A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

X-Ray Crystallography to Study the Oligomeric State Transition of the Thermotoga maritima M42 Aminopeptidase TmPep1050

3.9K views

⸱

DOI:

10.3791/61288

⸱

May 13th, 2020

In This Article

Summary

This protocol has been developed to study the dimer-dodecamer transition of TmPep1050, an M42 aminopeptidase, at the structural level. It is a straightforward pipeline starting from protein purification to X-ray data processing. Crystallogenesis, data set indexation, and molecular replacement have been emphasized through a case of study, TmPep1050H60A H307A variant.

Abstract

The M42 aminopeptidases form functionally active complexes made of 12 subunits. Their assembly process appears to be regulated by their metal ion cofactors triggering a dimer-dodecamer transition. Upon metal ion binding, several structural modifications occur in the active site and at the interaction interface, shaping dimers to promote the self-assembly. To observe such modifications, stable oligomers must be isolated prior to structural study. Reported here is a method that allows the purification of stable dodecamers and dimers of TmPep1050, an M42 aminopeptidase of T. maritima, and their structure determination by X-ray crystallography. Dimers were prepared from dodecamers by removing metal ions with a chelating agent. Without their cofactor, dodecamers became less stable and were fully dissociated upon heating. The oligomeric structures were solved by the straightforward molecular replacement approach. To illustrate the methodology, the structure of a TmPep1050 variant, totally impaired in metal ion binding, is presented showing no further breakdown of dimers to monomers.

Introduction

Oligomerization is a predominant process that dictates the biological functions of many proteins. In Escherichia coli, it is estimated that only 35% of proteins are monomeric1. Some proteins, called morpheeins, can even adopt several oligomeric states with subunits having distinct structure in each oligomeric state2. The transition between their oligomeric states is often a mean to regulate protein activity as each oligomeric state may have a different specific activity or function. Several examples of morpheeins have been well-documented in literature, notably the porphobilinogen synthase3, HPr kinase/phosphatase4, Lon protease5, lactate dehydrogenase6, glyceraldehyde-3-phosphate dehydrogenase7, pyruvate kinase8, citrate synthase9, and ribonuclease A10. Recently, we described the M42 aminopeptidase TmPep1050, another example of enzyme with morpheein-like behavior, whose activity depends on its oligomeric states11. The transition between its oligomeric states is mediated by its metallic cofactors which induce several structural modifications of the subunits.

The M42 aminopeptidase family belongs to the MH clan12,13, and is widely distributed among Bacteria and Archaea14. The M42 aminopeptidases are genuine dinuclear enzymes degrading peptides up to 35 amino acid residues in length15. They adopt a peculiar tetrahedron-shaped structure made of 12 subunits with their active sites oriented towards an inner cavity. Such an arrangement is often described as a nano-compartmentalization of the activity to avoid uncontrolled proteolysis. The physiological function of the M42 aminopeptidases may be associated with the proteasome, hydrolyzing peptides resulting from protein degradation16,17. Pyrococcus horikoshii possesses four M42 aminopeptidases, each presenting distinct but complementary specificities18,19,20,21. Singularly, heterocomplexes made of two different types of subunits have been described in P. horikoshii, suggesting the existence of peptidasome complexes22,23.

Several structures of M42 aminopeptidases have been described in the literature11,16,18,19,20,24,25,26. The subunit is composed of two distinct domains, a catalytic domain and a dimerization domain. The catalytic domain adopts a common α/β fold conserved in the whole MH clan, the archetypal catalytic domain being the aminopeptidase Ap1 of Vibrio proteolyticus27. The dimerization domain adopts a PDZ-like fold16 and may have, in addition to its role in the oligomerization, a role in controlling substrate access and binding in the inner cavity11. As the basic building block is a dimer, the dodecamer is often described as the association of six dimers, each dimer being positioned at each edge of the tetrahedron16. The oligomerization of the M42 aminopeptidases relies on the availability of its metal cofactors. Divalent metal ions, often Zn2+ and Co2+, are catalytically involved in the peptide binding and hydrolysis. They are found in two distinct binding sites, namely M1 and M2 sites. The two metal ions also drive and finely tune the oligomerization as demonstrated for PhTET2, PhTET3, PfTET3, and TmPep105011,24,28,29. When the metal cofactors are depleted, the dodecamer disassembles into dimers, like in PhTET2, PhTET3, and TmPep105011,16,28, or even monomers, like in PhTET2 and PfTET324,29.

Presented here is a protocol used for studying the structures of TmPep1050 oligomers. This protocol is a set of common methods including protein purification, proteolytic activity screening, crystallization, X-ray diffraction, and molecular replacement. Subtleties inherent to dealing with metalloenzymes, protein oligomerization, protein crystallization and molecular replacement are emphasized. A case of study is also presented to show whether TmPep1050 dodecamers may further dissociate into monomers or not. To address this question, a TmPep1050 variant, TmPep1050H60A H307A, has been studied whose metal binding sites are impaired by mutating His-60 (M2 site) and His-307 (M1 site) to Ala residues. This protocol may be accommodated to study other M42 aminopeptidases or any metalloenzymes with morpheein-like behavior.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Production and purification of recombinant TmPep1050

NOTE: Hereafter are described the cloning procedure and purification of wild-type TmPep1050 adapted from a previous study11. Alternatively, the cloning can be done using a synthetic gene. To generate TmPep1050 variants, site directed mutagenesis can be performed following, for instance, the single-primer reactions in parallel protocol (SPRINP) method30. The purification protocol can be used for TmPep1050 variants. The use of His-tag should be avoided as it interferes with metal ion binding.

  1. Expression vector design
    1. Acquire genomic DNA of Thermotoga maritima MSB8 (ATCC 43589) or TmCD00089984 (Joint Center for Structural Genomics).
    2. Amplify TM_1050 open reading frame (ORF) using either genomic DNA or template plasmid, a high-fidelity DNA polymerase, and the following primers: ocej419 (5’- TTTAACTTTAAGAAGGAGATATACATACCCATGAAGGAACTGATCAGAAAGCTG) and ocej420 (5’- ATCCGCCAAAACAGCCAAGCTGGAGACCGTTTACGCCCCCAGATACCTGATGAG). Run the polymerase chain reaction (PCR) screening according to the following scheme: 5 min at 95 °C, 30 cycles of 3 steps (30 s at 95 °C, 30 s at 55 °C, 90 s at 72 °C), and 10 min at 72 °C as the final step.
    3. Clone the PCR fragment into a suitable expression vector (Table of Materials) by homologous recombination (Figure 1) in E. coli according to the SLiCE protocol31. To 50 ng of linearized vector, add PCR fragment in a 10:1 molar ratio of fragment to vector, 1 µL of PPY strain extract, 50 mM Tris-HCl pH 7.5, 100 mM MgCl2, 10 mM ATP, and 10 mM dithiothreitol (DTT) for a reaction volume of 10 µL. Incubate for 1 h at 37 °C.
    4. Transform chemically competent E. coli XL1 blue strain (or any recA- suitable strain) with 1 µL of recombination reaction. Plate the cells on LB medium containing 100 µg/mL ampicillin. Incubate the plates overnight at 37 °C.
    5. Pick colonies on fresh LB plates with 100 µg/mL ampicillin. Incubate the plates at 37 °C for a least 8 h.
    6. Screen for positive candidates by colony PCR using suitable primer pair (5’- ATGCCATAGCATTTTTATCC and 5’- ATTTAATCTGTATCAGGC if using the recommended vector listed in Table of Materials). With a microtip end, scratch a picked colony and transfer the cells to 20 µL of reaction mix containing 0.5 µM of each primer and 10 µL of a commercial Taq DNA polymerase mix.
    7. Run the PCR screening according to the following scheme: 5 min at 95 °C as the denaturation step, 30 cycles of 3 steps (30 s at 95 °C, 30 s at 55 °C, 90 s at 72 °C), and 10 min at 72 °C as the final step.
      NOTE: The PCR reactions can be stored overnight in the PCR machine at 12 °C.
    8. Load 10 µL of each PCR reaction on a 0.8% agarose gel prepared in Tris-acetate-EDTA (TAE) buffer. Run the electrophoresis for 25 min at 100 V.
      NOTE: A 1.1 kbp amplicon is expected.
    9. Extract plasmids from candidates using a commercial kit (Table of Materials) and sequence them using the same primer pair used in step 1.1.6.
  2. Cell culture
    NOTE: When a suitable candidate has been identified by sequencing, the clone can be directly used as the expression if using the recommended vector (Table of Materials). In that case, the expression is controlled by the arabinose-inducible PBAD promoter32.
    1. Inoculate 10 mL of LB medium containing 100 µg/mL ampicillin with the candidate and incubate the preculture overnight at 37 °C under orbital shaking. Add 5 mL of the preculture to 1 L of LB medium with 100 µg/mL ampicillin. Mind to respect an air to liquid ratio of 3.
    2. Let cells grow at 37 °C under orbital shaking. Monitor the optical density at 660 nm (OD660).
    3. When OD660 has reached 0.5−0.6, rapidly cool the culture for 5 min on ice and transfer it to an incubator set to 18 °C.
    4. Add 0.2 g/L arabinose to induce gene expression and incubate for 12−18 h at 18 °C.
    5. Harvest cells by centrifuging the culture at 6,000 x g for 30 min at 4 °C. Discard the supernatant and wash cells with 100 mL of 0.9% (w/v) NaCl.
    6. Centrifuge again at 6,000 x g for 15 min at 4 °C and discard the supernatant.
      NOTE: Cell pellets can be used directly for protein extraction or stored at -80 °C.
  3. Protein purification
    1. Resuspend the cell pellets in 40 mL of 50 mM MOPS, 1 mM CoCl2, pH 7.2. Add 1 µL of 25 U/µL DNA/RNA endonuclease and one tablet of protease inhibitor cocktail that does not contain EDTA. Sonicate the suspension in pulse mode under cooling for 30 min.
    2. Centrifuge the crude extract at 20,000 x g for 30 min at 4 °C. Collect the supernatant and heat it in a water bath at 70 °C for 10 min.
    3. Centrifuge the denatured cell extract at 20,000 x g for 30 min at 4 °C and collect the supernatant for purification.
    4. Use suitable anion exchange resin (Table of Materials) packed in a column of ~15 mL of volume. Refer to manufacturer’s recommendations for the working flow rate and column pressure limit. Equilibrate the resin with 50 mM MOPS, 1 mM CoCl2, pH 7.2.
    5. Load the supernatant collected from step 1.3.3 into the column. Monitor the absorbance of the eluate at 280 nm. When it has reached the baseline, proceed to the elution.
    6. Apply a gradient from 0 to 0.5 M NaCl in 50 mM MOPS, 1 mM CoCl2, pH 7.2 for 5 column volumes (CV). Wait till the conductivity is stabilized and the absorbance has reached the baseline.
    7. Apply a final gradient from 0.5 to 1 M NaCl in 50 mM MOPS, 1 mM CoCl2, pH 7.2 for 1 CV.
    8. Analyze some fractions (see Figure 2A for guidance) by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).
      NOTE: TmPep1050 appears as a 36 kDa band after Coomassie staining. Alternatively, the presence of TmPep1050 can be confirmed by activity assay (see section 2.1). At this step, fractions can be stored at 4 °C overnight.
    9. Pool the fractions containing TmPep1050 and add finely ground powder of (NH4)2SO4 to obtain a concentration of 1.5 M (NH4)2SO4. Mix gently by inverting the tube upside down till complete dissolution.
    10. Use hydrophobic interaction resin (Table of Materials) packed in a column of ~30 mL of volume. Refer to manufacturer’s recommendations for the working flow rate and column pressure limit. Equilibrate the resin with 50 mM MOPS, 1.5 M (NH4)2SO4, 1 mM CoCl2, pH 7.2.
    11. Load the sample onto the column and monitor the absorbance of the eluate at 280 nm. When the absorbance has reached the baseline, elute bound proteins by applying a gradient from 1.5 M to 0 M (NH4)2SO4 in 50 mM MOPS, 1 mM CoCl2, pH 7.2 for 5 CV.
    12. Analyze some fractions (see Figure 2B for guidance) by SDS-PAGE.
      NOTE: TmPep1050 appears as a 36 kDa band after Coomassie staining. Alternatively, the presence of TmPep1050 can be confirmed by activity assay (see section 2.1). At this step, fractions can be stored at 4 °C overnight.
    13. Pool the fractions containing TmPep1050 and concentrate to 2 mL using ultrafiltration units with 30 kDa cutoff (Table of Materials). Proceed to section 1.4 to determine the molecular weight.
  4. Size exclusion chromatography
    1. Use size exclusion resin (Table of Materials) packed in a column of ~120 mL of volume. Refer to manufacturer’s recommendations for the working flow rate and column pressure limit. Equilibrate the resin with 50 mM MOPS, 0.5 M (NH4)2SO4, 1 mM CoCl2, pH 7.2.
    2. Load the sample onto the column and monitor the absorbance of the eluate at 280 nm. Fractionate from the column dead volume (~0.33 CV) until the end of the elution (1 CV).
    3. Measure the elution volume for each observed peak.
      NOTE: For guidance, dodecameric TmPep1050 elutes at ~82 mL (Figure 3A) under current experimental conditions, while dimeric TmPep1050, such as the TmPep1050H60A H307A variant, elutes at ~95 mL (Figure 3B). Some TmPep1050 may adopt both oligomeric forms, such as TmPep1050H60A (Figure 3C).
    4. Analyze fractions corresponding to the maxima and tails of observed peaks using SDS-PAGE.
      NOTE: TmPep1050 appears as a 36 kDa band after Coomassie staining.
    5. Pool the fractions of each peak and concentrate using ultrafiltration units with 30 kDa cutoff (Table of Materials) to obtain a concentration of ~300 µM.
    6. Measure the absorbance at 280 nm on a nano-volume spectrophotometer and calculate the concentration using the molecular extinction coefficient of 18,910 M-1 cm-1.
    7. Store the purified protein at -18 °C.
    8. To determine the molecular weight, calibrate the size exclusion chromatography (SEC) column using molecular weight standards (Table of Materials). Analyze the standards using 50 mM MOPS, 0.5 M (NH4)2SO4, 1 mM CoCl2 pH 7.2 as the running buffer.

2. Activity assay and apo-enzyme preparation

NOTE: Originally, the apo-enzyme was prepared by diluting 1 volume of TmPep1050 in 10 volumes of 2.1 M malic acid pH 7.0 and concentrating back to 1 volume prior to dialysis11. Below is presented an alternative procedure using 1,10-phenanthroline, a metal ion chelator. This procedure reduces protein loss and gives the same results than the previously published method.

  1. Activity assay
    1. Prepare a stock solution of 100 mM L-Leucine-p-nitroanilide (Table of Materials) in methanol.
    2. Add 25 µL of 100 mM L-Leucine-p-nitroanilide in 965 µL of 50 mM MOPS, 250 µM CoCl2, pH 7.2, 10% methanol. Preincubate the reaction mix at 75 °C in a dry bath.
    3. Dilute the enzyme in 50 mM MOPS pH 7.2 to a concentration of 1 µM. Add 10 µL to the reaction mix, vortex, and incubate at 75 °C either until it has turned yellowish or for 1 h.
    4. Stop the reaction by adding 1 mL of 20% acetic acid. Vortex well and let it cool down to room temperature.
    5. Transfer the reaction mix in a spectrophotometer cell. Read the absorbance at 410 nm against a negative control (incubated reaction mix without enzyme).
  2. Apo-enzyme preparation
    1. Prepare a stock solution of 1 M 1,10-phenanthroline in ethanol. Add 10 µL of 1,10-phenanthroline stock solution to 890 µL of 50 mM MOPS, 0.5 M (NH4)2SO4, pH 7.2. Add 100 µL of purified TmPep1050 (300 µM−1 mM concentration).
    2. Check the activity loss using the activity assay described in section 2.1 without adding CoCl2 in the reaction mix.
    3. Transfer the sample in a dialysis tube. Dialyze against 200 mL of 50 mM MOPS, 0.5 M (NH4)2SO4, pH 7.2 at 4 °C. Exchange thrice the dialysate with fresh buffer during the 48 h dialysis.
    4. Collect the sample from the dialysis tube and concentrate back to 100 µL using ultrafiltration units with 30 kDa cutoff (Table of Materials). Check the concentration by reading the absorbance at 280 nm using a nano-volume spectrophotometer.
  3. Dimer preparation
    1. Dilute the apo-enzyme to a concentration of 1 µM in 50 mM MOPS, 0.5 M (NH4)2SO4, pH 7.2. Incubate for 2 h at 75 °C in a dry bath, then let the sample cool down to room temperature.
    2. Concentrate the sample to an enzyme concentration of at least 50 µM. Check the molecular weight by SEC (see section 1.4). The elution peak must shift from ~82 mL to ~95 mL (under current experimental conditions).

3. TmPep1050 crystallization

NOTE: Protein crystallization remains an empirical science as it is a multifactorial phenomenon33. While some parameters can be identified and controlled (such as temperature, pH, precipitation agent concentration), others may influence elusively the crystallization (such as protein and chemical purity, proteolysis, sample history). Nowadays protein crystallization is tackled in a rational and systematic manner thanks to a bunch of commercial crystallization screening conditions and automation. The optimization of a crystallization condition, however, relies mostly on a trial-and-error approach. Hereafter are described a blueprint for crystallizing proteins and several tips for optimizing the crystallization conditions.

  1. Crystallization screening
    NOTE: Using commercial crystallization kits, crystals of dodecameric TmPep1050 have been obtained in 2.2 M DL-malic acid pH 7.0, 0.1 M Bis-Tris propane pH 7.0 and 0.18 M tri-ammonium citrate, 20% polyethylene glycol (PEG) 3350. Crystals of dimeric TmPep1050 have been obtained in 0.1 M sodium citrate pH 5.6, 0.2 M ammonium acetate, 30% PEG4000. Crystals of dodecamers appear within a week and reach their full size in a month. Crystals of dimers usually appear within 24 h and grow to full size in a week.
    1. Acquire several commercial crystallization kits (see Table of Materials for examples).
    2. Set up crystallization plates (Table of Materials) for the hanging drop method. Fill the wells with 500 µL of each solution of a crystallization screening kit.
    3. For each well, set up a crystallization support. On the support, deposit a 1 µL drop of purified protein (usually ~10 mg/mL).
    4. Immediately pipet 1 µL of crystallization solution from the well. Add it carefully to the protein drop and mix gently by pipetting upside down thrice. The drop must remain semispherical without any bubbles.
    5. Screw the support on top of the corresponding well. Repeat the operation for the whole kit.
    6. After setting up the plates, observe each drop with a binocular. Refer to the crystallization kit user guide for interpretation (clear drop, phase separation, precipitate, needles, etc.).
    7. Incubate the plates at 20 °C. Check the plates once per day during the first week and once per week afterwards.
    8. Score each well using the score sheet and the user guide provided with the crystallization kits.
  2. Crystallization optimization
    NOTE: The initial crystallization conditions of dodecameric TmPep1050 have been optimized to 2.1 M DL-malic acid pH 6.75 and 0.18 M tri-ammonium citrate pH 7.5, 40% (w/v) PEG3350 while the crystallization condition of dimeric TmPep1050 has been shifted to 0.1 M sodium citrate pH 6.0, 10% (w/v) PEG3350. One cycle of seeding has been necessary to improve crystallinity. Hereafter is described how the crystallization of TmPep1050H60A H307A variant has been optimized.
    1. Prepare stock solutions of 0.5 M sodium citrate buffer at different pH (4.5, 5.2, and 6.0), and 50% (w/v) PEG3350 solution.
    2. Set up a crystallization plate as a matrix of pH vs. precipitation agent (see Figure 4A).
    3. Incubate the plate at 20 °C. Observe each well with a binocular once per day during a week.
    4. Score each well according to crystal size and shape. Select a condition giving crystals of at least 50 µm. Proceed to microseeding.
  3. Microseeding
    NOTE: Microseeding is a powerful method to improve the shape, size and crystallinity of protein crystals34. A faster seeding approach is streak seeding using a cat whisker. See Figure 4 as an example how crystallization optimization and microseeding have improved the crystal shape and size for TmPep1050H60A H307A.
    1. Prepare the seeds using the selected well in step 3.2.4.
    2. Increase the volume of a drop containing crystals to 10 µL by adding crystallization solution from the well. Pipet the drop and add 90 µL of crystallization solution from the well. Vortex thoroughly and keep the seeds on ice.
    3. Prepare several dilutions of the seeds: 1x, 10x, 25x, and 100x. Vortex well the seeds before pipetting. Keep the dilutions on ice.
    4. For each seed dilution, set up a crystallization plate as a matrix of pH vs. precipitation agent (see Figure 4B). Use the stock solutions prepared in step 3.2.1.
    5. When making the drop, add 0.2 µL of seeds for a 2 µL drop. Incubate the plate at 20 °C. Observe each well with a binocular once per day during a week.
      NOTE: Crystal size distribution and shape must be improved, see Figure 4C as an example for TmPep1050H60A H307A. For further uses, seeds can be stored at -20 °C.

4. X-ray diffraction

  1. Crystal picking
    NOTE: Sample preparation depends on the X-ray source facility (home facility vs. synchrotron). Use storage devices (vials and vial-holder basket) accordingly. The addition of cryoprotectant (such as glycerol) may be required depending on salt/precipitation agent concentration. For TmPep1050 crystals, a cryoprotectant is not necessary as PEG or buffer concentration is high enough to avoid water crystals.
    1. Prepare a bath filled with liquid nitrogen, plunge any vials or basket used for sample handling.
    2. Set up sample picking loops of different sizes: 100, 150, and 200 µm (Table of Materials). Choose the sizes according to the crystal size.
    3. Using a binocular, check the drop containing crystals and spot isolated crystals (the easiest to pick). With a loop, gently pick a crystal from the bottom. Immediately plunge the loop in liquid nitrogen and place the loop in a suitable vial.
  2. Data collection
    NOTE: Data collection may vary greatly depending on the X-ray source (home facility vs. synchrotron) and detector sensitivity. The collection strategy may also differ greatly from a sample to another, depending on the resolution, spot intensity, space group, etc. The topic has been extensively reviewed by Dauter35.
    1. Mount the loop carrying the crystal on the goniometer head of the diffractometer.
    2. Tune the goniometer head along XYZ axes to align the crystal with the X-ray beam path.
    3. Set the wavelength to 0.98 Å and move the detector to get 2 Å of resolution.
    4. Start a short data collection by acquiring images in at least two different crystal orientations. Take 10 images (1 image per 0.1°) at 0° and 90°.
    5. Check the collected images with suitable software (e.g., ADXV, XDS-Viewer or Albula Viewer). Determine the spot intensity and the highest resolution where spots are seen. Check also the monocrystallinity and spot separation.
    6. Eventually, repeat steps 4.2.3−4.2.5 by changing the detector position for higher or lower resolution and the exposure time in accordance to the observation.
    7. Start data collection around 360° with 1 image taken per 0.1°. Remember to set the detector position and exposure time optimally.

5. Indexation, molecular replacement and model building

  1. Indexation
    NOTE: Indexation is a method for measuring diffraction spots intensity, giving the amplitudes of structure factors36. Four software packages are commonly used for processing collected images: Mosflm37, HKL200038, DIALS39, and XDS40. The latter has been used for indexing the data sets obtained from TmPep1050 crystal diffraction.
    1. Install XDS package and XDSME41. If processing HDF5 files, install XDS Neggia plugin (available on Dectris website). For more information, visit XDS wiki web page https://strucbio.biologie.uni-konstanz.de/xdswiki/index.php/Main_Page and XDSME web page https://github.com/legrandp/xdsme.
    2. Before processing data, create a folder from where XDS will be run. Locate the path to the images.
    3. To run XDSME, type xdsme /path_to_images/image.extension in a terminal window.
    4. After XDS has ended the job, check the CORRECT.LP file. Note the probability of the space group determination, data completeness, the highest resolution, crystal mosaicity, and data quality. Check also XDS_pointless.log to obtain the likelihood of space groups.
      NOTE: See Figure 5 as an example of output.
    5. Rerun XDSME with different space group solutions proposed by XDS in separate folder to avoid overwriting the previous process. Type xdsme -s space_group_name -c “unit_cell_parameters” /path_to_images/image.extension (e.g., xdsme -s P21 -c “43.295 137.812 61.118 90.000 110.716 90.000).
    6. Check the CORRECT.LP files and choose the best solution based on data statistics.
    7. Run XSCALE by typing xscale.py XDS_ASCII.HKL. Run XDSCONV by typing xdsconv.py XSCALE.HKL ccp4.
      NOTE: In some cases, XDSME fails to identify the space group or fails to cut the resolution range properly or generates weird data statistics. If such a problem is encountered, it is worth to run XDS natively. Several parameters must be introduced in the XDS.INP initiation file (see XDS wiki page). When using XDS, the likelihood of possible space groups can be checked by using Pointless, part of CCP4 package42. To cut the data set resolution, Rmeas < 60% and I/σ ~2 are commonly accepted to determine the highest resolution43. The molecular replacement and model refinement, however, can be improved by extending the resolution to I/σ ~0.5−1.5 and CC1/2 down to 0.2−0.444.
  2. Molecular replacement
    NOTE: Experimental data give access to the amplitude of structural factors but, without knowing the phase, they are useless. The phase can be determined experimentally by different methods relying on an anomalous signal (from a heavy atom, for instance)45. Molecular replacement is another method for determining the phase without an anomalous scattering atom46,47. This method uses the coordinates of a related molecule to find and improve the phase iteratively. We use Phaser48 in Phenix GUI49 for molecular replacement.
    1. Prepare the starting model for molecular replacement using 4P6Y coordinates. From the pdb file, extract the monomer A and truncate its aminoacids in alanine using the PDB file editor in Phenix (under the Model tools tab).
    2. Run Xtriage in Phenix (under the Data analysis tab) with the reflection file generated by XDSCONV (5.1.9) and the sequence as inputs.
    3. Check the log file from Xtriage. Note the completeness, the number of subunits in the asymmetric unit, the anisotropy, the presence of ice rings, and twinning occurrence.
    4. Run Phaser-MR in Phenix (under the Molecular replacement tab) for molecular replacement using the reflection file, the sequence and the starting 4P6Y model truncated in poly alanine (step 5.2.1).
    5. Upon completion, check if a model has been found and the score of the molecular replacement. A translation factor Z-score (TFZ) of at least 8 indicates that the solution is definitively correct.
  3. Model building
    NOTE: After determining the phase by molecular replacement, the model must be built and refined. This protocol uses Phenix GUI49 for automatic building and iterative refinements, and Coot50 for manual structure building and refinement.
    1. After molecular replacement using Phase-MR in Phenix, select Run Autobuild. All the required files will be automatically added. Simply press Run to start autobuild.
    2. Upon completion, check the model in Coot. Build and refine the model manually according the electron density map in Coot.
    3. Refine the manually curated model in Phenix (in the Refinement tab) using the model, the sequence, and the diffraction data as inputs. Refer to Phenix help to choose the right strategy.
    4. After refinement, check the results: Rfree and Rwork must decrease, Molprobity51 indicators must be respected, and outliers with low real-space correlation must be limited.
    5. Repeat steps 5.3.2−5.3.4 until the best refined model is generated.
    6. Run Molprobity on the server: http://molprobity.biochem.duke.edu/. Check any outliers identified by Molprobity.
    7. Eventually repeat steps 5.3.2−5.3.6 until the best refined model is obtained.

Access restricted. Please log in or start a trial to view this content.

Results

To study a possible dodecamer dissociation into monomers in TmPep1050, the His-60 and His-307 codons were replaced by alanine codon using a synthetic gene. This gene was then cloned in pBAD vector for expression and purification of the corresponding TmPep1050 variant subsequently named TmPep1050H60A H307A. Size exclusion chromatography (Figure 3B) showed that the purified protein had an apparent molecular weight of 56 kDa (molecular weight of the monomer being 36.0 kDa). A similar...

Access restricted. Please log in or start a trial to view this content.

Discussion

The protocol described herein allows understanding the dimer-dodecamer transition of TmPep1050 at the structural level. The methodology was experienced previously for determining the structure of both TmPep1050 oligomers11. The most challenging step was to find conditions promoting the dissociation of dodecamers into stable dimers. Such conditions had to be mild enough to permit the reassociation of dimers into dodecamers when the metal ion cofactor was added. The separation of oligomers was also ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

We thank Martine Roovers for proofreading this paper and giving constructive comments. Access to Proxima 2 beamline (SOLEIL synchrotron) was within Block Allocation Groups 20151139.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1,10-phenanthrolineSigma-Aldrich13, 137-7
Amicon Ultra 0.5 ml Centrifugal Filters Ultracel 30KMerck MilliporeUFC503096
Amicon Ultra 15 Centrifugal Filters Ultracel 30KMerck MilliporeUFC903024
Benzonase NucleaseMerck Millipore70664-3
CCP4N/Avisit http://www.ccp4.ac.uk/
cOmplete EDTA-freeRoche5056489001
CootN/Avisit https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
Crystal Screen IHampton ResearchHR2-110
Crystal Screen IIHampton ResearchHR2-112
DreamTaq Green PCR Master MixThermoFisher ScientificK1082
EasyXtal 15-well toolNeXtal132007
Escherichia coli PPY strainN/Asee reference 31
Escherichia coli XL1 blue strainAgilent200249
Gel Filtration Calibration Kit HMWGE Healthcare Life Sciences28-4038-42
Gel Filtration Calibration Kit LMWGE Healthcare Life Sciences28-4038-41
Gel Filtration StandardBiorad1511901
GeneJET Plasmid Miniprep KitThermoFisher ScientificK0503
IndexHampton ResearchHR2-144
LitholoopsMolecular Dimensions
L-leucine-p-nitroanilideBachem AG40010720025
Natrix 1Hampton ResearchHR2-116
Natrix 2Hampton ResearchHR2-117
Neggia pluginDectrisN/Avisit https://www.dectris.com/
NeXtal Tubes JCSG Core Suite INeXtal130724
NeXtal Tubes JCSG Core Suite IINeXtal130725
NeXtal Tubes JCSG Core Suite IIINeXtal130726
NeXtal Tubes JCSG Core Suite IVNeXtal130727
pBAD-TOPOThermoFisher ScientificK430001
PhenixN/Avisit https://www.phenix-online.org/
Phusion High-Fidelity DNA polymeraseThermoFisher ScientificF-530L
Salt RX 1Hampton ResearchHR2-107
Salt RX 2Hampton ResearchHR2-109
SnakeSkin Dialysis Tubing, 3.5K MWCOThermoFisher Scientific88242
Source 15PheGE Healthcare Life Sciences17014702
Source 15QGE Healthcare Life Sciences17094705
Superdex 200 prep gradeGE Healthcare Life Sciences17104301
Thermotoga maritima MSB8 strainAmerican Type Culture CollectionATCC 43589
TmCD00089984DNASU Plasmid RepositoryN/A
XDSN/Avisit http://xds.mpimf-heidelberg.mpg.de/
xdsmeN/Avisit https://github.com/legrandp/xdsme

References

  1. Levy, E. D., Teichmann, S. A. Structural, Evolutionary, and Assembly Principles of Protein Oligomerization. Progress in Molecular Biology and Translational Science. 117, 25-51 (2013).
  2. Selwood, T., Jaffe, E. K. Dynamic dissociating homo-oligomers and the control of protein function. Archives of Biochemistry and Biophysics. 519 (2), 131-143 (2012).
  3. Jaffe, E. K. The Remarkable Character of Porphobilinogen Synthase. Accounts of Chemical Research. 49 (11), 2509-2517 (2016).
  4. Ramström, H., et al. Properties and Regulation of the Bifunctional Enzyme HPr Kinase/Phosphatase in Bacillus subtilis. Journal of Biological Chemistry. 278 (2), 1174-1185 (2003).
  5. Rudyak, S. G., Brenowitz, M., Shrader, T. E. Mg2+-Linked Oligomerization Modulates the Catalytic Activiy of the Lon (La) Protease from Mycobacterium smegmatis. Biochemistry. 40 (31), 9317-9323 (2001).
  6. Yamamoto, S., Storey, K. B. Dissociation-Association of lactate dehydrogenase Isozymes: Influences on the formation of tetramers vs. dimers of M4-LDH and H4-LDH. International Journal of Biochemistry. 20 (11), 1261-1265 (1988).
  7. Sirover, M. A. Structural analysis of glyceraldehyde-3-phosphate dehydrogenase functional diversity. The International Journal of Biochemistry & Cell Biology. 57, 20-26 (2014).
  8. Gupta, V., Bamezai, R. N. K. Human pyruvate kinase M2: A multifunctional protein: Multifunctional Human PKM2. Protein Science. 19 (11), 2031-2044 (2010).
  9. Wiegand, G., Remington, S. J. Citrate synthase: Structure, Control, and Mechanism. Annual Review of Biophysics and Biophysical Chemistry. 15, 97-117 (1986).
  10. Libonati, M., Gotte, G. Oligomerization of bovine ribonuclease A: structural and functional features of its multimers. Biochemical Journal. 380 (2), 311-327 (2004).
  11. Dutoit, R., et al. How metal cofactors drive dimer-dodecamer transition of the M42 aminopeptidase TmPep1050 of Thermotoga maritima. Journal of Biological Chemistry. 294 (47), 17777-17789 (2019).
  12. Rawlings, N. D., et al. The MEROPS database of proteolytic enzymes, their substrates and inhibitors in 2017 and a comparison with peptidases in the PANTHER database. Nucleic Acids Research. 46 (1), 624-632 (2018).
  13. Neuwald, A. F., Liu, J. S., Lipman, D. J., Lawrence, C. E. Extracting protein alignment models from the sequence database. Nucleic Acids Research. 25 (9), 1665-1677 (1997).
  14. Dutoit, R., Brandt, N., Legrain, C., Bauvois, C. Functional Characterization of Two M42 Aminopeptidases Erroneously Annotated as Cellulases. PLoS ONE. 7 (11), 50639(2012).
  15. Franzetti, B., et al. Tetrahedral aminopeptidase: a novel large protease complex from archaea. The EMBO Journal. 21 (9), 2132-2138 (2002).
  16. Borissenko, L., Groll, M. Crystal Structure of TET Protease Reveals Complementary Protein Degradation Pathways in Prokaryotes. Journal of Molecular Biology. 346 (5), 1207-1219 (2005).
  17. Appolaire, A., et al. TET peptidases: A family of tetrahedral complexes conserved in prokaryotes. Biochimie. 122, 188-196 (2016).
  18. Russo, S., Baumann, U. Crystal Structure of a Dodecameric Tetrahedral-shaped Aminopeptidase. Journal of Biological Chemistry. 279 (49), 51275-51281 (2004).
  19. Schoehn, G., et al. An Archaeal Peptidase Assembles into Two Different Quaternary Structures: A tetrahedron and a giant octahedron. Journal of Biological Chemistry. 281 (47), 36327-36337 (2006).
  20. Durá, M. A., et al. The structural and biochemical characterizations of a novel TET peptidase complex from Pyrococcus horikoshii reveal an integrated peptide degradation system in hyperthermophilic Archaea: Characterization of P. horikoshii TET3 peptidase. Molecular Microbiology. 72 (1), 26-40 (2009).
  21. Basbous, H., Appolaire, A., Girard, E., Franzetti, B. Characterization of a Glycyl-Specific TET Aminopeptidase Complex from Pyrococcus horikoshii. Journal of Bacteriology. 200 (17), 00059(2018).
  22. Appolaire, A., et al. Small-angle neutron scattering reveals the assembly mode and oligomeric architecture of TET, a large, dodecameric aminopeptidase. Acta Crystallographica Section D Biological Crystallography. 70 (11), 2983-2993 (2014).
  23. Appolaire, A., et al. The TET2 and TET3 aminopeptidases from P yrococcus horikoshii form a hetero-subunit peptidasome with enhanced peptide destruction properties: TET aminopeptidase multi-subunit complex. Molecular Microbiology. 94 (4), 803-814 (2014).
  24. Colombo, M., Girard, E., Franzetti, B. Tuned by metals: the TET peptidase activity is controlled by 3 metal binding sites. Scientific Reports. 6 (1), 20876(2016).
  25. Petrova, T. E., et al. Structure of the dodecamer of the aminopeptidase APDkam598 from the archaeon Desulfurococcus kamchatkensis. Acta Crystallographica Section F Structural Biology Communications. 71 (3), 277-285 (2015).
  26. Kim, D., et al. Structural basis for the substrate specificity of PepA from Streptococcus pneumoniae, a dodecameric tetrahedral protease. Biochemical and Biophysical Research Communications. 391 (1), 431-436 (2010).
  27. Chevrier, B., et al. Crystal structure of Aeromonas proteolytica aminopeptidase: a prototypical member of the co-catalytic zinc enzyme family. Structure. 2, 283-291 (1994).
  28. Rosenbaum, E., Ferruit, M., Durá, M. A., Franzetti, B. Studies on the parameters controlling the stability of the TET peptidase superstructure from Pyrococcus horikoshii revealed a crucial role of pH and catalytic metals in the oligomerization process. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics. 1814 (10), 1289-1294 (2011).
  29. Macek, P., et al. Unraveling self-assembly pathways of the 468-kDa proteolytic machine TET2. Science Advances. 3 (4), 1601601(2017).
  30. Edelheit, O., Hanukoglu, A., Hanukoglu, I. Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies. BMC Biotechnology. 9 (1), 61(2009).
  31. Zhang, Y., Werling, U., Edelmann, W. SLiCE: a novel bacterial cell extract-based DNA cloning method. Nucleic Acids Research. 40 (8), 55(2012).
  32. Schleif, R. AraC protein, regulation of the l-arabinose operon in Escherichia coli, and the light switch mechanism of AraC action. FEMS Microbiology Reviews. 34 (5), 779-796 (2010).
  33. McPherson, A., Gavira, J. A. Introduction to protein crystallization. Acta Crystallographica Section F Structural Biology Communications. 70 (1), 2-20 (2014).
  34. Bergfors, T. Seeds to crystals. Journal of Structural Biology. 142 (1), 66-76 (2003).
  35. Dauter, Z. Collection of X-Ray Diffraction Data from Macromolecular Crystals. Protein Crystallography. 1607, 165-184 (2017).
  36. Powell, H. R. X-ray data processing. Bioscience Reports. 37 (5), 0227(2017).
  37. Battye, T. G. G., Kontogiannis, L., Johnson, O., Powell, H. R., Leslie, A. G. W. iMOSFLM a new graphical interface for diffraction-image processing with MOSFLM. Acta Crystallographica Section D Biological Crystallography. 67 (4), 271-281 (2011).
  38. Otwinowski, Z., Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Methods in Enzymology. 276, 307-326 (1997).
  39. Clabbers, M. T. B., Gruene, T., Parkhurst, J. M., Abrahams, J. P., Waterman, D. G. Electron diffraction data processing with DIALS. Acta Crystallographica Section D Structural Biology. 74 (6), 506-518 (2018).
  40. Kabsch, W. XDS. Acta Crystallographica Section D Biological Crystallography. 66 (2), 125-132 (2010).
  41. Legrand, P. legrandp/xdsme: March 2019 version working with the latest XDS version. , Jan 26, 2018. Zenodo (2019).
  42. Evans, P. Scaling and assessment of data quality. Acta Crystallographica Section D Biological Crystallography. 62 (1), 72-82 (2006).
  43. Wlodawer, A., Minor, W., Dauter, Z., Jaskolski, M. Protein crystallography for non-crystallographers, or how to get the best (but not more) from published macromolecular structures: Protein crystallography for non-crystallographers. FEBS Journal. 275 (1), 1-21 (2008).
  44. Karplus, P. A., Diederichs, K. Assessing and maximizing data quality in macromolecular crystallography. Current Opinion in Structural Biology. 34, 60-68 (2015).
  45. Taylor, G. L. Introduction to phasing. Acta Crystallographica Section D Biological Crystallography. 66 (4), 325-338 (2010).
  46. Rossmann, M. G., Blow, D. M. The detection of sub-units within the crystallographic asymmetric unit. Acta Crystallographica. 15, 24-31 (1962).
  47. Rossmann, M. G. The molecular replacement method. Acta Crystallographica Section A Foundations of Crystallography. 46 (2), 73-82 (1990).
  48. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40 (4), 658-674 (2007).
  49. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D Biological Crystallography. 66 (2), 213-221 (2010).
  50. Emsley, P., Lohkamp, B., Scott, W. G., Cowtan, K. Features and development of Coot. Acta Crystallographica Section D Biological Crystallography. 66 (4), 486-501 (2010).
  51. Chen, V. B., et al. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallographica Section D Biological Crystallography. 66 (1), 12-21 (2010).
  52. Zwart, P. H., Grosse-Kunstleve, R. W., Lebedev, A. A., Murshudov, G. N., Adams, P. D. Surprises and pitfalls arising from (pseudo)symmetry. Acta Crystallographica Section D Biological Crystallography. 64 (1), 99-107 (2008).
  53. Yeates, T. O. Detecting and overcoming crystal twinning. Methods in Enzymology. 276, 344-358 (1997).
  54. Terwilliger, T. C. Using prime-and-switch phasing to reduce model bias in molecular replacement. Acta Crystallographica Section D Biological Crystallography. 60 (12), 2144-2149 (2004).
  55. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D Biological Crystallography. 64 (1), 61-69 (2008).
  56. Krissinel, E., Henrick, K. Inference of Macromolecular Assemblies from Crystalline State. Journal of Molecular Biology. 372 (3), 774-797 (2007).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Dodecamer PurificationDimer PreparationSize Exclusion ChromatographyMolecular ReplacementPhenix RefinementNative Mass Spectrometry