttrycks kassett) i nivå T. Om två eller flera nivå 1-sammansättningar ska monteras i nivå T måste dock positionen och riktningen för varje montering på nivå 1 beaktas. Upp till sju nivå 1-sammansättningar kan monteras i en level T acceptor-vektor med hjälp av nivå 1-acceptorvektorer med lämpliga lägen12.
    2. Montera nivå 0-delarna i nivå 1. Bered en 20 μl reaktionsblandning med bsai och Ställ in det termiska apparat-programmet enligt beskrivningen i tabell 2. Fortsätt till E. coli -omvandling med 5 μl av den sammansatta reaktionsblandningen nivå 1 (enligt beskrivningen i avsnitt 2).
  3. Konstruktion av nivå T-aggregat
    1. Bestäm vilka nivå 1-sammansättningar som ska monteras (figur 1D). Välj en lämplig nivå T acceptor vektor.
      Anmärkning: pUC19A-T (ampicillin Resistance) och pUC19S-T (spectinomycin resistens) är hög kopie rad integrativ vektorer som inte kan replikera i cyanobakterier och används främst för genomisk integration (dvs., Knock-in eller knock-out av gener) via homolog rekombination12. Leverans av integrativ vektorer kan fortsätta genom naturlig omvandling i mottagliga cyanobakteriella arter11. pPMQAK1-T är ett brett värd område, replikativ vektor som levereras genom konjugal överföring (avsnitt 3).
    2. Välj en lämplig slutlänk till ligera 3 ′ slutet av den slutliga nivå 1 församling till nivå T Backbone15.
      Obs: länken som krävs är samma nummer som positionen för den sista delen. Till exempel, en nivå T vektor med endast en nivå 1 position 1 (framåt eller bakåt) del kommer att kräva end-Link 1 (pICH50872) för ligering i nivå T ryggraden.
    3. Montera en eller flera nivå 1-sammansättningar i nivå T. Förbered en reaktionsblandning med bpii och den erforderliga länk vektorn och Ställ in det termiska apparat-programmet enligt beskrivningen i tabell 2. Fortsätt till E. coli -omvandling med 5 μl av den sammansatta nivå T-reaktionsblandningen (enligt beskrivningen i avsnitt 2).

2. E. coli omvandling och vektor rening

  1. E. coli -omvandling (dag 1)
    1. Avfrostning en alikvot (~ 25 μL) av kemiskt behöriga E. coli -celler (tabell över material) och pipettera försiktigt till en 1,5 ml tub på is. Tillsätt 5 μL av sammansättnings blandningen (nivå 0, 1 eller T) och Inkubera röret på is i ytterligare 30 − 60 minuter.
    2. Värme chock celler genom inkuberande röret i ett vattenbad vid 42 ° c för 30 s, sedan placera röret tillbaka på isen för 2 min. Tillsätt rumstemperatur (RT) Super optimal buljong med katabolit repression (S.O.C.) medium (250 μL) till röret. Inkubera röret vid 37 ° c i 1 h vid 225 rpm i en skakande inkubator.
    3. Platta 40 μl av kulturen på en LB-agarplatta som innehåller lämplig slutlig koncentration av antibiotika (100 μg/ml för Spektinomycin dihydrokloridpentahydrat [Nivå 0], 100 μg/ml carbenicillin dinatrion [nivå 1] eller 50 μg/ml kanamycinsulfat [ Nivå T]), 1 mM isopropyl-beta-D-tiogalactopyranosid (IPTG) och 40 μg/mL 5-Bromo-4-klor-3-indolyl-β-D-galaktopyranosid (X-gal) för Blåvit screening. Inkubera plattan över natten vid 37 ° c.
      Notera: mängden av kulturpläterade kan varieras beroende på effektiviteten av de kompetenta cellerna för E. coli och ligationreaktionen. Platta en större volym om < 10 kolonier observeras efter övernattning inkubation.
  2. Val av vita kolonier och beredning av flytande kulturer (dag 2)
    Anmärkning: beroende på effektiviteten i sammansättningen reaktion och efterföljande omvandling, LB agar plattor kan innehålla inga kolonier, blå kolonier eller vita kolonier (figur 3). Blå kolonier är indikativa för acceptor vektorer som inte har genomgått restriktioner (dvs en funktionell kopia av Lacz är fortfarande närvarande). Vita kolonier indikerar att Lacz -uttryckskassetten har förlorats och ersatts av en del/montering.
    1. Du kan också validera att vita kolonier innehåller den förväntade vektorn genom att utföra PCR som beskrivs i avsnitt 7.
    2. Välj enstaka vita kolonier (eller PCR-kontrollerade kolonier) med en 10 μL spets och överför till ett 15 mL centrifugertub som innehåller LB-medium (5 mL) och lämpliga antibiotiska koncentrationer (steg 2.1.3). Inkubera rören vid 37 ° c över natten vid 225 rpm i en skakande inkubator.
  3. Plasmid vektor rening (dag 3)
    1. Du kan också förbereda en glycerol lager av natten E. coli kultur för långsiktig kryolagring av vektorer. Tillsätt 500 μL bakterieodling till 500 μL på 50% (v/v) glycerol i en lämplig 1,5 − 2,0 mL tub för kryoförvaring vid-80 ° c. Blanda försiktigt genom att invertera 5 − 10X. Flash-frys prover i flytande kväve och förvara i en-80 ° c frys.
    2. Snurra ner kulturer i 15 mL centrifugrör vid 3 000 x g i 5 − 10 min. Kassera supernatanten utan att störa cellpelleten. Rena vektorn med hjälp av en Plasmid rening Kit (tabell över material). Elute renad vektor i 35 μL avjoniserat vatten.
      Obs: Använd lägre elutionsvolymer för att ytterligare öka vektor koncentrationen. Samma elueringslösning kan sättas genom en rening kolumn två gånger för ökad avkastning.
    3. Mät koncentrationen av vektorn i eluenten med hjälp av en spektrofotometer (tabell över material).
      Obs: hög kopia-nummer vektorer i E. coli, såsom pUC19, vanligtvis ger avkastning på 50 − 300 ng/μl. låga kopior-nummer vektorer, såsom PPMQAK1-T, vanligtvis ger avkastning på 15 − 60 ng/μl.
  4. Vektor validering
    Obs: vektorer kan verifieras genom begränsning av matsmältningen (steg 2.4.1) och/eller sekvensering (steg 2.4.2).
    1. Begränsa 0,5 − 1 μg vektor med ett lämpligt begränsnings enzym (er) och kontrollera de förväntade band storlekarna enligt beskrivningen i avsnitt 6 (figur 4).
      Anmärkning: Felaktiga bandstorlekar indikerar vanligtvis felaktig montering, i vilket fall fler vita kolonier kan skäras eller monteringen kan upprepas. BsaI och BpiI kan användas för att validera rätt storlek på insatsen för nivå 0-och nivå 1-sammansättningar. BsaI eller BpiI kan användas tillsammans med ett extra, kompatibelt begränsnings enzym som skär inom skäret och/eller vektor stamnätet för att producera en distinkt uppsättning väl separerade band efter matsmältningen.
    2. Sekvensera vektorn med hjälp av sanger ordningsföljd med en lämplig primer uppströms den sammansatta regionen med hjälp av kommersiell sekvenserings anläggning (tabell 3).
      Obs: alla nya nivå 0-delar ska sekvenseras för att bekräfta den förväntade sekvensidentiteten. Sekvens validering av nivå 1 och T vektorer krävs normalt inte om monteras från tidigare sekvenserade nivå 0 delar.

3. generering av mutanter genom konjugering

Anmärkning: här, ett protokoll föräktenskapliga överföring av en självreplikerande Last vektor i synechocystis PCC 6803 eller S. elongatus utex 297311,47 beskrivs. Detta protokoll är tillämpligt på andra modell arter (t. ex. S. elongatus pcc 7942 och synechococcus sp. PCC 7002). Allt arbete med cyanobakterier (och tillhörande buffertpreparat) bör utföras under sterila förhållanden i ett laminärt flödes skydd.

  1. Tillväxt av cyanobakterial kulturen (dag 1)
    1. Bered BG11 medium enligt Lea-Smith et al.11, och agar plattor med lb-BG11 och BG11 + Kan50 (avsnitt 8).
    2. Inrätta en ny kultur av Synechocystis pcc 6803 eller S. elongatus utex 2973 genom att inokulera en 100 ml e-kolv av färskt BG11 medium (50 ml) med celler som kommer från en axenisk BG11 agar tallrik. Odla Synechocystis pcc 6803 kulturer vid 30 ° c, 100 μmol fotoner m-2s-1 vid 100 rpm och Grow s. elongatus utex 2973 vid 40 ° c, 300 μmol fotoner m-2s-1 vid 100 rpm. Odla kulturer tills OD750 = 0.5 − 1.5 (typiskt 1 − 2 dagar).
      Anmärkning: s. elongatus utex 2973 kulturer kan odlas vid 40 ° c i hög ljusintensiteter (t. ex., 2000 μmol fotoner m-2S-1)48.
  2. Tillväxt av hjälpare och Last E. coli stammar (dag 2)
    1. Inokulera LB-medium som innehåller ampicillin (slutlig koncentration 100 μg/mL) och kloramfenikol (slutlig koncentration 25 μg/mL) med en MC1061 E. coli -stam som innehåller vektorer PRK24 och pRL528 (dvs. hjälparstammen) och växa vid 37 ° c över natten vid 225 rpm i en skakande inkubator. Växa upp en tillräcklig mängd hjälpare stamkultur, förutsatt 1 mL kultur krävs per konjugering.
    2. Inokulera LB-medium (5 mL) som innehåller lämpliga antibiotika med E. coli -kulturen som transporterar Last vektorn (dvs. en nivå T-vektor). Odla kulturen vid 37 ° c över natten vid 225 rpm i en skakande inkubator.
  3. Conjugal Transfer (Tri-föräldra parning) (dag 3)
    1. Förbered E. coli Helper och Last stammar. Centrifugera hjälparen och lasten E. coli över natten kulturer på 3 000 x g för 10 min vid rumstemperatur. Kassera supernatanten utan att störa cellpelleten.
    2. Tvätta pelleten genom att tillsätta färskt LB-medium utan antibiotika. Använd samma volym som den ursprungliga kulturen. Omsuspendera pelleten genom att försiktigt Pipettera upp och ner. Vortexblanda inte kulturen. Upprepa detta steg 3x för att ta bort kvarvarande antibiotika från natten kulturen.
    3. Centrifugera den återsuspenderade kulturen (som i steg 3.3.1), Kassera supernatanten och Omsuspendera i halva volymen av LB-mediet för den initiala kultur volymen (t. ex. 2,5 mL om natt kulturen var 5 mL). Kombinera 450 μL av hjälparstammen med 450 μL av Last stammen i en 2 mL tub och Ställ undan (låt vid RT) tills steg 3.3.6.
    4. Förbereda den cyanobakteriella kulturen. För varje konjugeringsreaktion, Använd 1 mL cyanobakterial kultur (OD750 = 0,5 − 1,5).
    5. Centrifugera erforderlig total mängd cyanobakterial kultur vid 1 500 x g i 10 minuter vid RT, kassera sedan supernatanten försiktigt utan att störa cellpelleten. Tvätta pelleten genom att tillsätta färskt BG11 medium med samma initiala volym. Omsuspendera pelleten genom att försiktigt Pipettera upp och ner, Vortexblanda inte kulturen. Upprepa detta steg 3x och ställ den tvättade kulturen åt sidan.
    6. Tillsätt en delmängd av den tvättade cyanobakteriella kulturen (900 μL) till de kombinerade E. coli -stammarna (hjälpare och last) (900 μl) i ett 2 ml-rör. Blanda kulturerna genom att försiktigt Pipettera upp och ner. Skaka inte. Inkubera blandningen vid RT i 30 min för Synechocystis pcc 6803 eller 2 h för S. elongatus utex 2973.
    7. Centrifugera blandningen vid 1 500 x g i 10 minuter vid RT. ta bort 1,6 ml av supernatanten. Omsuspendera pelleten i resterande ~ 200 μL av supernatanten. Placera ett membranfilter på 0,45 μm på en LB-BG11 agar platta som saknar antibiotika (avsnitt 8). Fördela noggrant 200 μl av blandningen E. coli/cyanobakterial kultur på membranet med en steril spridare eller en steril, böjd spets och försegla plattan med paraffin film.
    8. Inkubera LB-BG11 plattan med membranet för 24 h. underhålla membran med Synechocystis pcc 6803 kulturer vid 30 ° c, 100 μmol fotoner m-2s-1. Underhålla membran med s. elongatus utex 2973 kulturer vid 40 ° c i 150 μmol fotoner m-2S-1.
  4. Membran överföring
    1. Efter 24 h, överför försiktigt membranet med hjälp av flamsteriliserade pinkoppar till en färsk BG11 agar-platta som innehåller lämplig antibiotika (avsnitt 8) för att välja för Last vektorn. Försegla plattan med paraffin film.
    2. Inkubera BG11 agar plattan under lämpliga tillväxtförhållanden, som beskrivs ovan för Synechocystis pcc 6803 eller S. elongatus utex 2973, tills kolonier visas.
      Observera: kolonier uppträder typiskt efter 7 − 14 dagar för Synechocystis pcc 6803 och 3 − 7 dagar för S. elongatus utex 2973.
  5. Val av konjuganter
    Anmärkning: endast cyanobakteriella kolonier som transporterar Last vektorn kommer att kunna växa på membranet (figur 5).
    1. Använd en värmesteril slinga och välj minst två enskilda kolonier från membranet och stryk på en ny BG11 agar-platta som innehåller lämplig antibiotika (figur 5C).
      Anmärkning: nyligen strimmiga kolonier kan fortfarande vara kontaminerade med E. coli som överförts från konjugering (dvs. om små vita kolonier är uppenbara på plattan), så två eller tre ytterligare rundor av ny Streaking på färska BG11 agar plattor typiskt är behövs för att uppnå en cyanobakteriell kultur av axenic.
    2. Bekräfta frånvaron av E. coli -kontaminering genom att Inokulera en strimma av cyanobakteriell odling i ett 15 ml centrifugerör som innehåller 5 ml lb-medium och inkuberas vid 37 ° c över natten vid 225 rpm i en skakande inkubator. Efter en tillräcklig tillväxtperiod (~ 7 dagar), plocka enskilda axenic kolonier att inrätta flytande kulturer för långsiktig kryolagring eller efterföljande experiment.
  6. Kryolagring av cyanobakterial stammar
    1. Odla en cyanobakteriell flytande kultur i BG11 (som beskrivs i avsnitt 3,1) tills OD750 = 1,5 − 3,0. Centrifugera 10 mL kultur i 10 min vid 1 500 x g, ta bort supernatanten och Omsuspendera cellerna i 5 ml färskt BG11 medium.
    2. Tillsätt 3,5 mL autoklav steriliserad 50% (v/v) glycerol för en slutlig glycerolkoncentration på ~ 20% (v/v)49. Detta tillvägagångssätt fungerar bra för Synechocystis pcc 6803. Alternativt, tillsätt 5 mL filtersteriliserad BG11 innehållande 16% (v/v) dimetylsulfoxid (DMSO) för en slutlig DMSO-koncentration på ~ 8% (v/v)50. Denna metod rekommenderas för de flesta stammar, inklusive S. elongatus utex 2973.
      FÖRSIKTIGHET: DMSO är giftigt och bör hanteras med lämpligt skydd.
    3. Blanda försiktigt genom att invertera 5 − 10X. Subaliquot ~ 1 mL kultur i separata Cryostorage kompatibla 1,5 mL skruv-Cap rör (tabell över material). Placera rören i a-80 ° c frys för kryoförvaring. Blixten får inte frysas i flytande kväve.
      Anmärkning: minst tre lager per stam rekommenderas.
    4. För återhämtning, ta bort ett rör från-80 ° c frys och Tina kulturen i en 35 ° c vattenbad medan försiktigt blanda. Tillsätt den tinade kulturen till 50 mL färskt BG11 medium och växa som en flytande kultur (som beskrivs i avsnitt 3,1).
      Notera: Alternativt kan kulturen vara strimmig och odlas på en färsk BG11 agar tallrik. Transgena kulturer som transporterar urvals markörer måste först återupplivas på BG11 agar plattor utan antibiotika och sedan restreaked på BG11 agar plattor med lämplig antibiotika.

4. Promotorns karaktärisering

Anmärkning: Här beskrivs en standardmetod för att analysera styrkan hos en promotor del genom att mäta uttrycksnivåerna för en fluorescerande markör (eYFP) efter en tillväxtperiod på 72 h med antingen en Plattläsare eller en flödescytometer12.

  1. Kultur tillväxt
    1. Inrätta frö kulturer genom att vaccinera 10 mL BG11 medium som innehåller lämpliga antibiotika med en enda koloni av den transgena cyanobakteriala stammen som bär den fluorescerande markör uttrycks kassetten. Också förbereda frö kulturer för lämpliga negativa kontroll stammar (t. ex. en vild typ stam och/eller en transgen stam som bär samma vektor stamnät men saknar fluorescerande markör uttrycks kassett).
      Anmärkning: minst fyra biologiska replikat rekommenderas.
    2. Odla frö kulturer för 48 h eller tills OD750 = 1 − 1.5 under tillväxtförhållanden som är lämpliga för arten stammen.
    3. För att spåra Promotorns uttryck över tid, först mäta OD750 för varje frö kultur. Beräkna utspädnings kraven för att föra varje kultur till en start OD750 = 0,2. Ställ in utspädda experiment kultur prov (2 mL total volym) i en platt-botten 24-brunn tallrik (tabell över material).
    4. Inkubera plattan i en skakande inkubator med vita LED-lampor (tabell över material) under lämpliga tillväxtförhållanden. Mät kulturens tillväxt täthet (OD750) och förbättrad fluorescens i gult fluorescerande protein (eyfp) med antingen en Plattläsare (avsnitt 4,2) eller en flödescytometer (avsnitt 4,3).
      Obs: Synechocystis pcc 6803 och S. elongatus utex 2973 kulturer kan odlas som i steg 3.1.2. Det rekommenderas starkt att plattan hålls under hög luftfuktighet (95%) för att undvika avdunstning av kulturproverna.
  2. Skylt läsare
    1. Blanda snabbt in kulturerna i 24-brunnen plattan (steg 4.1.4) med skonsam pipettering. Överför ett delprov av varje kultur till en svart platt-botten 96-brunn plattan (tabell över material). Späd vid behov (100 μL slutlig volym). Undvik bildandet av bubblor eftersom detta kan störa mätnoggrannheten.
      Anmärkning: det rekommenderas att alla mätningar utförs på prover i ett OD750 -intervall på 0,2 − 1,0. Eftersom tätheten av kulturerna i 24-brunnen kommer att öka med tiden, är följande utspädningar rekommenderas baserat på de förväntade ökningar i standard tillväxtvillkor: ingen utspädning vid 0 h, 1:4 vid 24 h, 1:10 vid 48 h och 1:10 vid 72 h. Så till exempel, vid 24 h skörd 25 μL av kulturen och blanda med 75 μL av BG11 medium.
    2. Inkludera två blanka brunnar i 96-brunnsplattan (d.v.s. 100 μL BG11 medium). Sätt 96-brunnen plattan i en tallrik läsare (tabell över material). Skaka plattan för 60 s vid 500 rpm med hjälp av orbitalshakern i plattläsaren för att blanda brunnarna.
      Obs: cyanobakteriella kulturer kan aggregera och/eller flocculate, så bra blandning är kritisk före läsning för noggranna mätningar.
    3. Mät OD750 och eyfp fluorescens med excitation/emissions våglängder vid 485 nm/520 Nm.
    4. Subtrahera medelvärdet av OD750 -mätningarna av de två tomma brunnarna från OD750 -mätningen för varje prov brunn som innehåller cyanobakterier-kultur.
    5. Normalisera fluorescensvärdena för varje kultur prov genom att dividera eYFP-fluorescensmätningen (steg 4.2.3) med kulturens justerade OD750 (steg 4.2.4). Subtrahera sedan det genomsnittliga normaliserade eyfp-fluorescensvärdet (eyfp fluorescens/OD750) av de biologiska replikaterna av en lämplig negativ kontroll stam från de transgena stammar som bär eyfp Expression-kassetten.
      Anmärkning: cyanobakterier fluorescerar naturligt på grund av förekomst av pigment, såsom klorofyll och phycobiliproteiner.
    6. Plotta kultur tillväxt över tid (figur 6a) och de genomsnittliga normaliserade eyfp-fluorescensvärdena för varje experimentell kultur vid önskade tidpunkter (t. ex. 72 h; Figur 6B).
  3. Flödescytometer
    1. Välj en kompatibel plåt för flödescytometerns vätskehanteringssystem. Till exempel, Använd en rund-botten 96-brunn plattan (tabell över material) med flödescytometern (tabell över material) som används i detta protokoll.
    2. Blanda snabbt in kulturerna i 24-brunnen plattan (steg 4.1.4) med skonsam pipettering. Späd kulturer till OD750 = 0,1 − 0,2 för att undvika blockeringar av munstycken i vätskehanterings systemet. Tillsätt en lämplig mängd odlingsprov till 96-brunn-plattan och ta till en slutlig volym på 250 μL med filtersteriliserad 1x fosfatbuffrad saltlösning (PBS). Inkludera en blank brunn för medel lösningen på plattan som innehåller 60 μL BG11 och 190 μL 1x PBS.
      Obs: denna volym rekommenderas om det finns ett behov av att köra om prover. Volymer som är högre än 250 μL rekommenderas inte eftersom den maximala volymen för varje brunn är 300 μL.
    3. När flödescytometern är klar för användning, placera 96-brunnen plattan med odlingsprov i vätskehanterings stationen. Ställ in programvaru protokollet för flödescytometern för att samla in mätningarna av 10 000 enskilda händelser (t. ex. celler). Mät eYFP fluorescens med excitation/emissions våglängder på 488 nm/515 − 545 nm. Först mäta och kontrollera läsning från den tomma brunnen (figur 7A), kör sedan proverna.
    4. Försätta populationen av cyanobakterier i de främre och sido scatterdata uppsättningarna, med undantag för regioner som är vanliga med blind läsningen (figur 7B). Subtrahera de genomsnittliga eYFP-fluorescensvärdena för de biologiska replikaterna av en lämplig negativ kontroll stam från de transgena stammar som bär eYFP-uttryckskassetten (figur 7C, D). Rita medelvärdet av median fluorescensvärdena per cell för varje experimentell kultur vid önskade tidpunkter (t. ex. 72 h; Figur 7E).

5. genomisk DNA-extraktion från cyanobakterier

Anmärkning: i protokollet nedan används en kommersiell DNA-extraktion Kit (tabell över material).

  1. Odla en cyanobakteriell flytande kultur i BG11 (som beskrivs i avsnitt 3,1) tills OD750 = 1,5 − 3,0. Snurra ner 10 mL kultur på 3 000 x g i 10 min och Kassera supernatanten. Frys in pelleten genom att inkuberas rören vid-20 ° c i 30 min.
  2. Tillsätt 400 μl lyseringsbuffert (buffert AP1) och 400 μl av ribonukleas-lösningen (RNase A) och 50% (w/v) av glaspärlor (0,5 mm i diameter). Störa prover med en pärlkvarn (tabell över material) vid 30 Hz (dvs. motsvarande 1 800 oscillationer/min) i 6 min.
  3. Snurra provet på 17 000 x g i 5 min och försiktigt överföra supernatanten till ett nytt rör och kassera pelleten. Fortsätt enligt tillverkarens anvisningar (tabell över material).

6. agaros gel elektrofores

  1. Kasta en 1% (w/v) aguppstod gel som innehåller 0,02% (v/v) etidiumbromid bromid. Lastprover och en lämplig referens för DNA-stege.
  2. Kör proverna för 50 min vid 125 V. Kontrollera för band separation på en ultraviolett (UV) transilluminator.
    Obs: körtid och aguppstod gel procent kan ändras för att passa den förväntade band storleken. Till exempel kan en högre andel aguppkom gel och längre körtid förbättra bandet upplösning och separation av DNA-produkter < 500 BP.

7. koloni PCR

  1. Ställ in en PCR-reaktionsblandning med ett standard kit (tabell över material) och en lämplig kombination av primers (t. ex. grundfärger som flanerar sammansättnings regionen eller är specifika för sekvenser inom sammansättnings regionen (tabell 3). Pipettera över 10 μL till ett PCR-rör.
  2. Vidrör försiktigt toppen av en enda vit koloni med en steril tandpetare eller 10 μL pipettspets och Inokulera ett PCR-rör som innehåller PCR-reaktionsblandning. Var noga med att markera kolonin och matcha med det specifika PCR-röret. Rör försiktigt reaktionsblandningen så att E. coli -cellerna fälls in i lösningen.
  3. Amplify produkter med PCR. Använd ett program som består av ett initialt denatureringssteg på 95 ° c för 60 s, 30 omgångar på 95 ° c för 15 s, 58 ° c för 15 s (några grader under Tm -värdena för primers), 72 ° c för 30 s (30 s/KB av insatsen) , följt av en slutlig förlängnings steg på 72 ° c i 5 min.

8. beredning av BG11 medium och plattor

  1. Bered stamlösningar av 100x BG11 medium, järn (ammoniumjärncitrat), spårämnen, fosfat (K2HPO4), na2Co3 och tes-buffert enligt Lea-Smith et al.11. Autoklav fosfat och na2Co3 bestånd. Använd 0,2 μm filter för att filtrera sterilisera TES buffert (pH 8,2) och NaHCO3 lagerlösningar.
  2. Förbered 1 L BG11 medium. Blanda 10 mL 100x BG11, 1 mL spårämnen och 1 mL järnstock och autoklav lösningen med 976 mL vatten. När lösningen har svalnat till RT, tillsätt 1 mL fosfat buljong, 1 mL na2Co3 -lager och 10 ml NaHCO3, och justera till pH 7.6 − 7.8 med 1 M HCl.
  3. LB-BG11 agar plattor (1,5% [w/v])
    1. Kombinera 700 mL avjoniserat vatten och 15 g agar i en glaskolv. Tillsätt 186 mL vatten i en andra kolv, 10 mL 100x BG11, 1 mL spårämnen och 1 mL järnstock. Autoklav båda lösningarna.
    2. När lösningarna har svalnat ner till runt 60 ° c, kombinera dem och tillsätt 1 mL fosfat lager, 1 mL na2Co3 -lager, 10 ml NaHCO3 -lager och 50 ml lb sterilt medium, vilket bör ge en slutlig volym på 1 L. gjutna petriskålar med 25 mL LB-BG11 agar medium.
  4. BG11 + Kan50-agar plattor (1,5% [w/v])
    1. Kombinera 700 mL avjoniserat vatten och 15 g agar i en glaskolv. Tillsätt 3 g natriumtiosulfat (na2S2O3) i en andra kolv, 226 ml vatten, 10 mL 100x BG11, 1 ml spårämnen och 1 ml järnstock. Autoklav båda lösningarna.
    2. När lösningarna har svalnat ner till runt 60 ° c, kombinera dem och tillsätt 1 mL fosfat lager, 1 mL na2Co3 -lager, 10 ml tes buffertlager och 10 ml NaHCO3 -lager, vilket bör ge en slutlig volym på 1 L. Tillsätt kanamycinsulfat till en slutlig koncentration av 50 μg/mL och gjutna petriskålar med 35 mL medium.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

För att demonstrera monterings arbetsflödet för Golden Gate, samlades en uttrycks kassett i nivå 1 position 1 (forward) acceptor Vector (pICH47732) som innehåller följande nivå 0-delar: promotorn för C-phycocyanin operon Pcpc560 (PC 0,005), kodningen sekvens för eYFP (pC 0.008) och dubbla Terminator TrrnB (PC 0.082)12. Efter omvandlingen av församlingen reaktionen identifierades framgångsrika sammansättningar med hjälp av standard blå-vit screening av E. coli kolonier (figur 3). EYFP Expression-kassetten i nivå 1-vektorn och end-Link 1-vektorn (pICH50872) samlades sedan in i en level T acceptor Vector (pPMQAK1-T) för att ge vektorn Cpcba-Eyfp (figur 4a). Den sammansatta Cpcba-eyfp-vektorn kontrollerades genom begränsning av matsmältningen (figur 4B).

Lyckad konjugal överföring av Cpcba-eyfp eller den tomma PPMQAK1-T-vektorn (dvs. en negativ kontroll som saknade eyfp-uttryckskassetten) resulterade i att upp till flera hundra kolonier på membranet för Synechocystis PCC 6803 och S. elongatus utex 2973 efter 7 − 14 dagar respektive 3 − 7 dagar (figur 5). Enskilda kolonier plockades och strimlade på färska BG11 + Kan50 agar plattor; 2 − 3 re-strimmor krävdes för att generera axeniska kulturer.

Som förväntat för den starka Pcpc560 -promotorn51var värdena för normaliserad eyfp-fluorescens från plattläsaren och eyfp-fluorescensen per cell från flödescytometern höga jämfört med den negativa kontrollen (figur 6 och Figur 7). Fluorescensvärden var högre i S. elongatus utex 2973 än i Synechocystis PCC 680312.

Figure 1
Figur 1: översikt över monteringsprocessen för Golden Gate i Cyanogat. Montering av en gen uttrycks kassett visas, med början från amplifiering av en sekvens av intresse från mall-DNA till montering i en nivå T vektor (delar inte dras till skalan). (A) utformning av framåtriktade och omvända primers för förstärkning av en CDS1 del från mall-DNA (t. ex. genomiskt eller PLASMID DNA). Platserna för BpiI-restriktionsplatser och överhäng som krävs för insättning i acceptorvektorn (d.v.s. 5 ′ och 3 ′ i mallsekvensen) markeras i rött respektive blått. Bokstaven "n" betecknar att alla NT kan användas på denna position. Glödgningregionerna av primersen med DNA-mallen och deras rekommenderade smälta temperaturer (Tm) indikeras. B) nivå 0-montering av PCR-produkten i nivå 0 CDS1 acceptor Vector pICH41308. Sekvensen som kommer att exciseras av bpii och och ligaturer i acceptor vektorn är markerad i blått. (C) nivå 1-montering av en gen uttrycks kassett som innehåller tre nivå 0-delar (Pro + 5U, CDS1 och 3U + ter) i nivå 1 position 1 (forward) acceptor Vector PICH47732 med bsai. D) nivå t-montering av nivå 1-enheten och end-Link 1 (pICH50872, kallad "Level M end-Link 1" i Engler et al.15) till en level t acceptor-vektor (t. ex. pPMQAK1-t) med bpii. Eden slutliga sammansatta nivå T-vektorn. Förkortningar: AmpR, ampicillin motstånd kassett; CarbR, carbenicillin motstånd kassett; CDS1, kodning sekvens i nivå 0 syntax15; EL1, End-Link 1 del; KanR, kanamycin motstånd kassett; Laczα, β-galaktosidas uttrycks kassett; Specr, Spektinomycin motstånd kassett. Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Bild 2: en PCR-baserad domesticering strategi för borttagning av en olaglig typ IIS begränsning webbplats. (A) Schematiskt diagram som visar två primer-par (i grönt respektive orange) för att modifiera en bpii-webbplats (gaagac) till gaggac i en PROTEINKODNINGSDNA-sekvens avsedd för montering i CDS1 Level 0 acceptor Vector (pICH41308). Observera att modifiering bevarar kodon för glutaminsyra (GLU) (dvs GAA till GAG). Även om BpiI webbplatsen visas i ram med start Codon, denna metod kommer att fungera även om webbplatsen inte är i RAM (dvs, så länge webbplatsen störs, och proteinsekvensen bevaras). Platserna för BpiI-restriktionsplatser och överhäng i primers markeras i rött respektive blått. DNA-mallen och den översatta proteinsekvensen markeras i gult. Glödgningregionerna av primersen med DNA-mallen och deras rekommenderade smälta temperaturer (Tm) indikeras. Den orange paret används för att förstärka 5 ′ slutet av sekvensen med överhäng AATG och TGAA (fragment 1), medan den gröna paret används för att förstärka 3 ′ med överhäng TGAA och GCTT (fragment 2). Innan du beställer primers, trohet av TGAA fusion överhäng för fragment 1 och 2 var noggrant kontrolleras52. Dåligt utformade fusion överhäng kan leda till sammansättnings fel (dvs. inga kolonier efter omvandling; Figur 5) eller falska positiva identifieringar (t. ex. trunkerade eller felaktiga sammansättningar). Den senare kan lösas vara screening ett större antal vita kolonier för att identifiera en korrekt monterad konstruktion. (B) amplicons av fragment 1 och 2 efter begränsning med bpii under Golden Gate församling. Cden domesticerade sekvensen monterad i nivå 0 CDS1 acceptor Vector. Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: blå-vit koloni screening av E. coli transformanter efter Golden Gate församling. Plattorna som visas innehåller LB-agar (1% [w/v]) kompletterad med X-gal, IPTG och antibiotika vid lämpliga koncentrationer. A) inga kolonier, vilket tyder på en misslyckad sammansättnings reaktion och/eller E. coli -omvandling. (B) mestadels blå kolonier, vilket indikerar en lyckad montering, men att verkningsgraden hos restriktionsenzymen som används i monterings reaktionen var låg. Cmestadels vita kolonier, vilket tyder på en typisk lyckad monterings reaktion. D) inga blå kolonier, vilket indikerar en mycket effektiv montering. Vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: verifiering av en sammansatt nivå T-vektor genom begränsning av matsmältningen. Vektorerna smältes med HindIII och BamHI. (A) sekvenskarta över tom PPMQAK1-T acceptor Vector (CT. 0) och Level T Assembly (cpcba-eyfp) som visar komponenterna i eyfp Expression-kassetten (PCpc560-eyfp-trrnB). Positionerna för restriktionssajterna för HindIII och BamHI anges. Efter dubbel rötning anges de förväntade storlekarna av DNA-fragment: (1) 5 847 BP, (2) 2 004 BP, (3) 30 BP, (4) 374 BP, (5) 1 820 BP, (6) 1 289 BP, och (7) 156 bp. (B) en aguppstod gel (0,8% [w/v]) körs vid 125 v för 60 min laddad med smält nivå T församling (Cpcba-eyfp) visar banden 1, 5 och 6, den smälta tomma PPMQAK1-T acceptor VEKTOR (CT. 0) visar band 1 och 2 och en DNA-stege (tabell över material). Observera att banden 3, 4 och 7 var för små för att visualisera på gelen. Vänligen klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: tillväxt av transgena Synechocystis pcc 6803 kolonier efter lyckad konjugering. Exempel på membran efter inkubering på BG11 + Kan50-agarplattor visas. (A) överväxt efter mycket effektiv konjugering-den Synechocystis PCC 6803 kolonier har utvecklats till en gräsmatta utan enskilda kolonier. Ben god konjugering som visar flera hundra enskilda kolonier efter 12 dagar. (C) tillväxt av en axenisk stam efter 14 dagar efter flera omgångar av ny Streaking på en färsk BG11 + Kan50 agar plattan. Avsaknad av bakteriell kontamination indikerade att Synechocystis pcc 6803 transkonjugant var axenic. Vänligen klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: representativ tillväxtdata och normaliserade eYFP-fluorescensvärden med hjälp av en Plattläsare. A) tillväxt jämförelse av stammar som transporterar cpcba-eyfp eller den tomma pPMQAK1-T-vektorn (CT. 0, negativ kontroll) i synechocystis PCC 6803 och S. elongatus utex 2973. Värden är medel ± SE från fyra biologiska replikat. Synechocystis PCC 6803 och S. elongatus utex 2973 var odlade för 72 h vid 30 ° c med kontinuerligt ljus (100 μmol fotoner m-2S-1) och 40 ° c med 300 μmol fotoner m-2S-1, respektive. (B) normaliserade eyfp-fluorescensvärden för Synechocystis PCC 6803 eller S. elongatus Utex 2973 konjugerat med cpcba-eyfp vid 72 h. värden är medel ± se från fyra biologiska replikat. Vänligen klicka här för att se en större version av denna siffra.

Figure 7
Figur 7: representativa eYFP-fluorescensvärden med hjälp av en flödescytometer. (A) vidarebefordra (FSC-h) och Side (SSC-h) spridningsdiagram från den "tomma" medel lösningen (BG11 och PBS). (B) spridningsdiagram för en Synechocystis PCC 6803 prov (höger). Cirkeln anger den valda regionen som tar upp populationen av cyanobakterier från återstoden av prov signalen. (C) histogram över den gated regionen för en stam som transporterar den tomma PPMQAK1-T VEKTOR (CT. 0, negativ kontroll). (D) histogram över den gated regionen för en stam som transporterar cpcba-eyfp. (E) eyfp-fluorescensvärden per cell i Synechocystis PCC 6803 och S. elongatus Utex 2973 vid 72 h. fluorescens från den negativa kontrollen har subtraherats. Värden är medel ± SE från fyra biologiska replikat. Vänligen klicka här för att se en större version av denna siffra.

Nej. Vektor-ID Namn Beskrivning 5 överhänget 3 överhänget
1 pICH41233 Pro Promotorn GGAG Takt
2 pICH41295 Pro + 5U Promotorn och 5 ˈ unöversatt region GGAG AATG
3 pAGM1251 Pro + 5U (f) Promotorn och 5 ˈ oöversatt sekvens för N Terminal fusioner GGAG CCAT
4 pICH41246 5u 5 ˈ oöversatt region Takt CCAT
5 pAGM1263 5U (f) 5 ′ oöversatt sekvens för N Terminal fusioner Takt CCAT
6 pICH41246 5U + NT1 5 ˈ oöversatt region och N slutligt kodifiera region Takt CCAT
7 pAGM1276 NT1 N terminaltagg eller lokaliserings signal CCAT AATG
8 pICH41258 Sp Signal peptid AATG AGGT
9 pICH41258 NT2 N terminaltagg eller lokaliserings signal AATG AGGT
10 pAGM1287 CDS1 ns Kodning region utan stopp kodon AATG TTCG
11 pICH41308 CDS1 Stop Kodning region med stopp kodon AATG GCTT
12 pAGM1299 CDS2 ns Kodning region-utan start och stopp kodon AGGT TTCG
13 pICH41264 CDS2 Stop Kodning region-utan start och med stopp kodon AGGT GCTT
14 pAGM1301 Ct C terminaltagg eller lokaliserings signal TTCG GCTT
15 pICH53388 3u 3 ˈ oöversatt region GCTT GGTA
16 pICH53399 Ter Terminator GGTA CGCT
17 pICH41276 3U + ter 3 ˈ oöversatt region och Terminator GCTT CGCT
18 pICH41331 Cgm Acceptor för kompletta gen kassetter GGAG CGCT
19 pCA 0,002 Pro (låg kopia) Promotorn, låg kopienummer acceptor (pSC101 Ori) GGAG Takt
20 pCA 0,001 Pro TSS Promotor trunkerad till avskrift startplats GGAG TAGC
21 Direkt till nivå 1 srRNA Små regulatoriska RNA (för translationell ljuddämpning) TAGC GTTT
22 Direkt till nivå 1 sgRNA Single guide RNA (för CRISPRi) TAGC GTTT
23 pICH41295 UPP FLANK Flanking sekvens uppströms mål homolog rekombination plats GGAG AATG
24 pICH41276 NED FLANK Flankning sekvens nedströms mål homolog rekombination plats GCTT CGCT

Tabell 1: en lista över tillgängliga vektorer för nivå 0-acceptor och överhäng. Vektorer 1 − 18 är från växten MoClo kit15. Vektorer 19 − 22 är från CyanoGate kit12. För srRNA och sgRNA delar, syntetiserade sekvenser eller PCR-produkter monteras direkt i nivå 1 acceptor vektorer. Vektorer 23 − 24 är från växten MoClo kit som har åter avsikt för omvandling av homolog rekombination med hjälp av Cyanogat kit.

Monteringskomponenter för BpiI (nivå 0, T) Monteringsdetaljer för BsaI (nivå 1)
50 − 100 ng av den acceptor vektorn 50 − 100 ng av den acceptor vektorn
För varje vektor/del att infoga, Använd en 2:1 förhållandet mellan INSERT: acceptor Vector. För varje vektor/del att infoga, Använd en 2:1 förhållandet mellan INSERT: acceptor Vector.
2 μL 10 mM ATP (tabell över material) 2 μL 10 mM ATP (tabell över material)
2 μL buffert G (buffert för BpiI/BsaI) 2 μL buffert G (buffert för BpiI/BsaI)
2 μL BSA (10X) (tabell över material) 2 μL BSA (10X) (tabell över material)
10 enheter BpiI (1 μL10 U/μL BpiI, tabell över material) 10 enheter BsaI (1 μL 10 U/μL BsaI, tabell över material)
Ta till 20 μL med dH2O. Ta till 20 μL med dH2O.
200 enheter T4 DNA Ligas (1 μL 200 U/μL, tabell över material) 200 enheter T4 DNA Ligas (1 μL 200 U/μL, tabell över material)
ThermoCycler Protocol (nivå 0, T) ThermoCycler Protocol (nivå 1)
37 ° c i 10 min cykel x 5 37 ° c i 10 min cykel x 5
16 ° c i 10 min 16 ° c i 10 min
37 ° c i 20 min 37 ° c i 20 min
65 ° c i 10 min 65 ° c i 10 min
16 ° c (håll) 16 ° c (håll)

Tabell 2: protokoll för Golden Gate-enheter i nivå 0, 1 och T. Montering i nivå 0 och nivå T acceptor vektorer använder begränsnings enzym BpiI (vänster). Montering i nivå 1-acceptorvektorer använder begränsnings enzym BsaI (höger). Denna tabell har anpassats från Vasudevan et al.12.

Primer nej. Sekvens (5 '-3 ') Längd (BP) Beskrivning
L0T framåt Mer från GTCTCATGAGCGGATACATA
TTTGAATG
28 För amplifiering från nivå 0 och nivå T
L1 Reverse GAACCCTGTGGTTGGCATGC
ACATAC
26 För amplifiering från nivå 1
L1 framåt CTGGTGGCAGGATATATTGT
GGTG
24 För amplifiering från nivå 1
L0T omvänd TTGAGTGAGCTGATACCGCT 20 För amplifiering från nivå 0 och nivå T

Tabell 3: lista över primers för PCR-validering eller sekvensering av nivå 0,1 och T vektorer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Golden Gate Assembly har flera fördelar jämfört med andra vektor monteringsmetoder, särskilt när det gäller skalbarhet20,21. Ändå kräver inrättandet av Golden Gate-systemet i ett labb tid för att utveckla en förtrogenhet med de olika delarna och acceptor vektor bibliotek och övergripande monteringsprocesser. Noggrann planering behövs ofta för mer komplexa sammansättningar eller när man utför ett stort antal komplexa sammansättningar parallellt (t. ex. att göra en svit av nivå T vektorer som innehåller flera gen uttrycks kassetter). Vi rekommenderar att du först listar alla kombinationer av gen uttrycks kassett som krävs och sedan kartlägger arbetsflödet från nivå 0 till nivå T i silico. Under denna process, användare bör överväga nivå 1 "dummy" delar tillgängliga i anläggningen MoClo kit som möjliggör montering av icke-sekventiella nivå 1 vektorer i nivå T (t. ex. nivå 1 position 1 och position 3 vektorer kan monteras tillsammans med "dummy" del Nivå 1 position 2), vilket kan minska det totala antalet monterings reaktioner och klonings steg som krävs15.

DNA-syntes är typiskt den enklaste metoden för att bygga nya nivå 0-delar. Men när kloning krävs (t. ex. från plasmider eller genomiskt DNA) är det viktigt att optimera utformningen av de primers som används för förstärkning för att maximera effektiviteten i efterföljande nivå 0 vektor montering. De två mest kritiska stegen i primer design är: 1) Kontrollera att rätt överhäng ingår och är i lämplig orientering för framåt och bakåt primers (figur 1 och tabell 1), och 2) se till att längden på primer sekvens som anneals till mallen är tillräckligt lång (18 − 30 BP) och att Tm -värdet för denna sekvens (helst 58 − 62 ° c) är liknande för primerparet (figur 1A). Om en sekvens kräver domesticering, är flera strategier tillgängliga. För korta sekvenser (t. ex., < 200 BP), ett par långa framåt och omvänd primers kan utformas i vilken 3 ′ slutar glöden till varandra (dvs. en överlappning av > 20 BP) och bildar en dubbel strandad sekvens efter amplifiering. För längre sekvenser kan separata fragment av sekvensen förstärkas som tar bort olagliga restriktioner platser och sedan monteras med hjälp av en Golden Gate församling tillvägagångssätt (figur 2). Om monteringen effektivitet med PCR-produkter är dålig, enskilda fragment av en nivå 0 sekvens kan klonas i nivå 1 Universal acceptor Vector (pAGM1311), validerade, och sedan monteras ihop till lämplig nivå 0 acceptor Vector15. En 2:1 Infoga: acceptor vektor molar förhållandet rekommenderas för effektiv Golden Gate församling. Men för sammansättningar av endast 2-3 vektorer (t. ex. två nivå 0 delar och en nivå 1 acceptor vektor), kombinerar ~ 100 ng av varje regelbundet vanligtvis resulterar i framgångsrika församlingar. Effektiviteten av församlingar tenderar att minska eftersom antalet vektorer som används per reaktion ökar, vilket resulterar i en minskning av det totala antalet vita kolonier efter omvandling (figur 3).

Före konjugering rekommenderas validering av slutförda nivå-T-vektorer genom begränsnings sammandrag och PCR. Conjugal DNA Transfer är en väl etablerat teknik för cyanobakterial stammar, inklusive de som inte är naturligt transformerbara41,45. Viktiga steg i konjugation protokollet inkluderar: 1) noggrann hantering av hjälparen E. coli stam efter natten tillväxt (t. ex. undvika vortexing)35, 2) noga med att helt ta bort spår av antibiotika som används för att odla hjälpare och laster E. coli -stammar, 3) en lämplig inkubationstid för blandningen av last och hjälp stammar och cyanobakterier (t. ex. en längre inkubationstid var kritisk för S. elongatus utex 2973), och 4) den initiala överföringsperioden för cellen blandning på membran i LB-BG11 agar plattor som saknar antibiotika för 24 h.

Isolerade cyanobakteriala kolonier bör utvecklas på membranet inom två veckor för Synechocystis pcc 6803 och S. elongatus utex 2973, annars är det troligt att konjugering har misslyckats. Flera ändringar av protokollet kan sedan testas, inklusive 1) med hjälp av en cyanobakterial kultur med högre start täthet (t. ex. OD750 = 1.5 − 2). 2) öka inkubationstiden innan överföring till membranet; och 3) förlänga den initiala inkubationstiden på membranet från 24 h till 48 h (dvs., för att ge mer tid för uttrycket av antibiotikaresistens genen på den överförda vektorn). Om konjugering fortfarande misslyckas, alternativa metoder såsom elektroporation kan prövas53. Att bekräfta en transgen cyanobakterial stam är axenic är viktigt innan ytterligare experiment. Slutligen är det god praxis att bekräfta storleken på den heterologösa vektorn i den transgena cyanobakteriella stammen. Den senare kräver DNA-extraktion (avsnitt 5), omvandling till E. coli och selektion (avsnitt 2,1) och vektor validering (avsnitt 2,4).

Det beskrivna Promotorns karakteriseringsprotokoll använder små kultur volymer (d.v.s. 2 mL) som ett sätt att uppnå en screening metodik med hög genomflöde. Större volymer kan användas beroende på photobioreactor utrymme tillgängliga, vilket skulle bidra till att mildra kulturen avdunstning frågor. Om hög genomströmning screening med små odlings volymer krävs, är det viktigt att ha hög luftfuktighet i tillväxt kammaren för att hämma avdunstning. Avdunstning under ett tillväxt experiment kan vara skadligt för noggrannheten och giltigheten av prov mätningar. Kontrollera kultur volymer under och efter experimentet för att bekräfta hur mycket avdunstning har inträffat.

För mätningar av Plattläsare är det viktigt att mäta kulturer vid låga densiteter, helst OD750 < 1, för att säkerställa förvärvet av tillförlitlig och reproducerbar tillväxt-och fluorescensdata. Ett linjärt förhållande mellan cell nummer och OD750 observeras endast inom ett specifikt intervall54. För att fastställa detta intervall rekommenderar vi att du utför en seriell utspädning (t. ex. från OD750 = 0,1 − 1,0) med en känd Transformant där eyfp fluorescens har bekräftats. Plottning av absolut fluorescens mot normaliserad fluorescens (eyfp fluorescens/OD750) hjälper till att identifiera det linjära arbetsområdet för kultur tätheter. Flera Plattläsare inkluderar en "Gain"-funktion för att modifiera fluorescensdetektorns känslighet. I det här fallet bör Gain-värdet ställas in på en lämplig nivå innan experimentet påbörjas och inte ändras mellan olika experimentella körningar eller så kommer data inte att vara direkt jämförbara.

Även om driften av olika flödescytometrar varierar mellan tillverkarna är det viktigt att ta en blind avläsning av den medelstora lösningen för att underlätta identifieringen och gating av målet cyanobakterial population från alla bakgrunds signaler i mediet (figur 7A, B). Efter detta, subtraktion av fluorescensvärdet av det negativa kontrollprovet (t. ex. en vild typ stam) kommer att bidra till att ta bort infödda autofluorescence (figur 7C, D). Den Fotomultiplikator Tube (PMT) spännings parametern i en flödescytometer har en liknande funktion till förstärkningen i en Plattläsare, dvs öka eller minska känsligheten hos detektorn till intensiteten av fluorescenssignalen. Som med plattläsaren bör PMT-spänningen ställas in på en lämplig nivå innan experimentet55påbörjas. När värdet är inställt bör PMT-spänningsvärdet bibehållas mellan olika experimentella körningar eller så kommer uppgifterna inte att vara direkt jämförbara.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Författarna är tacksamma för PHYCONET bioteknik och biologisk vetenskap forskningsrådet (BBSRC) nätverk inom industriell bioteknik och bioenergi (NIBB) och Industrial Biotechnology innovation Centre (IBioIC) för ekonomiskt stöd. GARG, AASO och AP erkänner finansiering stöd från BBSRC EASTBIO fall PhD program (Grant Number BB/M010996/1), den Consejo Nacional de Ciencia y Tecnología (CONACYT) doktorandprogrammet, och IBioIC-BBSRC Collaborative Training Partnership (CTP) doktorandprogrammet, Respektive. Vi tackar Conrad Mullineaux (Queen Mary University of London), och Poul Eric Jensen och Julie Anne Marie Zita Zedler (Köpenhamns universitet) för plasmid Vector och protokoll bidrag och råd.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
Genetisk modifiering av cyanobakterier genom konjugering med hjälp av den modulbaserade klonings verktygslådan Cyanogat
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter