Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

تطبيق نظام حفّال ميكانيكي أحادي الأبعاد أحادي الأبعاد للتحفيز الحيوي للحث على التمايز التنوجيني للخلايا الجذعية المشتقة من الأوتار

doi: 10.3791/61278 Published: August 1, 2020
* These authors contributed equally

Summary

نظام ثلاثي الأبعاد للتحفيز الميكانيكي أحادي الأبعاد هو مفاعل حيوي مثالي للتمايز التنغيم الخاص بالخلايا الجذعية المشتقة من الأوتار وتكوين الأوتار الجديد.

Abstract

اعتلال التناد هو مرض شائع من أمراض الوتر المزمن المتعلقة بالالتهاب والانحطاط في منطقة تقويم العظام. مع ارتفاع معدلات المراضة، والقدرة على إصلاح الذات محدودة، والأهم من ذلك، لا علاجات نهائية، اعتلال الأوتار لا يزال يؤثر على نوعية حياة المرضى سلبا. الخلايا الجذعية المشتقة من الأوتار (TDSCs) ، كخلايا أولية أولية من خلايا الأوتار ، تلعب دورًا أساسيًا في تطور اعتلال الأوتار ، والاستعادة الوظيفية والهيكلية بعد اعتلال الأوتار. وهكذا، فإن الطريقة التي يمكن في المختبر تقليد التمايز في الجسم الحي من TDSCs في خلايا الأوتار سيكون من المفيد. هنا، يصف هذا البروتوكول طريقة تستند إلى نظام تمدد أحادي الأبعاد ثلاثي الأبعاد (3D) لتحفيز TDSCs على التفريق في أنسجة تشبه الأوتار. هناك سبع مراحل من البروتوكول الحالي: عزل ماوس TDSCs, ثقافة وتوسع فئران TDSCs, إعداد الحفز ثقافة المتوسطة لتشكيل ورقة الخلية, تشكيل ورقة الخلية عن طريق زراعة في التحفيز المتوسطة, إعداد 3D وتر الخلايا الجذعية بناء, تجميع مجمع التحفيز الميكانيكية أحادية التمدد, وتقييم الميكانيكية حفز في النسيج مثل وتر فيترو. وقد أثبتت الأنسجة فعالية. تستغرق العملية بأكملها أقل من 3 أسابيع. لتعزيز ترسب المصفوفة خارج الخلية، تم استخدام 4.4 ملغ/مل حمض الاسكوربيك في المحفزات المتوسطة الثقافة. غرفة منفصلة مع محرك خطي يوفر دقة التحميل الميكانيكية وقابل للنقل وتعديلها بسهولة، والتي يتم تطبيقها على مفاعل حيوي. وكان نظام التحميل في هذا البروتوكول 6٪ سلالة، 0.25 هرتز، 8 ساعة، تليها 16 ساعة من الراحة لمدة 6 أيام. يمكن أن يحاكي هذا البروتوكول تمايز الخلايا في الوتر ، وهو مفيد للتحقيق في العملية المرضية لاعتلال الوتر. وعلاوة على ذلك، يمكن أن تستخدم الأنسجة الشبيهة بالوتر لتعزيز شفاء الأوتار في إصابة الأوتار ككسب غير مشروع ذاتي هندسي. وخلاصة القول إن هذا البروتوكول بسيط واقتصادي ويمكن استنساخه وصحته.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

اعتلال التتناد هو واحد من الإصابات الرياضية الشائعة. ويتجلى ذلك أساسا من الألم, تورم المحلية, انخفاض التوتر العضلي في المنطقة المصابة, والخلل الوظيفي. الإصابة باعتلال الوتار عالية. وجود اعتلال الأوتار أخيل هو الأكثر شيوعا للعدائين المسافات المتوسطة والطويلة (تصل إلى 29٪)، في حين أن وجود اعتلال الأوتار الرضفة أيضا عالية في الرياضيين من الكرة الطائرة (45٪)، وكرة السلة (32٪)، والمضمار والميدان (23٪)، وكرة اليد (15٪)، وكرة القدم (13٪),,,,5. ومع ذلك ، بسبب قدرة محدودة على الشفاء الذاتي من وتر ، وعدم وجود علاجات فعالة ، والاعتلال لا يزال يؤثر على حياة المرضى سلبا6،7. وعلاوة على ذلك، لا يزال من غير الواضح التسبب في اعتلال التناد. كانت هناك العديد من التحقيقات حول مسببات المرض ، بما في ذلك أساسا "نظرية الالتهاب" ، "نظرية الانحطاط" ، "نظرية الإفراط في الاستخدام" ، وهكذا4. في الوقت الحاضر، يعتقد العديد من الباحثين أن اعتلال الأوتار كان بسبب فشل الإصلاح الذاتي للإصابات الدقيقة الناجمة عن التحميل الميكانيكي المفرط لتجارب وتر9،10.

الخلايا الجذعية المشتقة من الأوتار (TDSCs) ، كخلايا أولية لخلايا الأوتار ، تلعب دورًا أساسيًا في تطوير اعتلال الأوتار والاستعادة الوظيفية والهيكلية بعد اعتلال الأوتار11،12،13. وأفيد أن التحفيز العصبي الميكانيكي يمكن أن يسبب انتشار وتمايز osteocytes، والعظام، والخلايا العضلية الملساء، الخلايا الليفية، والخلايا الجذعية mesenchymal وغيرها من الخلايا الحساسة للقوة14،15،16،17،18. ولذلك، TDSCs، باعتبارها واحدة من الخلايا الحساسية ومتعددة القدرات، ويمكن أيضا أن يكون حافزا للتمييز عن طريق تحميل الميكانيكية19،20.

ومع ذلك، يمكن أن المعلمات تحميل الميكانيكية المختلفة (قوة التحميل، تردد التحميل، نوع التحميل وفترة التحميل) يمكن أن تحفز TDSCs للتمييز في خلايا مختلفة21. وبالتالي ، فإن نظام التحميل الميكانيكية الفعالة والصالحة مهم جدًا بالنسبة لـ tenogenesis. وعلاوة على ذلك، هناك أنواع مختلفة من المفاعلات الحيوية كأنظمة تحفيز تستخدم حالياً لتوفير التحميل الميكانيكي للبلدان النامية. مبادئ كل نوع من مفاعلات الحيوية مختلفة ، وبالتالي فإن المعلمات التحميل الميكانيكية المقابلة لمختلف المفاعلات الحيوية هي أيضا مختلفة. ولذلك، فإن بروتوكول التحفيز البسيط والاقتصادي والقابل للاستنساخ مطلوب، بما في ذلك نوع مفاعل حيوي، ووسيلة التحفيز المقابلة، ونظام التحميل الميكانيكي.

وتصف هذه المقالة طريقة تستند إلى نظام تمدد أحادي الأبعاد ثلاثي الأبعاد (3D) لتحفيز TDSCs على التفريق في أنسجة تشبه الأوتار. هناك سبع مراحل من البروتوكول: عزل TDSCs الفئران، والثقافة والتوسع في الفئران TDSCs، وإعداد ثقافة التحفيز المتوسطة لتشكيل ورقة الخلية، وتشكيل ورقة الخلية عن طريق زراعة في التحفيز المتوسط، وإعداد 3D وتر الخلايا الجذعية بناء، وتجميع مجمع التحفيز الميكانيكية أحادية التمدد، وتقييم الميكانيكية حفز في الأنسجة مثل وتر فيترو. الإجراء كله يستغرق أقل من 3 أسابيع للحصول على بناء الخلية 3D، وهو أقل بكثير من بعض الأساليب القائمة22،23. وقد ثبت أن البروتوكول الحالي قادر على حث TDSCs على التفريق في أنسجة الأوتار ، وهو أكثر موثوقية من نظام التمدد ثنائي الأبعاد (2D) الحالي الشائع الاستخدام (2D). وقد أثبتت الأنسجة فعالية. وباختصار، فإن هذا البروتوكول بسيط واقتصادي ويمكن استنساخه وصحته.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وقد تمت الموافقة على الأساليب الموصوفة وتنفيذها وفقاً للمبادئ التوجيهية واللوائح الصادرة عن لجنة أخلاقيات الحيوان بجامعة غرب أستراليا.

1- عزل الفئران TDSCs

  1. القتل الرحيم 6-8 أسابيع من العمر C57BL/6 الفئران عن طريق خلع عنق الرحم.
  2. حصاد الأوتار الرضفة24 وأوتار أخيل25.
  3. الأوتار هضم من واحد مع 6 مل من نوع أنا collagenase (3 ملغ / مل) لمدة 3 ساعة.
    ملاحظة: كما حجم وتر في الماوس صغير، يجب استخدام جميع الأوتار التي يتم حصادها من ماوس واحد في هذه الخطوة.
  4. جمع الخلايا والثقافة في المتوسط الأساسي الحد الأدنى الكامل (ألفا-MEM) التي تحتوي على 10٪ من مصل الأبقار الجنين (FBS) و 1٪ من ستربتوميسين وخليط البنسلين لمدة 7 أيام.
  5. تحديد TDSCs باستخدام فرز الخلايا المنشطة بالفلور من خلال قياس التدفق الخلوي (التعبير عن علامات سطح الخلية بما في ذلك CD4 و CD90 و Sca-1؛ عدم التعبير عن CD34 و CD45).
  6. مرور وتجميد الخلايا (سيتم استخدام مرور الخلايا 4 لمزيد من الخطوات).

2- الثقافة والتوسع في مراكز الماوس للـ TDSCs

ملاحظة: إجراء جميع الخطوات في غطاء معقمة السلامة البيولوجية.

  1. خذ الخلايا الدافّة (فئران TDSCs، مليون خلية، مرور 4، إلى 37 درجة مئوية).
  2. إضافة ببطء إضافية 4-5 مل كاملة الحد الأدنى من المتوسطة الأساسية (ألفا-MEM).
  3. نقل الخليط إلى أنبوب الطرد المركزي 15 مل مع ماصة.
  4. أعلى مع متوسطة إلى 8 مل مجموع مع ماصة.
    1. متوسطة ما قبل الارهاد في حاضنة فرن 37 درجة مئوية.
  5. ضع الأنبوب في جهاز طرد مركزي وتوازن.
  6. أجهزة الطرد المركزي وخلايا بيليه في 347 × ز لمدة 5 دقائق.
  7. إخراج بعد الطرد المركزي والتحقق من بيليه في الجزء السفلي.
  8. decant المتوسطة تجميد، والخلايا resuspend بلطف في 1-2 مل من المتوسط الكامل (تجنب صنع فقاعات كثيرة جدا).
  9. نقل الخلايا التي أعيد اعتمادها إلى قارورة T-75 بواسطة ماصة.
  10. استخدام ماصة لإضافة كاملة ألفا-MEM المتوسطة إلى القارورة لتصل إلى حجم إجمالي 10 مل مع تركيز النهائي من 13،000 الخلايا/ سم2.
  11. ضع القارورة في الحاضنة والثقافة عند 37 درجة مئوية مع 5٪ CO2.
  12. تغيير الوسط كل 3 أيام.
  13. مراقبة ومراقبة الخلايا تحت المجهر عند تغيير المتوسطة حتى يتم استزراع الخلايا إلى التقاء 100٪ (حوالي 40،000 خلية / سم2).

3. إعداد المحفزات الثقافة المتوسطة لتشكيل ورقة الخلية

ملاحظة: إجراء جميع الخطوات في غطاء معقمة السلامة البيولوجية.

  1. صب 15 مل من كامل ألفا-MEM المتوسطة في أنبوب معقم 15 مل.
  2. إضافة 6 ميكرولتر من حمض الاسكوربيك (11 ملغ / مل) إلى 15 مل من المتوسط لتركيز النهائي من 4.4 ميكروغرام / مل.
    ملاحظة: إضافة 25 نانوغرام / مل عامل نمو النسيج الضام في الحث ثقافة المتوسطة يمكن تسريع النمو كله وعملية التمايز.
  3. مزيج بلطف عن طريق عكس صعودا وهبوطا.

4. خلية ورقة تشكيل عن طريق زراعة في التحفيز المتوسطة

ملاحظة: إجراء جميع الخطوات في غطاء معقمة السلامة البيولوجية.

  1. تخلص من وسط ألفا-ميم العادي الكامل بعناية، وتجنب لمس الخلايا المتصلة بأسفل القارورة.
  2. إضافة 10 مل من التحفيز المتوسط ببطء وتجنب التسبب في أي اضطراب في الخلايا التقاء تماما.
  3. ثقافة الخلايا في التحفيز المتوسط لمدة 9 أيام (تغيير المتوسطة كل 3 أيام) لتوليد ما يكفي ورقة الخلية في 37 درجة مئوية مع 5٪ CO2.
    ملاحظة: سوف تصبح مصفوفة خارج الخلية سميكة وحاضرة لتكون غائمة عندما لوحظ من أسفل القارورة بعد تحفيزها من حمض الاسكوربيك، مما يعني أن ورقة الخلية يتم إنشاؤها بشكل كاف.

5. إعداد 3D وتر الخلايا الجذعية بناء

ملاحظة: إجراء جميع الخطوات في غطاء معقمة السلامة البيولوجية.

  1. أخرج القارورة من الحاضنة
  2. تجاهل وسيط التحفيز تماما.
  3. اغسل ورقة الخلية الأحادية مع محلول ملحي مؤقت الفوسفات (PBS) عن طريق تدوير القارورة.
  4. تجاهل برنامج تلفزيوني تماما.
  5. استخدام ماصة لإضافة 1 مل من 0.25٪ التربسين إلى زاوية القارورة.
  6. انقر فوق زاوية القارورة لفك إرفاق ورقة الخلية الأحادية حتى تكون زاوية ورقة الخلية خارج الجزء السفلي من القارورة.
  7. على الفور إضافة 9 مل كاملة ألفا MEM المتوسطة لوقف التربسينية.
  8. مواصلة دوامة قارورة لتقشير قبالة ورقة الخلية monolayer تماما.
  9. صب مجموع ورقة الخلية دي المرفقة في طبق بيتري مع المتوسطة.
  10. استخدم ملاقطة معقمة لالتقاط زاوية واحدة من ورقة الخلية وتدويرها في اتجاه عقارب الساعة لمدة 15 مرة.
  11. التقاط آخر نهاية ورقة الخلية وتدوير في اتجاه عكس عقارب الساعة لمدة 10 مرات لتوليد بحزم وتر مثل في بناء في المختبر (الشكل 1A).

6. تجميع مجمع التحفيز الميكانيكي أحادي التمدد في مفاعل حيوي فريد التصميم

ملاحظة: إجراء جميع الخطوات في غطاء معقمة السلامة البيولوجية.

  1. قم بتوصيل الخطافات بواسطة جهاز التوصيل واضبطها مع المسافة المطلوبة (2 سم) بين خطان.
  2. الرياح بلطف TDSCs 3D بناء على هوك تجميعها لمدة 3 مرات على كل هوك(الشكل 1B).
  3. تأمين السنانير مع بناء الخلية على غرفة مفاعل حيوي عن طريق تشديد مسامير على طرفي.
    ملاحظة: الغرفة بأكملها، بما في ذلك مسامير وخطاف، هو عقيم (الأوتوكلاف لمدة 1.5 ساعة في 134 درجة مئوية والأشعة فوق البنفسجية (الأشعة فوق البنفسجية) تعرض لمدة 24 ساعة قبل الاستخدام). بالنسبة لحامل المعدن من الغرف، الأشعة فوق البنفسجية يعرض لمدة 48 ساعة قبل الاستخدام.
  4. ملء الغرفة مع كامل ألفا-MEM المتوسطة.
  5. قم بتوصيل المحرك بغرفة الثقافة عن طريق الكابل.
  6. قطع ربط السنانير بواسطة مقص معقمة.
  7. قم بتشغيل وحدة تحكم القناة والمماثلة لبدء التحفيز الميكانيكي.
  8. ضع الغطاء على الغرفة
  9. تحقق من أضواء المؤشر، وضمان أن يمكن أن تعمل بشكل صحيح.
  10. وضع مفاعل حيوي في الحاضنة واخضاع بناء الخلية 3D لتمتد الميكانيكية لمدة 6 أيام (6٪ تمتد، 0.25 هرتز، 8 ح، تليها 16 ساعة بقية).

7. تقييم ميكانيكية حفز في نسيج يشبه وتر في المختبر

  1. تخفيف البراغي من قبل مفك واتخاذ الجمعية قبالة بعناية.
  2. وضع الأنسجة الشبيهة بالوتر في 4% شبه شكلي للتهييب لمدة 15 دقيقة.
  3. ضع النسيج الثابت الشبيه بأوتار العين في كاسيت خزعة مع خزعة رغوة وسادات.
  4. عملية لتجفيف العينة وتقييم أخيرا من قبل H & E تلطيخ النسيج النسيجي.
  5. كرر البروتوكول بأكمله واستخراج RNA من الأنسجة الشبيهة بالوتر لتقييم التعبير عن علامات التنغيم بواسطة PCR الكمي (qPCR). يتم سرد التمهيديات للجينات المختارة في الجدول 1.
    ملاحظة: بروتوكول الأنسجة وبروتوكول qPCR هي معيار وبعد دراسة سابقة21.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

قبل التحفيز الميكانيكي، نمت TDSCs إلى التقاء 100٪ في المتوسط الكامل وعرض مورفولوجيا فائقة التنظيم غير منظم(الشكل 2A). بعد 6 أيام من التحميل الميكانيكية تمتد uniaxial، مصفوفة خارج الخلية (ECM) ومحاذاة الخلية كانت موجهة بشكل جيد (الشكل 2B). كانت الخلايا مأهولة بشكل جيد ومغلفة بشكل جيد في ECM بعد التحميل الميكانيكي. وقد قدمت الخلية مورفولوجيا أن تكون ممدود وكان أكثر مماثلة لخلية وتر العادي مقارنة مع واحد دون تمتد (الشكل 2C). كثافة الخلية في بناء الخلية مع تحميل كان أعلى من واحد دون تحميل. وأظهرت نتائج QPCR أن الطريقة الحالية زادت من التعبير عن علامات التنغيمية بما في ذلك Scleraxis، موهوك، تينومودلين، COL1A1(الشكل 3)مقارنة بتلك التي تعامل بها ثقافة ثابتة.

Figure 1
الشكل 1: تجميع ثلاثي الأبعاد (3D) بناء الخلايا على السنانير من مفاعل حيوي. (أ) عرض عام من بناء الخلية 3D على السنانير. (B) الرسم البياني لتجميع بناء الخلية 3D على السنانير. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2: مورفولوجيا الخلية قبل وبعد التحفيز الميكانيكي. (أ)نمت الخلايا الجذعية المشتقة من الأوتار إلى 100٪ التقاء في وسط كامل وعرضها على مورفولوجيا ultrastructural غير منظم قبل التحفيز الميكانيكي. (B)أظهرت الصور Histologic H & E تلطيخ من بناء الخلايا بعد التحفيز الميكانيكي. (C) أظهرت الصور Histologic H & E تلطيخ خلية التحكم في بناء مثقف في مفاعل حيوي لمدة 6 أيام دون التحفيز الميكانيكي. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3: مستوى التعبير من علامات تينوجينيسيس. تم تطبيع مستويات التعبير الجيني الفردية أولاً ضد الرقابة الداخلية، 36B4، ثم تم تطبيعها مقابل مستويات التعبير الجيني من الثقافات الساكنة. تظهر النتائج من 3 تجارب. وترد تسلسلات التمهيدي المستخدمة لتحليل qPCR في الجدول 1. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 4
الشكل 4: ثلاثي الأبعاد نظام التحفيز الميكانيكية التحفيز bioreactor. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

الجينات تسلسل التمهيدي
إلى الأمام 5'-> 3' عكس 5'->3'
COL1A1 TGACTGGAAGAGCGGAGAGT GTTCGGGCTGATGTACCAGT
Scleraxis CCCAAACAGATCTGCACCTT GGCTCTGTGACTCTTCAG
الموهوك GTCCCAGCCAGATTTAAG TCGCTGAGCTTTCCCCTTTA
تينومودولين CCGCAGAAAAGCCTATTGAA GACCACCCATTGCTCATTATTCT
36B4 CTTCCCACTTGCTGAAAGG CGAAGAGACCGAATCCA

الجدول 1: تسلسلات التمهيدي المستخدمة لتحليل qPCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وتر هو نسيج الضام الليفي الليفي النياني. وفقا للبحوث السابقة، التحميل الميكانيكية الزائدة يمكن أن تؤدي إلى تمايز العظم من الخلايا الجذعية وتر، في حين أن التحميل غير كافية من شأنه أن يؤدي إلى اضطراب هيكل الألياف الكولاجين خلال التمايز وتر21.

وهناك رأي شائع هو أن المفتاح إلى مفاعل حيوي مثالي هو القدرة على محاكاة البيئة الدقيقة في المختبر الخلوية التي تخضع الخلايا في الجسم الحي. ولذلك، محاكاة في بيئة الإجهاد الطبيعي في الجسم الحي في المختبر هو المفتاح لتحفيز تمايز النسب واحد من TDSCs في خلايا الأوتار. في هذا البروتوكول، كان عرض بناء TDSC 2 سم، وكان نطاق حركة الخطاف 0.12 سم، مما يعني أن السلالة كانت 0.12/2 (٪). وفي الختام، تم تحفيز مراكز المفاعلات المعالجة عبر الفلوريوم ميكانيكياً في مفاعل حيوي لمدة 6 أيام (6 في المائة، 0.25 هرتز، 8 ساعات، تليها 16 ساعة راحة) في هذا البروتوكول. وبعد التقييم، ثبت أن بارامترات التحميل الميكانيكية المستخدمة في هذا البروتوكول تحفز الشركات عبر الوطنية على توليد أنسجة تشبه الأوتار. وينبغي ملاحظة أن بارامترات مفاعلات الطاقة الحيوية ينبغي أن تتطابق على وجه التحديد مع نوع نظام التمدد المناظر. على سبيل المثال، تختلف المعلمات المناسبة لتمتد الخلية أحادية الطبقات عن ورقة الخلايا ثلاثية الأبعاد الحالية التي تمتد26،27. وهناك سبب محتمل هو وسائط القوة المختلفة21. في نظام 2D أحادية الطبقات تمتد، والخلايا نعلق على الركيزة الثقافة من قبل الالتصاقات البؤري في الجزء السفلي والاتصال مع بعضها البعض عن طريق تقاطعات الخلية الخلية. ومع ذلك ، في ورقة الخلية 3D ، وهناك أيضا العديد من اتصالات الخلية ECM التي شكلت نتيجة لالمتخصصة 3D ، مما يعني أن الخلايا تحت الضغط بالإضافة إلى تمتد.

وقد تجلت فعالية هذا البروتوكول من خلال مورفولوجيا ومستوى التعبير عن علامات التينوجينيك. من حيث مورفولوجيا، وبصرف النظر عن الأنسجة، وذلك باستخدام المجهر المناعي confocal للكشف عن الكولاجين أنا هو وسيلة شائعة لتوصيف تنظيم الكولاجين ومن ثم تقييم محاذاة ECM. أكدت دراسة سابقة نوع الكولاجين المتوائمة جيدا أنا تشكيل حزمة في بناء TDSC مع 6٪ التحفيز الميكانيكية uniaxial لمدة 6 أيام ولكن ليس في واحد دون تحميل21. واستخدمت علامات تينوجينيك لتحديد خلايا الوتر، بما في ذلك Scleraxis (SCX)، وموهوك (MKX)، وتينومولين (TNMD)، و COL1A1. فقط كان TNMD عامل غير النسخ، والباقي منهم هي عوامل النسخ28. لقد تم التعرف عليهم جميعاً يمكن أن ينظم SCX تنمية الأوتار في المرحلة الجنينية29، في حين يمكن أن تنظم MKX تمايز وتر ونضج في مرحلة ما بعد الولادة30. وعلاوة على ذلك، تم تقييم الخصائص الميكانيكية (الحمل الأقصى وصلابة) من الأنسجة الشبيهة بأوتار في دراسة سابقة أيضا، وأظهرت الخصائص الميكانيكية لبناء TDSC مع التحميل كانت أفضل مما كانت عليه في واحد دون تحميل21.

يمكن أن تؤثر هذه الوسيلة على نمو الخلايا والتمايز. في هذا البروتوكول، من أجل تشكيل ورقة الخلية بطريقة سليمة، نمت TDSCs إلى التقاء 100٪ في قارورة بلاستيكية غير المصقول القياسية في المتوسط الكامل، ثم تم تحفيز TDSCs لتعزيز ترسب ECM بإضافة 4.4 ملغم / مل حمض الاسكوربيك ل6 د. العديد من عوامل النمو، بما في ذلك عامل النمو الشبيه بالإنسولين الأول، عامل النمو البطانية الوعائية، عامل النمو المشتق من الصفائح الدموية، عامل النمو الليفي الأساسي، عامل النمو التحويلي، وعامل تمايز النمو 5، لعبت دورا هاما في تشكيل الأوتار والشفاء31،32،33،34. إضافة 25 نانوغرام / مل عامل نمو النسيج الضام في التحفيز ثقافة المتوسطة كما Ni وآخرون ذكرت يمكن تسريع النمو كله وعملية التمايز35.

في الوقت الحاضر، ورقة الخلية 2D، والمعروف أيضا باسم الخلية أحادية الطبقات، هو النظام الأكثر شيوعا المستخدمة في التحقيقات الميكانيكية. يوفر الامتداد ثنائي الاتجاهات التوتر متعدد الاتجاهات ، سواء طولياً أو جانبياً ، حيث أن الامتداد الأحادي يوفر فقط التوتر الطولي36. وهكذا، يمكن أن تحاكي ثقافة الخلية أحادية الطبقة مع امتداد ثنائي المحور بيئة النمو لبعض أنواع الخلايا، مثل خلايا القلب والخلايا البشرة. ومع ذلك، فإن بناء الخلية ثلاثية الأبعاد أكثر شبهاً بالشكل الحقيقي للوتر، والتمدد الأحادي هو أكثر شبهاً بخصائص الإجهاد في خلايا الأوتار، مقارنةً بصفقة الخلايا الثنائية الأبعاد والتمدد ثنائي الاكسالي. وهكذا، فإن الجمع بين بناء الخلية ثلاثية الأبعاد والتمدد الأحادي هو أكثر كفاءة لفهم أفضل للوتر والبيئة الدقيقة الميكانيكية. وهذا يوفر أساسا نظريا لاستخدام نظام تمدد أحادي ثلاثي الأبعاد لحفز التمايز بين اللجان الإقليمية. وهكذا، تم أخيرا تدحرجت ورقة الخلية 2D في بناء خلية 3D وخضع لتمتد uniaxial في هذا البروتوكول.

ويتكون المُصدِّر البيولوجي المستخدم في هذا البروتوكول من غرفة المُشغل والثقافة(الشكل 4). تفاصيل عن هذا مفاعل حيوي متوفرة في دراسة سابقة37. حاليا، وشملت المحركات الأكثر شيوعا المستخدمة في الأوتار المحركات الهوائية، والمحركات الخطية، ومسامير كرة المحرك خطوة38،39،40. وشملت الغرف الدوائر المتكاملة والمنفصلة41,42. من بينها ، غرفة منفصلة مع محرك خطي قدمت دقيقة التحميل الميكانيكية وكان المحمولة وسهلة ليتمضبطها 43.

وباستثناء الخلايا الجذعية المُتَّمَكَّلة، قد تكون أنواع أخرى من الخلايا الجذعية مصدراً محتملاً للخلايا يُستخدم في الطريقة الحالية. وقد أظهرت الأبحاث السابقة أن أنواع أخرى من الخلايا الجذعية قد يكون لها القدرة العلاجية المحتملة وربما تحسن تجديد الأوتار. مقارنة بأوتار الخيول المصابة المعالجة بالإدارة التقليدية غير الخلوية المستندة ، كان معدل إعادة إصابة الأوتار التي تعالجها BMSCs أقلمن 44،45. وعلاوة على ذلك، حقن داخلي BMSCs في نموذج اعتلال الأوتار يمكن أن تحفز بشكل فعال تجديد الأوتار46. يمكن للخلايا الجذعية المشتقة الدهنية علاج بشكل فعال الأوتار الاكوين مما يؤدي إلى الشفاء الكامل والعودة إلى النشاط الطبيعي في الخيول47. معا، كان هناك ما يكفي من الأدلة تشير إلى أن الخلايا الجذعية، باستثناء TDSCs، يمكن علاج انحطاط الأوتار. ومع ذلك ، كملاحظة تحذيرية ، فقد ثبت أن زرع BMSCs في الأوتار المصابة يحفز التمايز العظمي الاتبي المستبد في نموذج أرنب ، مما يشير إلى أن الخلايا الجذعية من نسيج معين قد يكون لها ميل إلى التفريق في خلايا غير مرغوب فيها من نسيجها المنشأ48. في البحوث السابقة، يمكن أن يؤدي العلاج المحروم من التحميل إلى مراكز التكاد إلى نشوء العظام وكذلك21، مما أدى إلى اقتراح بأن الطريقة الحالية لديها القدرة على تحفيز تينوجينسيس الخلايا الجذعية الأخرى وتجنب تكوين العظم مع نظام تحميل محدد. ومن الضروري إجراء مزيد من البحوث لاستكشاف نظم التحميل المحددة هذه بالنسبة لأنواع أخرى من الخلايا الجذعية. إذا كان هذا السيناريو يحمل, المزيد من مصدر الخلية لعلاج اعتلال الأوتار تكون متاحة.

ولا تزال هناك بعض القيود التي ينبغي الاعتراف بها. أولا، على الرغم من أن المواد غيرcorrosive ولصناعة السيارات، الفولاذ المقاوم للصدأ، واستخدمت لبناء نظام مفاعل حيوي، وظروف زراعة ووسط الثقافة لا تزال تآكل الغرفة بما في ذلك المسمار والخطاف. وبالتالي ، فإن التفتيش الروتيني للغرفة وإزالة الصدأ في الوقت المناسب ضروري. ثانيا، من أجل جعل هذا مفاعل حيوي الاقتصادية والمحمولة، لا يوجد في ذلك نظام مراقبة البيئة وتداول متوسطة. وبالتالي ، يحتاج المشغل إلى نقل مفاعل حيوي وفتح الغرفة للتبادل المتوسط كل 3 أيام ، مما يزيد من خطر التلوث. يجب على المشغل دائماً الانتباه للحفاظ على بيئة TDSCs العقيمة.

لعلاج اعتلال الوتر ، من الضروري توضيح العملية المرضية من منظور غير جراحي. من حيث العلاج الجراحي ، فإن الطريقة الفعالة هي استخدام الطعوم الذاتية المهندسة. عملية تحفيز TDSCs لتقليد التمايز في الجسم الحي مفيد للتحقيق في العملية المرضية من اعتلال الأوتار. نسيج وتر سقالة هندسة خالية لديه القدرة على تعزيز شفاء وتر في نموذج إصابة إطار وتر الرضفة الفئران. الى جانب ذلك ، أثبتت الأعمال السابقة التحميل الميكانيكية يمكن أن تحسن الخصائص الميكانيكية للوتر مثقف. وهكذا، يوفر هذا البروتوكول طريقة قابلة للتكرار للتمايز الموجه بين TDSCs في أنسجة تشبه الأوتار بحيث يمكن استخدامها ببساطة ومجدية لثقافة الأوتار الهندسية المحتملة.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ليس لدى أصحاب البلاغ ما يكشفون عنه.

Acknowledgments

وقد أجري البحث بينما كان صاحب البلاغ يحصل على "منحة دراسية من جامعة غرب أستراليا للحصول على رسوم دولية وجائزة للدراسات العليا الجامعية في جامعة غرب أستراليا". وقد دعم هذا العمل المؤسسة الوطنية للعلوم الطبيعية الصينية (81802214).

Materials

Name Company Catalog Number Comments
Ascorbic acid Sigma-aldrich PHR1008-2G
Fetal bovine serum (FBS) Gibcoä by Life Technologies 1908361
Histology processor Leica TP 1020
Minimal Essential Medium (Alpha-MEM) Gibcoä by Life Technologies 2003802
Mouse Tendon Derived Stem Cell Isolated from Achilles tendons of 6- to 8-wk-old C57BL/6 mice. Then digested with type I collagenase (3 mg/ml; MilliporeSigma, Burlington, MA, USA) for 3 h and passed through a 70 mmcell strainer to yield single-cell suspensions.
Paraformaldehyde Sigma-aldrich 441244
Streptomycin and penicillin mixture Gibcoä by Life Technologies 15140122
Three-dimensional Uniaxial Mechanical Stimulation Bioreactor System Centre of Orthopaedic Translational Research, Medical School, University of Western Australia Available from the corresponding author upon request. Or make it according to our design* *Wang T, Lin Z, Day RE, et al. Programmable mechanical stimulation influences tendon homeostasis in a bioreactor system. Biotechnol Bioeng. 2013;110(5):1495–1507. doi:10.1002/bit.24809
Trypsin Gibcoä by Life Technologies 1858331

DOWNLOAD MATERIALS LIST

References

  1. Knobloch, K., Yoon, U., Vogt, P. M. Acute and overuse injuries correlated to hours of training in master running athletes. Foot & Ankle International. 29, (7), 671-676 (2008).
  2. Kujala, U. M., Sarna, S., Kaprio, J. Cumulative incidence of achilles tendon rupture and tendinopathy in male former elite athletes. Clinical Journal of Sport Medicine. 15, (3), 133-135 (2005).
  3. Lian, O. B., Engebretsen, L., Bahr, R. Prevalence of jumper's knee among elite athletes from different sports: a cross-sectional study. The American Journal of Sports Medicine. 33, (4), 561-567 (2005).
  4. Zwerver, J., Bredeweg, S. W., vanden Akker-Scheek, I. Prevalence of Jumper's knee among nonelite athletes from different sports: a cross-sectional survey. The American Journal of Sports Medicine. 39, (9), 1984-1988 (2011).
  5. van der Worp, H., et al. Risk factors for patellar tendinopathy: a systematic review of the literature. British Journal of Sports Medicine. 45, (5), 446-452 (2011).
  6. Lopez, R. G. L., Jung, H. -G. Achilles tendinosis: treatment options. Clinics in Orthopedic Surgery. 7, (1), 1-7 (2015).
  7. Wren, T. A., Yerby, S. A., Beaupré, G. S., Carter, D. R. Mechanical properties of the human achilles tendon. Clinical Biomechanics. 16, (3), Bristol, Avon. 245-251 (2001).
  8. Rees, J. D., Wilson, A. M., Wolman, R. L. Current concepts in the management of tendon disorders. Rheumatology. 45, (5), Oxford, England. 508-521 (2006).
  9. Magnan, B., Bondi, M., Pierantoni, S., Samaila, E. The pathogenesis of Achilles tendinopathy: a systematic review. Foot and Ankle Surgery. 20, (3), 154-159 (2014).
  10. Riley, G. The pathogenesis of tendinopathy. A molecular perspective. Rheumatology. 43, (2), Oxford, England. 131-142 (2004).
  11. Bi, Y., et al. Identification of tendon stem/progenitor cells and the role of the extracellular matrix in their niche. Nature Medicine. 13, (10), 1219-1227 (2007).
  12. Zhang, J., Wang, J. H. C. BMP-2 mediates PGE(2) -induced reduction of proliferation and osteogenic differentiation of human tendon stem cells. Journal of Orthopaedic Research. 30, (2), 47-52 (2012).
  13. Chen, L., et al. Synergy of tendon stem cells and platelet-rich plasma in tendon healing. Journal of Orthopaedic Research. 30, (6), 991-997 (2012).
  14. Wang, J., et al. Mechanical stimulation orchestrates the osteogenic differentiation of human bone marrow stromal cells by regulating HDAC1. Cell Death & Disease. 7, (5), 2221 (2016).
  15. Parvizi, M., Bolhuis-Versteeg, L. A. M., Poot, A. A., Harmsen, M. C. Efficient generation of smooth muscle cells from adipose-derived stromal cells by 3D mechanical stimulation can substitute the use of growth factors in vascular Tissue Engineeringineering. Biotechnology Journal. 11, (7), 932-944 (2016).
  16. Sun, L., et al. Effects of Mechanical Stretch on Cell Proliferation and Matrix Formation of Mesenchymal Stem Cell and Anterior Cruciate Ligament Fibroblast. Stem Cells International. 2016, 9842075 (2016).
  17. Lin, X., Shi, Y., Cao, Y., Liu, W. Recent progress in stem cell differentiation directed by material and mechanical cues. Biomedical Materials. 11, (1), Bristol, England. 014109 (2016).
  18. Li, R., et al. Mechanical strain regulates osteogenic and adipogenic differentiation of bone marrow mesenchymal stem cells. Biomed Research International. 2015, 873251 (2015).
  19. Zhang, J., Wang, J. H. C. Characterization of differential properties of rabbit tendon stem cells and tenocytes. BMC Musculoskeletal Disorders. 11, 10-10 (2010).
  20. Liu, X., Chen, W., Zhou, Y., Tang, K., Zhang, J. Mechanical Tension Promotes the Osteogenic Differentiation of Rat Tendon-derived Stem Cells Through the Wnt5a/Wnt5b/JNK Signaling Pathway. Cellular Physiology and Biochemistry. 36, (2), 517-530 (2015).
  21. Wang, T., et al. 3D uniaxial mechanical stimulation induces tenogenic differentiation of tendon-derived stem cells through a PI3K/AKT signaling pathway. FASEB Journal. 32, (9), 4804-4814 (2018).
  22. Calve, S., et al. Engineering of functional tendon. Tissue Engineering. 10, (5-6), 755-761 (2004).
  23. Kostrominova, T. Y., Calve, S., Arruda, E. M., Larkin, L. M. Ultrastructure of myotendinous junctions in tendon-skeletal muscle constructs engineered in vitro. Histology & Histopathology. 24, (5), 541-550 (2009).
  24. Wagner, J. R., Taguchi, T., Cho, J. Y., Charavaryamath, C., Griffon, D. J. Evaluation of Stem Cell Therapies in a Bilateral Patellar Tendon Injury Model in Rats. Journal of Visualized Experiments. (133), e56810 (2018).
  25. Kurtaliaj, I., Golman, M., Abraham, A. C., Thomopoulos, S. Biomechanical Testing of Murine Tendons. Journal of Visualized Experiments. (152), e60280 (2019).
  26. Hsiao, M. Y., et al. The Effect of the Repression of Oxidative Stress on Tenocyte Differentiation: A Preliminary Study of a Rat Cell Model Using a Novel Differential Tensile Strain Bioreactor. International Journal of Molecular Sciences. 20, (14), (2019).
  27. Morita, Y., et al. The optimal mechanical condition in stem cell-to-tenocyte differentiation determined with the homogeneous strain distributions and the cellular orientation control. Biology Open. 8, (5), 0339164 (2019).
  28. Shukunami, C., Oshima, Y., Hiraki, Y. Molecular cloning of tenomodulin, a novel chondromodulin-I related gene. Biochemical and Biophysical Research Communications. 280, (5), 1323-1327 (2001).
  29. Murchison, N. D., et al. Regulation of tendon differentiation by scleraxis distinguishes force-transmitting tendons from muscle-anchoring tendons. Development. 134, (14), Cambridge, England. 2697-2708 (2007).
  30. Liu, W., et al. The atypical homeodomain transcription factor Mohawk controls tendon morphogenesis. Molecular and Cellular Biology. 30, (20), 4797-4807 (2010).
  31. Chang, J., Thunder, R., Most, D., Longaker, M. T., Lineaweaver, W. C. Studies in flexor tendon wound healing: neutralizing antibody to TGF-beta1 increases postoperative range of motion. Plastic and Reconstructive Surgery. 105, (1), 148-155 (2000).
  32. Bennett, N. T., Schultz, G. S. Growth factors and wound healing: biochemical properties of growth factors and their receptors. American Journal of Surgery. 165, (6), 728-737 (1993).
  33. Wòjciak, B., Crossan, J. F. The effects of T cells and their products on in vitro healing of epitenon cell microwounds. Immunology. 83, (1), 93-98 (1994).
  34. Marui, T., et al. Effect of growth factors on matrix synthesis by ligament fibroblasts. Journal of Orthopaedic Research. 15, (1), 18-23 (1997).
  35. Ni, M., et al. Engineered scaffold-free tendon tissue produced by tendon-derived stem cells. Biomaterials. 34, (8), 2024-2037 (2013).
  36. Trumbull, A., Subramanian, G., Yildirim-Ayan, E. Mechanoresponsive musculoskeletal tissue differentiation of adipose-derived stem cells. Biomedical Engineering Online. 15, 43 (2016).
  37. Wang, T., et al. Programmable mechanical stimulation influences tendon homeostasis in a bioreactor system. Biotechnology and Bioengineering. 110, (5), 1495-1507 (2013).
  38. Nirmalanandhan, V. S., et al. Effect of scaffold material, construct length and mechanical stimulation on the in vitro stiffness of the engineered tendon construct. Journal of Biomechanics. 41, (4), 822-828 (2008).
  39. Doroski, D. M., Levenston, M. E., Temenoff, J. S. Cyclic tensile culture promotes fibroblastic differentiation of marrow stromal cells encapsulated in poly(ethylene glycol)-based hydrogels. Tissue Engineeringineering. Part A. 16, (11), 3457-3466 (2010).
  40. Altman, G. H., et al. Advanced bioreactor with controlled application of multi-dimensional strain for Tissue Engineeringineering. Journal of Biomechanical Engineering. 124, (6), 742-749 (2002).
  41. Webb, K., et al. Cyclic strain increases fibroblast proliferation, matrix accumulation, and elastic modulus of fibroblast-seeded polyurethane constructs. Journal of Biomechanics. 39, (6), 1136-1144 (2006).
  42. Parent, G., Huppé, N., Langelier, E. Low stress tendon fatigue is a relatively rapid process in the context of overuse injuries. Annals of Biomedical Engineering. 39, (5), 1535-1545 (2011).
  43. Wang, T., et al. Bioreactor design for tendon/ligament engineering. Tissue Engineeringineering. Part B, Reviews. 19, (2), 133-146 (2013).
  44. Smith, R. K. Mesenchymal stem cell therapy for equine tendinopathy. Disability and Rehabilitation. 30, (20-22), 1752-1758 (2008).
  45. Godwin, E. E., Young, N. J., Dudhia, J., Beamish, I. C., Smith, R. K. Implantation of bone marrow-derived mesenchymal stem cells demonstrates improved outcome in horses with overstrain injury of the superficial digital flexor tendon. Journal of Equine Veterinary Science. 44, (1), 25-32 (2012).
  46. Lacitignola, L., Crovace, A., Rossi, G., Francioso, E. Cell therapy for tendinitis, experimental and clinical report. Veterinary Research Communications. 32, Suppl 1 33-38 (2008).
  47. Del Bue, M., et al. Equine adipose-tissue derived mesenchymal stem cells and platelet concentrates: their association in vitro and in vivo. Veterinary Research Communications. 32, Suppl 1 51-55 (2008).
  48. Awad, H. A., et al. Repair of patellar tendon injuries using a cell-collagen composite. Journal of Orthopaedic Research. 21, (3), 420-431 (2003).
تطبيق نظام حفّال ميكانيكي أحادي الأبعاد أحادي الأبعاد للتحفيز الحيوي للحث على التمايز التنوجيني للخلايا الجذعية المشتقة من الأوتار
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chen, Z., Chen, P., Ruan, R., Chen, L., Yuan, J., Wood, D., Wang, T., Zheng, M. H. Applying a Three-dimensional Uniaxial Mechanical Stimulation Bioreactor System to Induce Tenogenic Differentiation of Tendon-Derived Stem Cells. J. Vis. Exp. (162), e61278, doi:10.3791/61278 (2020).More

Chen, Z., Chen, P., Ruan, R., Chen, L., Yuan, J., Wood, D., Wang, T., Zheng, M. H. Applying a Three-dimensional Uniaxial Mechanical Stimulation Bioreactor System to Induce Tenogenic Differentiation of Tendon-Derived Stem Cells. J. Vis. Exp. (162), e61278, doi:10.3791/61278 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter