Determinare profili di espressione genetica in C. elegans Utilizzo Microarray e Real-time PCR

Biology
 

Summary

Analisi microarray è stato condotto per determinare profili di espressione genetica

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Sinapsi sono composti da una zona presinaptica attivo nella segnalazione cellulare e un terminale postsinaptici nella cella di destinazione. Nel caso di sinapsi chimiche, i messaggi vengono trasportati da neurotrasmettitori rilasciati dai terminali presinaptici e ricevuti dai recettori sulle cellule postsinaptici. Le nostre ricerche precedenti in Caenorhabditis elegans ha dimostrato che VSM-1 regola negativamente esocitosi. Inoltre, l'analisi di sinapsi in VSM-1 mutanti hanno mostrato che gli animali privi di una connettività completamente funzionale VSM-1 sono aumentati sinaptica. Sulla base di questi risultati preliminari, abbiamo ipotizzato che C. elegans VSM-1 può giocare un ruolo cruciale nella sinaptogenesi. Per verificare questa ipotesi, a doppio etichettati analisi microarray è stata eseguita, e profili di espressione genica sono stati determinati. In primo luogo, l'RNA totale è stato isolato, inversamente trascritto in cDNA, e ibridato al DNA microarray. Poi, in silico-analisi di ibridazione sonda fluorescente rivelato induzione significativo di molti geni che codificano per i membri della famiglia principali proteine ​​dello sperma (MSP) in mutanti con sinaptogenesi migliorata. MSP è il principale componente di sperma in C. elegans e sembrano segnale maturazione degli ovociti nematodi e l'ovulazione. Nel moscerino della frutta, Chai e colleghi hanno dimostrato che 1 MSP-come le molecole regolano il numero e la dimensione bouton presinaptica a livello della giunzione neuromuscolare. Inoltre, l'analisi eseguita da Tsuda e collaboratori due suggerito che MSP può agire come leganti per i recettori Ef e innescare tirosin-chinasi del recettore cascate di segnalazione. Infine, l'analisi PCR in tempo reale corroborata che il gene che codifica per MSP-32 è indotta a VSM-1 (ok1468) mutanti. Nel loro insieme, la ricerca effettuata dal nostro laboratorio ha dimostrato che VSM-1 mutanti hanno un significativo aumento della densità sinaptica, che potrebbe essere mediata da MSP-32 di segnalazione.

Protocol

1. Isolamento di RNA totale

  1. Sano nematodi sincronizzato sono state raccolte mediante lavaggio piatti con temperatura ambiente di media M9, ​​utilizzando 2-3 ml per piastra. Nematodi risospesi sono stati trasferiti in provette da 15 ml e giù pellettati per centrifugazione, 3200 g a 4 ° C per 4 minuti. Nematodi raccolti stati ripuliti da batteri, avanzata dal risospendere il pellet con 7 ml di NaCl 0,1 M e 7 ml di ghiaccio freddo al 60% w / v di saccarosio. La miscela è stata incubata risospeso in ghiaccio per 15 minuti e nematodi pulita, che swim-up attraverso la soluzione di saccarosio, sono state raccolte dopo centrifugazione la miscela a 3200 g a 4 ° C per 4 minuti. Priva di batteri vermi sono stati trasferiti in una nuova provetta conica con pipette sterili e lavati due volte con un massimo di 15 ml di acqua RNase-free seguito da una centrifugazione 3200 g a 4 ° C per 2 minuti. Il pellet pulito poco compatti è stato trasferito a 1,5 ml di tubo microcentrifuga e centrifugato alla massima velocità (circa 10.000 g) per 30 secondi. Infine, la maggior parte acqua RNase-free è stato rimosso e 10 volumi di RNAlater è stato aggiunto al pellet, e conservato a 4 ° C fino al momento di procedere.
  2. Per preparare i campioni di RNA totale, nematodi raccolti sono stati centrifugati a velocità massima (circa 10.000 g) per 4 minuti e RNAlater è stata scartata. Poi, un pizzico di resina Molecolare Rettifica (bioscienze G) è stato aggiunto al pellet e la miscela è stata congelata con azoto liquido. Sospensione verme congelato è stato macinato in una polvere fine e pestello con azoto liquido è stato aggiunto come necessario per mantenere la polvere fredda. Dopo la rettifica, l'estratto è stato tenuto in ghiaccio per 5 minuti e poi mescolata con 700 microlitri RLT / BME (rapporto tra volume di 100 RLT: 1 volume di BME) (Qiagen) e 472 microlitri di etanolo al 100%.
  3. L'RNA totale è stato isolato utilizzando il kit RNeasy Mini (Qiagen) e seguendo il protocollo consigliati dal produttore. Volume finale di RNA isolato era di 60 microlitri per ogni campione biologico.

2. Digestione del DNA e RNA Cleanup

  1. 50 mg di RNA totale potenzialmente contaminati con il DNA genomico è stato digerito con DNasi I (Qiagen). Reazioni Digest contenente 0,1 U DNasi / 1 mg di RNA e 1X tampone PSR sono state incubate a temperatura ambiente per 10 minuti.
  2. Campioni di RNA trattato con DNasi I sono stati puliti-up utilizzando la RNeasy MinElute Clean-Up Kit (Qiagen). Protocolli raccomandati dal produttore sono stati seguiti e 60 microlitri volume finale eluizione è stato ottenuto.

3. Analisi qualitativa e quantitativa di RNA

  1. Concentrazione di RNA è stato determinato utilizzando il NanoDrop spettrofotometro UV (Thermo Scientific).
  2. L'integrità dei campioni di RNA è stata valutata mediante elettroforesi di agarosio. In breve, 1% RNasi-free gel di agarosio sono stati preparati utilizzando 1X Nord Max Gly Gel Prep / tampone di corsa (Ambion), 1% RNasi-free Agarosio LE (Ambion) e 0,5 mg / ml di bromuro di etidio. Mentre il gel è stato polimerizzazione, campioni di RNA sono stati glyoxylated aggiungendo 5 ml di campione Glyoxyl colorante di caricamento / campione e campioni di incubazione a 50 ° C per 30 minuti. Scaletta RNA è stato anche glyoxylated e caricato per comparazione delle taglie.

4. Sintesi di cDNA

  1. Per ogni reazione di sintesi, 8,4 mg di RNA del campione è stato miscelato con 1 iniettore microlitri RT (1 pmole / mL). Un campione (WT o mutanti) ha ricevuto il Cy5 fondo catturare RT, l'altro campione ha ricevuto il Cy3 fondo catturare RT (fornito con il Array 350 Etichettatura-Detection Kit, Genisphere). Miscele campione sono stati riscaldati a 75-80 ° C per 10 minuti e trasferiti al ghiaccio per 2-3 minuti.
  2. Mentre l'RNA campioni incubare, il MasterMix (Genisphere) è stato preparato come segue: per ogni reazione di RT, abbiamo unito quattro microlitri tampone di reazione 5X per RT, 1 dNTP microlitri (10 mm ciascuno dATP, dCTP, dGTP, dTTP), 1 Superase microlitri -In RNasi inibitore (fornito con il Array 350 Etichettatura-Detection Kit, Genisphere), 1 ml RT Enzima (200 U / mL). Ultimo, 7 ml di MasterMix è stato aggiunto a ciascun campione di RNA, delicatamente mescolato (non utilizzare vortice) e incubate 2 ore a 42 ° C.

5. La degradazione dell'RNA e purificazione di campioni di cDNA

  1. sintesi del cDNA è stato fermato con l'aggiunta di 3,5 microlitri NaOH/50mM 0.5M EDTA (concentrazione finale) e incubati a 65 ° C per 15 minuti. Poi, le reazioni sono state neutralizzate con 1M Tris-HCl, pH 8,0 a raggiungere una concentrazione finale di 850 mM Tris-HCl. Infine, WT e cDNA mutanti sono stati combinati in una sola provetta. Il tubo vuoto è stato risciacquato con 73 microlitri di buffer TE 1X e ha aggiunto al tubo contenente cDNA, il volume finale del tubo combinato cDNA era di 130 microlitri.
  2. CDNA misto è stato purificato successivo protocollo del produttore e la Purificazione QIAquick PCR Kit (Qiagen). Il volume risultante eluizione di purificazione del DNA era di 60 microlitri.

6. In primo luogo Microarray ibridazione

  1. C. elegans microarray diapositive ottenute attraverso GCAT (Genome Consortium per la didattica attiva) sono stati bloccati atemperatura ambiente per 1 ora con 0,1 mg / ml sonicato DNA dello sperma di salmone 3X SSC, 0,1% SDS. Scivoli bloccati sono stati sciacquati per immersione in ddH2O e spin-essiccato mediante centrifugazione per 1 minuto a 2.000 g in 50 ml provette coniche con KimWipe in fondo.
  2. Poi, 2X formammide-based buffer di ibridazione (Genisphere) è stata incubata a 55 ° C per 10 minuti, mescolando con cura per sciogliere i cristalli e centrifugati per 1 minuto a 10.000 g. Successivamente, un campione di 25 microlitri di cDNA è stato gentilmente mixato da sfogliando con 25 microlitri della 2X formammide-based buffer di ibridazione. CDNA diluito campione è stato raccolto da girare flash per 15 secondi e incubate a 80 ° C per 10 minuti.
  3. Scorso, è stato ibridato cDNA microarray per far scorrere con attenzione l'intero pipettamento campione riscaldato cDNA senza toccare la diapositiva. Il campione è stato uniformemente diffusa sul microarray con delicatezza abbassando un vetrino utilizzando un ago di siringa. Prima che la polizza di copertura era completamente abbassata, la polizza di copertura era tirato indietro, poi abbassato con l'ago di nuovo, e lasciato cadere dolcemente in posizione, riducendo al minimo la formazione di bolle d'aria. Ibridazione primo set up era culminata mettendo la diapositiva orizzontalmente in un tubo da 50 ml coniche con 50 ml di DDH 2 O sotto la diapositiva e incubate overnight a 37 ° C.

7. Ibridazione secondo

  1. Microarray ibridato sono stati lavati con 2X SSC a varie temperature. In primo luogo, scivoli microarray sono stati trasferiti in provette coniche contenenti temperatura ambiente SSC 2X e 0,2% SDS e agitò delicatamente per rimuovere coprioggetto. Poi, scivoli microarray sono stati trasferiti in provette coniche contenenti 55 ° C 2X SSC e 0,2% SDS e incubate a 55 ° C per 15 minuti. Successivamente, diapositive sono stati trasferiti a 2X SSC e incubate a temperatura ambiente per 15 minuti, agitando delicatamente periodicamente. Ultimo, scivoli sono stati trasferiti a 0,2 X SSC e incubate per 15 minuti a temperatura ambiente agitando delicatamente periodicamente. Diapositive sono stati lavati spin-secco con l'introduzione dell'etichetta rivolto verso il basso le diapositive di 50 ml provette coniche con un KimWipe sul fondo e centrifugato per 1 minuto a 2000 g.
  2. Successivamente, miscela di ibridazione secondo è stato preparato utilizzando 2X formammide tampone a base di ibridazione (Genisphere). Buffer di ibridazione è stata incubata a 55 ° C per 10 minuti e centrifugati per 1 minuto a 10.000 g. Cattura i reagenti fluorescenti (Cy3 e Cy5) e l'anti-fade reagenti sono stati scongelati a temperatura ambiente e coperto con un foglio per evitare che i reagenti da photobleaching. Ibridazione passi seguenti sono state eseguite al buio per minimizzare l'esposizione alla luce. 150 ml di 2X formammide tampone a base di ibridazione è stato combinato con 1,5 microlitri anti-sbiadimento reagente a fare l'anti-fade-trattati miscela di ibridazione.
  3. Cattura i reagenti sono in agitazione Cy3 e Cy5 per 3 secondi e centrifugato per 15 secondi, 10.000 g. Miscela di ibridazione secondo è stato preparato unendo 75 microlitri anti-sbiadimento trattati con miscela di ibridazione, 60 microlitri acqua priva di nucleasi, 7,5 microlitri Cy3 reagente di cattura, e 7,5 microlitri Cy5 reagente di cattura. Mix di ibridazione seconda è stata incubata per 10 minuti a 75 ° C e 50 ml di miscela riscaldata era pipettati con molta attenzione sul lavati / asciugato scivolo microarray. Per diffondere uniformemente il campione attraverso la microarray, una scivolata copertina è stata leggermente abbassata usando un ago di siringa. Prima che la polizza di copertura era completamente abbassata, la polizza di copertura era tirato indietro, poi abbassato con l'ago di nuovo, e lasciato cadere dolcemente in posizione, riducendo al minimo la formazione di bolle d'aria. Ibridazione microarray scivolo era posta orizzontalmente in 50 ml di tubo conico ricoperto di un foglio e 50 ml di DDH 2 O è stato aggiunto sotto la diapositiva per creare una camera umida. Ibridazione seconda è stata incubata a 37 ° C per 2-5 ore.
  4. Seconda ibridazione microarray è stato lavato al buio con temperatura ambiente 2X SSC, 0,2% SDS, 1 mM DTT e agitò delicatamente per rimuovere scivolare coperchio. Poi, microarray è stato trasferito al coperto tubo conico contenente 55 ° C 2X SSC, 0,2% SDS, 1 mM DTT e incubate per 15 minuti a 55 ° C. Quindi, far scorrere è stato trasferito al coperto tubo conico contenente 2X SSC, 1 mM DTT e incubate per 15 minuti a temperatura ambiente agitando delicatamente periodicamente. Ultimo, scivolo è stato trasferito a 0,2 X SSC, 1 mM DTT e incubate a temperatura ambiente per 15 minuti, agitando delicatamente periodicamente. Scivolo microarray è stato asciugato per centrifugazione per 1 minuto, 2.000 g, far scorrere l'etichetta rivolta verso il basso in coperta tubo da 50 ml coniche con KimWipe sul fondo. Diapositive microarray a secco sono stati esaminati utilizzando GenePix personali 4100A modello di scanner al Davidson College.

8. Microarray Analysis

  1. Immagini ottenute dopo la scansione, sono stati analizzati utilizzando il software sviluppato MAGICTool al Davidson College di Laurie Heyer ei suoi studenti universitari. In breve, sotto la scheda "Progetto", un "Nuovo progetto" è stato creato e salvato. Sotto la "Build profilo di espressione" scheda "Immagine Coppia di carico" è stato selezionato il file immagine e rosso (_635.tif) è stato caricato come "Red" e il file immagine verde (_532.tif) è stato caricato come "verde". Quindi, utilizzando il "Build profilo di espressione" scheda e "Lista Gene Load", una C. file di gene elegans lista ottenuti dal sito web GCAT è stato caricato.
  2. Immagine microarray è stato affrontato e griglia con il "Build profilo di espressione" scheda e "Crea / Modifica griglia" opzione. "Setup Grid" finestra di dialogo è stata modificata utilizzando "48" per il numero di griglie, "22 righe" e "22 colonne" per ogni griglia, punti numerati "Sinistra a Destra" e "Top to Bottom". "Cambia contrasto Percentuale" è stata aumentata e lo zoom sulla griglia fino a quando i punti individuali erano facilmente distinguibili. Le griglie sono state create selezionando prima "Set Top Spot di sinistra" sul pannello a sinistra. Poi, il centro del punto in alto a sinistra, alto punto giusto e riga in basso sono stati cliccato su "Rete 1". Gridding Questa procedura è stata ripetuta per ciascuna delle 48 reti, procedendo da sinistra a destra e dall'alto in basso. Quando gridding è stato completato, la corrente di rete è stato salvato sotto "File" "Salva Corrente di Griglia con nome". Quando la griglia è stato salvato con successo la scheda "Finito" è stato selezionato.
  3. Per eliminare tutti i punti non correlati dall'analisi, il "Build profilo di espressione" scheda è stata aperta. Nella sezione "Affrontare gridding" "Spot Segnalazione" opzione è stata selezionata. Macchie o striato fluorescenza di fondo sono stati segnalati e salvati selezionando "Salva Bandiere corrente come" sotto la scheda "File".
  4. I file segnalati sono stati segmentati utilizzando il "Build profilo di espressione" scheda e selezionando "Raggio fisso" come metodo di segmentazione di scelta. Il raggio è stata impostata la dimensione desiderata, e "di aggiornamento dei dati" è stato cliccato. Per assicurarsi che il cerchio rimane dentro l'area griglia (giallo quadrati) si scorre verso il basso e da sinistra a destra e una volta selezionato "Crea profilo di espressione" è stato selezionato.
  5. Durante la segmentazione, il software calcola il Rosso: rapporti di fluorescenza verde per ciascuno dei punti che sono rimasti dopo la bandiera. Utilizzando la scheda "Expression", "manipolare i dati" "Trasforma" è stato selezionato. Un "Trasforma dati" nella finestra di dialogo in cui è apparso "logb (x)" opzione e b = 2 è stato inserito. "File Espressione di lavoro" è stata esplorata dalla scheda "Expression". Per un esperimento in cui il tipo selvatico ha ricevuto la (verde) sequenza di catturare Cy3 e il mutante ha ricevuto il Cy5 (rosso) sequenza di acquisizione, il valore dei rapporti accedere trasformato erano positivi per i geni che sono stati indotti e negative per i geni repressi.
  6. Ultimo, i geni indotti o repressi da un fattore specifico sono stati analizzati selezionando "Esplora" nella scheda "Expression". Nella finestra di "Esplorazione" dialogo "Trova geni dei criteri di abbinamento" è stato impostato su geni con un "max. Valore> X (numero positivo per i geni indotti)" o "min. Value <X (numero negativo per i geni repressi)" in esperimenti come quello descritto in # 5. Fold-espressione era pari a 2x, dove 'x' è il valore del numero inserito nei criteri di selezione.

9. Sintesi di cDNA e Real-Time PCR

  1. L'RNA totale è stato isolato come descritto in precedenza. Una volta che la qualità e la quantità di RNA isolato è stato determinato, cDNA è stato sintetizzato utilizzando il kit iScript sintesi del DNA (BioRad), 500 RNA ng / mL totale isolato dal wild-type e mutanti, e protocolli consigliati dal produttore.
  2. In tempo reale le reazioni PCR sono stati set-up utilizzando la iQ SYBR Green Supermix (BioRad), 100-500 nmoli primer gene specifico (tabella 1) e 4 cDNA microlitri prodotto dal passo precedente. 10 reazioni microlitri sono stati eseguiti utilizzando il termociclatore CFX96 Real-Time System (BioRad).
  3. Il termociclatore è stato riscaldato a 95 ° C per 3 minuti. Questo è stato seguito da un passo a 95 ° C per 5 secondi e 58 ° C per 30 secondi. Questo ciclo è stato completato un totale di quaranta volte, e A ° 65-95 curva C si fondono con un dislivello di 0,5 gradi è stata inserita. ΔΔCT valori sono stati calcolati utilizzando tre geni housekeeping (atto-1, cdc-42, e pmp-3) come controlli.
GENE PRIMER AVANTI PRIMER REVERSE
gst-5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
gst-9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl-1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR-2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
lim-9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
lpr-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
MES-6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
MSP-32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
MSP-142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
MSP-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
MSP-45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
MSP-49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
MSP-56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

Tabella 1. Marcia avanti e retromarcia sequenze Primer per Real-Time PCR

10. Rappresentante dei risultati:

RNA isolamento e analisi

Fusione di vescicole attivo precursore della zona presso i siti presinaptico è un passo obbligatorio durante la sinaptogenesi (3). VSM-1, di recente individuato v-SNARE proteine ​​maestro, è stata proposta per inibire la fusione delle vescicole nel lievito e sinaptogenesi nei nematodi (vedi Figura 1) da un meccanismo indeterminato (4, e il nostro lavoro non pubblicato). Per comprendere meglio il percorso molecolare alla base VSM-1 del regolamento nei nematodi e portare un po 'di luce nel campo sinaptogenesi, abbiamo iniziato un genoma a livello di schermo e ha stabilito che grandi geni delle proteine ​​dello sperma (MSP) sono indotti in assenza di completamente funzionale VSM-1 .

Per studiare i geni indotti nel ceppo VSM-1 (ok1468) mutante di C. elegans, abbiamo condotto una analisi gene microarray. Ciò è stato fatto da test trascrizioni isolati da wild-type e la VSM-1 ceppo mutante e determinare il loro arricchimento. In particolare, per prima cosa isolato l'RNA totale da sincrono L4 e L3 wild-type e VSM-1 nematodi larve mutanti. Poi, abbiamo trattato l'RNA totale ottenuto con DNasi I e ha esaminato la qualità del RNA estratto mediante elettroforesi su gel di agarosio. Nell'esperimento mostrato in figura 2, una scala è stato utilizzato in prima corsia per rappresentare il numero di coppie di basi per gli standard. Campioni di tipo selvatico pre-trattati e post-trattamento con DNasi I sono stati caricati in corsia 2 e 4, e VSM-1 campioni mutante pre-trattati e post-trattamento con DNasi I sono stati caricati nelle corsie 3 e 5, rispettivamente. Analisi di gel elettroforesi di RNA hanno dimostrato che tipo selvatico e VSM-1 mutante campioni di RNA erano intatti e di buona qualità. Questo è stato determinato osservando due bande che hanno rappresentato le due subunità di RNA ribosomiale.

Microarray di ibridazione

Una volta che la qualità dell'RNA è stata determinata, si è proceduto con la sintesi del DNA. Per farlo, abbiamo la trascrizione inversa dell'mRNA e ha aggiunto una sequenza di acquisizione per la coda. Il cDNA prodotto contenente sequenze di acquisizione per Cy3 e Cy5 sono stati ibridizzati di microarray diapositive e espulso per la scansione. Immagini microarray sono stati poi inseriti in un programma di software aperto source chiamato MAGICTool sviluppato al Davidson College di Laurie Heyer ei suoi studenti universitari. Utilizzando questo software abbiamo sovrapposto Cy3 e Cy5 immagini, microarray griglia, e analizzati profili di fluorescenza (vedi Figura 3). Una volta gridding era completa poi abbiamo segmentato ogni quadrato individuo assicurandosi che il oligonucleotide tutto è stato stampato in esame. Poi abbiamo analizzato i rapporti di indotto e creato espressioni profilo genetico mostrando che i geni che codificano per la famiglia MSP sono indotti a nematodi con sinaptogenesi migliorata. (Tabella 3).

Validazione e la quantificazione di espressione genica mediante PCR in tempo reale.

Per comprendere ulteriormente il profilo genetico del VSM-1 mutante abbiamo analizzato una serie di geni che codificano per i membri della famiglia MSP con PCR in tempo reale. In primo luogo, l'RNA totale è stato isolato da ceppi wild-type e VSM-1 (ok1468) mutante. Campioni di RNA sono stati poi inversamente trascritto in cDNA e utilizzato per l'analisi PCR in tempo reale. Le valutazioni in tempo reale di profili di espressione di PCR ha dimostrato che un membro della famiglia MSP sembra essere indotta in VSM-1 (ok1468) mutanti. Inoltre, PCR in tempo reale dei dati convalida risultatida microarray e ristretto la ricerca a un candidato gene msp (Figura 4).

Figura 1
Figura 1. A. UNC-17 immunocolorazione rivelato che VSM-1 mutanti mostrano maggiore densità sinaptica lungo il cordone nervoso dorsale. Le immagini sono state analizzate con ingrandimento 63x, posteriore (a destra) alla vulva. B. Analisi di WT e VSM-1 (ok1468) sinapsi mutante denotato statisticamente significativa densità maggiore sinaptica nel VSM-1 mutante (** p <0,01). Venti nematodi sono immagini per ogni genotipo.

Figura 2
Figura 2. La qualità del RNA estratto è stato determinato mediante elettroforesi su gel di agarosio. La presenza di due subunità ribosomiale intatta prima e dopo il trattamento con DNasi I è stato evidente in RNA estratto da campioni di tipo selvatico e VSM-1 (ok1468).

Figura 3
Figura 3. A. Immagine microarray per un esperimento in cui è stato etichettato il controllo rosso (Cy5) e il mutante VSM-1 è stato etichettato verde (Cy3). B. immagine rappresentante visualizzato 1 su 48 griglie analizzato per microarray. Ogni piccola piazza su una griglia è rappresentativo di un oligonucleotide unico foglio stampato, e ogni griglia è composta da 22 righe e 22 colonne.

Tabella 2
Tabella 2. Microarray analisi dei trascritti isolati da larve 4 (A) e le larve 3 (B) C. nematodi elegans ha dimostrato che i geni che codificano per le proteine ​​dello sperma principali sono indotti in mutanti con sinaptogenesi migliorata. Geni evidenziato indica geni indotti in entrambe le larve 3 e 4 larve.

Figura 4
Figura 4. Real-Time PCR ha dimostrato che un membro della famiglia genica msp, msp -32 è stata indotta in VSM-1 (ok1468) mutanti. Rappresentante grafico normalizzato espressione piega mostra che il vms-1 (ok1468) valori ΔΔCT per MSP-32 sono significativamente differenti rispetto ai wild-type (WT) e tre geni housekeeping sono utilizzati per la normalizzazione (atto-1, cdc-42, e pmp -3). Media di tre repliche sono tracciati + / - deviazione standard.

Discussion

In questo studio abbiamo sviluppato un semplice protocollo facile da usare che può essere usato per determinare profili di espressione genica di base vari fenomeni biologici. In questo protocollo, l'RNA totale è stato isolato e trattato con DNasi I. Il nostro metodo di isolamento dell'RNA è stata notevolmente semplificata dall'eliminazione fenolo e l'utilizzo di resine affinità per ripulire 5,6. In breve, C. elegans cuticule membrane cellulari e sono state incrinate, aperto da nematodi congelamento con azoto liquido e rettifica con resina molecolare. Successivamente, l'RNA estratto è stato trattato con DNasi I prima sintesi del DNA. Il passaggio successivo è stato aggiunto a minimizzare ibridazioni aspecifiche; campioni di RNA contaminato da DNA genomico potrebbe introdurre interferenze e producono molti falsi positivi. Poi, tipo selvatico e VSM-1 (ok1468) cDNA mutanti sono stati taggati con Cy3 e Cy5 sequenze di acquisizione e ibridato su C. microarray elegans ottenuti tramite il programma GCAT. Questo sistema è più sensibile rispetto a prodotti simili, e il suo sofisticato disegno bicolore diminuisce il numero di array necessari, con conseguente maggiore efficienza dei costi di tempo e 7,8. Inoltre, questo sistema non richiede attrezzature specializzate di altri sistemi simili, quindi, questa procedura potrebbe essere realizzato in qualsiasi ambiente standard di laboratorio 7. In terzo luogo, le immagini fluorescenti serie ibridata sono stati analizzati utilizzando il software a sorgente aperto MAGICTool, e profili di espressione genica sono stati creati. MAGICTool è un programma di facile uso che può essere facilmente utilizzato da individui di ogni livello di esperienza, dalla laurea al post-dottorato. Tuttavia, la performance ottimale richiede grande disponibilità di memoria. Infine, geni candidati ottenuti con l'analisi microarray sono state validate con PCR in tempo reale.

Anche se l'approccio genomico è un metodo efficace per studiare fenomeni biologici, ci sono alcune limitazioni si dovrebbe prendere in considerazione. In primo luogo, nonostante la specificità di questo protocollo microarray, trascrizioni all'interno di una famiglia sono indistinguibili l'uno dall'altro se il oligonucleotide stampata è tratto da sequenze conservate. PCR in tempo reale compensa somiglianze all'interno di una famiglia di geni e può anche distinguere tra isoforme specifiche dello stesso gene. Tuttavia, con PCR in tempo reale è una sfida per trovare controlli vero che sono espressi allo stesso modo per tutta la durata della vita di un organismo. A causa di questo, i risultati saranno relativi. Un approccio proteomico è una alternativa alla nostra tecnica. Singole proteine ​​possono essere isolate mediante gel elettroforesi 2D e identificati con la spettrometria di massa.

I nostri studi mostrano in particolare che molti membri delle principali proteine ​​dello sperma (MSP) famiglia sono indotti a VSM-1 nematodi mutante con una maggiore densità sinaptica. MSP sono unici a C. elegans e sono responsabili della maturazione dell'ovocita e l'ovulazione. Chai 1 ha dimostrato che la regolamentazione del numero Bouton presinaptica e la dimensione a livello della giunzione neuromuscolare nei moscerini della frutta è probabile controllato da molecole contenenti principali domini delle proteine ​​dello sperma. Studi di Tsuda e colleghi hanno dimostrato due principali domini di proteine ​​dello sperma possono servire come leganti per i recettori Ephrine, innescando cascate della tirosin-chinasi del recettore di segnalazione. Inoltre, l'analisi real time PCR convalidato e ristretto i risultati dei microarray a un membro della famiglia msp, msp-32. Nel loro insieme, il lavoro qui presentato rappresenta un genoma analisi di un dilemma centrale neuroscienze così come la potenza di ricerca universitari nello sforzo scientifico.

Disclosures

Nessun conflitto di interessi dichiarati.

Acknowledgments

Questo lavoro è stato eseguito da studenti universitari a sud-ovest Oklahoma State University, OK Weatherford. Questo lavoro è stato sostenuto da NSF RUI-0963258, NIH OK-INBRE 2P20RR016478, GCAT e OCAST HR09-137S.

L'(ok1468) vsm1 mutante è stato isolato dal Consorzio Knockout Gene Oklahoma.
Gli autori ringraziano Dan Stefanovic e Tanner Wheeler per il loro aiuto prezioso durante l'esecuzione del progetto.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics