La determinación de perfiles genéticos de expresión en C. elegans Utilización de microarrays y PCR en tiempo real

Biology
 

Summary

Análisis de microarrays se realizó para determinar los perfiles de expresión génica en

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Las sinapsis se componen de una zona presináptica activa en la señalización celular y una terminal postsináptica en la célula diana. En el caso de las sinapsis químicas, los mensajes son transportados por neurotransmisores liberados desde las terminales presinápticas y recibida por los receptores en las células postsinápticas. Nuestra investigación previa en Caenorhabditis elegans han demostrado que VSM-1 regula negativamente la exocitosis. Además, el análisis de las sinapsis en el VSM-1 mutantes mostraron que los animales que carecen de un completo y funcional de conectividad VSM-1 se han incrementado sináptica. En base a estos hallazgos preliminares, la hipótesis de que la C. elegans VSM-1 puede desempeñar un papel crucial en la sinaptogénesis. Para probar esta hipótesis, de doble etiquetado de análisis de microarrays se llevó a cabo, y los perfiles de expresión génica se determinaron. En primer lugar, se aisló ARN total, inversamente transcribe a cDNA, y se hibridan con los microarrays de ADN. Luego, en silico análisis de hibridación de la sonda fluorescente reveló una inducción significativa de muchos genes que codifican para los miembros de la familia de los espermatozoides principal proteína (MSP) en mutantes con una mayor sinaptogénesis. Proyectos son el principal componente de los espermatozoides en el C. elegans y parece que la señal de la maduración de los ovocitos de nematodos y la ovulación. En las moscas de la fruta, Chai y sus colegas demostraron que un MSP moléculas similares a regular el número y el tamaño de Bouton presináptica en la unión neuromuscular. Además, el análisis realizado por Tsuda y compañeros de trabajo 2 sugiere que los MSPs pueden actuar como ligandos para los receptores Eph y del receptor de activación de la tirosina cinasa cascadas de señalización. Por último, el análisis de PCR en tiempo real corroboró que el gen que codifica para MSP-32 es inducida en VSM-1 (ok1468) mutantes. En conjunto, la investigación realizada por nuestro laboratorio han demostrado que VSM-1 mutantes tienen un aumento significativo en la densidad sináptica, lo que podría estar mediado por el MSP-32 de señalización.

Protocol

1. Aislamiento de ARN total

  1. Nematodos sanos sincronizada fueron cosechadas por lavado de placas con el medio a temperatura ambiente M9, con 2-3 ml por placa. Nematodos resuspendido fueron transferidos a tubos de 15 ml y hacia abajo se sedimentaron por centrifugación, 3200 g a 4 ° C durante 4 minutos. Nematodos se cosecharon limpiar de bacterias flotando resuspendiendo el pellet con 7 ml de 0,1 M NaCl y 7 ml de hielo frío 60% w / v de sacarosa. La mezcla se resuspendió se incubó en hielo durante 15 minutos y nematodos limpia, que en la piscina a través de la solución de sacarosa, se obtuvieron después de la centrifugación de la mezcla a 3200 g a 4 ° C durante 4 minutos. Libre de bacterias gusanos fueron trasladados a un nuevo tubo cónico con pipetas estériles, y se lavó dos veces con un máximo de 15 ml RNasa libre de agua, seguido de una centrifugación 3200 g a 4 ° C durante 2 minutos. La limpieza de pellets flojamente compactada fue transferido a 1,5 ml tubo de microcentrífuga y se centrifuga a máxima velocidad (unos 10.000 g) durante 30 segundos. Por último, la mayoría de RNasa libre de agua se ha retirado y 10 volúmenes de RNAlater fue agregado a la bolita, y se almacenan a 4 ° C hasta que esté listo para proceder.
  2. Para preparar muestras de ARN total, nematodos cosecha se centrifuga a máxima velocidad (unos 10.000 g) durante 4 minutos y RNAlater fue descartado. Entonces, una pizca de resina molecular de molienda (biociencia G) se añadió a la bolita y la mezcla se congeló con nitrógeno líquido. Suspensión gusano congelado fue molido en un polvo fino con nitrógeno líquido maja y se agregó como necesario para mantener el polvo frío. Después de la molienda, el extracto se mantuvo en hielo durante 5 minutos y luego se mezcla con 700 l RLT / BME (relación volumen de 100 RLT: un volumen de BME) (Qiagen) y 472 l de etanol al 100%.
  3. ARN total fue aislado utilizando el RNeasy Mini Kit (Qiagen) y siguiendo el protocolo recomendado por el fabricante. Volumen final de ARN aislado fue de 60 l por muestra biológica.

2. Digestión del ADN y ARN de limpieza

  1. 50 g de ARN total potencialmente contaminadas con ADN genómico fue digerido con DNasa I (Qiagen). Reacciones de digestión que contenía 0,1 U de DNasa / 1 g de ARN y 1X Buffer RDP fueron incubados a temperatura ambiente durante 10 minutos.
  2. RNA de muestras tratadas con DNasa I se limpiaron por completo con la RNeasy MinElute Clean-Up Kit (Qiagen). Protocolos recomendados por el fabricante fueron seguidos y 60 l de volumen eluido final obtenida fue.

3. Análisis cualitativo y cuantitativo de RNA

  1. La concentración de ARN se determinó utilizando el Nanodrop espectrofotómetro UV (Thermo Scientific).
  2. La integridad de las muestras de ARN se evaluó mediante electroforesis de agarosa. En pocas palabras, un 1% libre de RNasa geles de agarosa fueron preparados utilizando 1X Norte Max Gel Gly / preparación de Buffer en funcionamiento (Ambion), el 1% libre de RNasa Agarosa LE (Ambion) y 0,5 mg / ml de bromuro de etidio. Mientras que el gel se polimeriza, las muestras de ARN se glyoxylated mediante la adición de 5 l de la muestra Glyoxyl colorante de carga / muestra y las muestras de incubación a 50 ° C durante 30 minutos. Escalera de ARN se glyoxylated también y cargado de comparación de tamaño.

4. Síntesis de cDNA

  1. Para cada reacción de síntesis, 8,4 ug de ARN de la muestra se mezcló con una imprimación l RT (1 pmol / l). Una de las muestras (WT o mutantes), recibió el Cy5 captura manual RT, la otra muestra recibió la Cy3 captura manual RT (siempre con la matriz de 350 etiquetado kit de detección, Genisphere). Mezclas de muestras se calentaron a 75-80 º C durante 10 minutos y se transfiere al hielo durante 2-3 minutos.
  2. Mientras que el ARN de las muestras se incuban, el MasterMix (Genisphere) se preparó como sigue: para cada reacción RT, se combinaron los 4 l Buffer de reacción para RT 5X, un dNTP l (10 mM de cada dATP, dCTP, dGTP, dTTP), 1 Superase l -En RNasa Inhibidor (siempre con la matriz de 350 etiquetado kit de detección, Genisphere), 1 l de enzimas RT (200 U / l). Por último, 7 l de MasterMix se añadió a cada muestra de ARN, mezcla suavemente (no utilizar vortex) y se incubaron 2 horas a 42 ° C.

5. Degradación del ARN y purificación de muestras de cDNA

  1. síntesis de ADNc se detuvo mediante la adición de 3,5 l 0,5 M EDTA NaOH/50mM (concentración final) y se incuba a 65 ° C durante 15 minutos. Entonces, las reacciones fueron neutralizados con 1M Tris-HCl, pH 8,0 para alcanzar una concentración final de 850 mM Tris-HCl. Por último, WT y cDNAs mutantes fueron combinadas en un tubo de microcentrífuga. El tubo de vacío se lavó con 73 l buffer TE 1X y se añade al tubo que contiene cDNA, el volumen final de la combinación de tubo de ADNc fue de 130 microlitros.
  2. Mezcla de cDNA fue purificado el protocolo del fabricante siguiente y el Kit de purificación QIAquick PCR (Qiagen). El volumen resultante eluye de cDNA purificado fue de 60 microlitros.

6. En primer lugar la hibridación de microarrays

  1. C. elegans microarrays de diapositivas obtenidas a través de GCAT (Consorcio del Genoma de enseñanza activa) fueron bloqueados ena temperatura ambiente durante 1 hora con 0,1 mg / ml de ADN de esperma de salmón sonicado en 3X SSC, 0,1% SDS. Diapositivas bloqueadas fueron lavadas por inmersión en ddH2O y centrifugado por centrifugación durante 1 minuto a 2.000 g en tubos de 50 ml cónicos con KIMWIPE en el fondo.
  2. Entonces, 2X formamida de búfer basado en la hibridación (Genisphere) se incuba a 55 ° C durante 10 minutos, se mezcla bien para disolver los cristales y se centrifuga durante 1 minuto a 10000 g. A continuación, una muestra de 25 l de cDNA se mezcla suavemente agitando con 25 l de la hibridación de amortiguación 2X formamida basado. Muestra de cDNA diluido por acción fue recogida por spin flash de 15 segundos y se incuba a 80 ° C durante 10 minutos.
  3. Por último, ADNc se hibridó con microarrays de diapositivas con cuidado toda la pipeta de la muestra de cDNA se calienta sin tocar la tapa. La muestra fue distribuida uniformemente en el microarray suavemente bajar una hoja de cubierta con una aguja de la jeringa. Antes de la hoja de la cubierta se bajó por completo, la hoja de la cubierta fue retirada una copia de seguridad, luego bajó con la aguja de nuevo, y se deja caer suavemente en su lugar, lo que minimiza la formación de burbujas de aire. Hibridación estableció por primera vez fue culminada por poner el deslizan horizontalmente en un tubo cónico de 50 ml con 50 l de ddH2O debajo de la diapositiva y se incubaron durante la noche a 37 ° C.

7. Hibridación segundo

  1. Microarrays hibridados se lavaron con 2X SSC a diferentes temperaturas. En primer lugar, las diapositivas de microarrays fueron transferidos a tubos cónicos que contengan la temperatura ambiente 2X SSC y 0,2% SDS y se derramó suavemente para quitar la cubierta se desliza. A continuación, las diapositivas de microarrays fueron transferidos a tubos cónicos de 55 ° C que contiene 2X SSC y SDS 0,2% y se incuba a 55 ° C durante 15 minutos. A continuación, las diapositivas se transfiere a 2X SSC y se incuban a temperatura ambiente durante 15 minutos, agitando suavemente de forma periódica. Por último, las diapositivas se transfiere a 0,2 X SSC y se incubó durante 15 minutos a temperatura ambiente, agitando suavemente de forma periódica. Diapositivas se lavaron centrifugado mediante la introducción de la etiqueta hacia abajo se desliza en tubos de 50 ml cónicos con un KIMWIPE en la parte inferior y se centrifuga durante 1 minuto a 2.000 g.
  2. Mezcla de al lado, la hibridación segunda se preparó utilizando 2X formamida de búfer basado en la hibridación (Genisphere). Tampón de hibridación se incubó a 55 ° C durante 10 minutos y se centrifuga durante 1 minuto a 10000 g. La captura de los reactivos fluorescentes (Cy3 y Cy5) y el reactivo anti-fade se descongelaron a temperatura ambiente y se cubre con papel de aluminio para proteger a los reactivos de photobleaching. Siguiendo los pasos de hibridación se realizaron en la oscuridad para minimizar la exposición de luz. 150 l de tampón de hibridación 2X formamida basado se combinó con 1,5 l anti-fade reactivo para hacer la mezcla de hibridación anti-fade-tratados.
  3. La captura de los reactivos Cy3 y Cy5 se agitaron durante 3 segundos y se centrifuga durante 15 segundos, 10.000 g. Mezcla de hibridación segundo fue preparado combinando 75 l anti-fade-tratados mezcla de hibridación, 60 l de agua libre de nucleasa, 7,5 l Cy3 reactivo de captura, y un 7,5 l Cy5 reactivo de captura. Mezcla de hibridación segundo se incubó durante 10 minutos a 75 ° C y 50 l de mezcla se calienta una pipeta con mucho cuidado en la diapositiva de microarrays lavado / secado. Distribuido de manera uniforme a la muestra en la micromatriz, una hoja de cubierta se bajó suavemente con una aguja de la jeringa. Antes de la hoja de la cubierta se bajó por completo, la hoja de la cubierta fue retirada una copia de seguridad, luego bajó con la aguja de nuevo, y se deja caer suavemente en su lugar, lo que minimiza la formación de burbujas de aire. Hibridación de microarrays de diapositivas se colocan horizontalmente en 50 ml tubo cónico cubierto con papel de aluminio y 50 l de ddH2O fue introducido debajo de la diapositiva para crear una cámara húmeda. En segundo lugar la hibridación se incubó a 37 ° C durante 2-5 horas.
  4. Microarrays segunda hibridación se lava en la oscuridad con la temperatura ambiente SSC 2X, 0,2% SDS, 1 mM DTT y se derramó suavemente para eliminar el cubreobjetos. Entonces, los microarrays se transfirió a tubos cónicos cubiertos que contiene 55 ° C 2X SSC, 0,2% SDS, 1 mM DTT y se incubó durante 15 minutos a 55 ° C. Diapositiva siguiente, fue transferido a un tubo cónico cubierto contiene 2X SSC, 1 mM DTT y se incubó durante 15 minutos a temperatura ambiente, agitando suavemente de forma periódica. La última diapositiva, fue trasladado a 0,2 X SSC, 1 mM DTT y se incubó a temperatura ambiente durante 15 minutos, agitando suavemente de forma periódica. Microarrays de diapositivas se secó por centrifugación durante 1 minuto, 2.000 g, deslice la etiqueta hacia abajo en la cubierta del tubo cónico de 50 ml con KIMWIPE en la parte inferior. Portaobjetos secos de microarrays fueron escaneados utilizando GenePix Personal 4100A modelo de escáner en el Davidson College.

8. El análisis de microarrays

  1. Las imágenes obtenidas después de la exploración fueron analizados utilizando el software MAGICTool desarrollado en el Davidson College de Laurie Heyer y sus estudiantes de pregrado. En pocas palabras, en el marco del "Proyecto" haga un "nuevo proyecto" fue creado y guardado. En la sección "Crear perfil de expresión" ficha ", Par cargar la imagen" fue seleccionado y el archivo de imagen de color rojo (_635.tif) fue subido como "Rojo" y el archivo de imagen verde (_532.tif) fue subido como "Verde". Luego, utilizando el "Build perfil de expresión" ficha y "lista de genes de carga", un C. gen elegans archivo de la lista obtenida del sitio web GCAT fue subido.
  2. La imagen de microarrays fue tratado y cuadriculada con el "Build perfil de expresión" y la pestaña "Crear / Editar cuadrícula" opción. "Setup Grid" cuadro de diálogo ha sido editado con "48" para el número de redes, "22 líneas" y "22 columnas" para cada red, los puntos numerados "de izquierda a derecha" y "de arriba a abajo". "El cambio de contraste por ciento" se incrementó y un acercamiento a la red hasta los puntos individuales se distinguen fácilmente. Las rejillas se creó por primera seleccionando "Set Top Spot izquierda" en el panel de la izquierda. Entonces, el centro de la mancha arriba a la izquierda, punto arriba a la derecha y la fila inferior se ha hecho clic en "Grid 1". Este procedimiento grillado se repitió para cada una de las 48 redes, procediendo de izquierda a derecha y de arriba abajo. Cuando se completó grillado, la corriente de red se guardan en "Archivo" "Guardar Como la corriente de red". Cuando la red se ha guardado correctamente el "Terminado" ficha se ha seleccionado.
  3. Para eliminar cualquier punto relacionado en el análisis, el "Perfil de construir la expresión" ficha se abrió. En el marco del "Tratamiento de Gridding" opción "Spot Las marcas" se ha seleccionado. Rayas o manchas de fluorescencia de fondo se marcan y se guarda mediante la opción "Guardar Banderas actual como" bajo la pestaña "Archivo".
  4. Archivos marcados fueron segmentados utilizando el "Build perfil de expresión" y seleccionar la pestaña "radio fijo" como el método de segmentación de la elección. La radio fue creada a la medida deseada, y "Actualización de Datos" se hace clic. Para asegurarse de que el círculo se mantiene dentro de la zona cuadriculada (cuadrado amarillo) se desplaza de arriba a abajo y de izquierda a derecha y una vez comprobado "Crear perfil de expresión", fue seleccionado.
  5. Durante la segmentación, el software calcula la Red: ratios de fluorescencia verde para cada uno de los puntos que quedaron después de marcar. El uso de "expresión" ficha "Manipulación de Datos", "Transformación" fue seleccionado. A "Transformar datos" cuadro de diálogo apareció en "logb (x)" opción, y b = 2 se ha introducido. "Archivo de Trabajo de expresión" se exploró la "expresión" ficha. Para un experimento en el que el tipo salvaje recibido la Cy3 (verde) secuencia de captura y el mutante recibió el Cy5 (rojo) secuencia de captura, el valor de las relaciones de transformación logarítmica fueron positivos para los genes que fueron inducidos y negativos para los genes reprimidos.
  6. Por último, los genes inducidos o reprimidos por un factor especificado se analizaron seleccionar "Explorar" en la "expresión" ficha. En el cuadro de "Exploración" de diálogo, "encontrar los genes de Criterios de Coincidencia" se establece en los genes con un "Max. Valor> X (número positivo para los genes inducidos)" o "Min. Valor <X (número negativo para los genes reprimidos)" en experimentos como el descrito en el # 5. Veces la expresión es igual a 2x, donde "x" es el valor del número introducido en los criterios de selección.

9. Síntesis de cDNA y PCR en tiempo real

  1. ARN total fue aislado como se describió anteriormente. Una vez que la calidad y la cantidad de ARN aislado se determinó, cDNA fue sintetizado utilizando el Kit de iScript Síntesis de cDNA (BioRad), 500 el total de ARN ng / l aislada de la de tipo salvaje y mutante, y los protocolos recomendados por el fabricante.
  2. En tiempo real las reacciones de PCR fueron puesta a punto con el iQ SYBR Green Supermix (Bio-Rad), 100-500 cebadores específicos del gen nmoles (tabla 1) y 4 l ADNc producido por el paso anterior. L 10 reacciones se realizaron utilizando el termociclador CFX96 Sistema de Tiempo Real (BioRad).
  3. El termociclador se calienta primero a 95 ° C durante 3 min. Esto fue seguido por un paso a 95 ° C durante 5 segundos y 58 ° C durante 30 segundos. Este ciclo se ha completado un total de cuarenta veces, y 65-95 ° C la curva de fusión con un gradiente de 0,5 grados se insertó también. ΔΔCT valores se calcularon utilizando tres genes de la casa (ACT-1, CDC-42, y PMP-3) como controles.
GENE PRIMER AVANCE Cebador inverso
gst-5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
gst-9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl-1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR-2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
Lim-9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
lpr-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
mes-6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
msp-32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
MSP-142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
msp-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
msp-45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
msp-49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
msp-56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

Tabla 1. Avance y retroceso primer secuencias de PCR en tiempo real

10. Los resultados representativos:

Aislamiento de ARN y análisis

La fusión de vesículas zona activa precursor en los sitios presinápticos es un paso obligatorio en la sinaptogénesis (3). VSM-1, una recientemente identificada v-SNARE proteína maestra, fue propuesto para inhibir la fusión de vesículas en la levadura y la sinaptogénesis en los nematodos (ver Figura 1) por un mecanismo indeterminado (4, y nuestro trabajo no publicado). Para comprender mejor el mecanismo molecular subyacente VSM-1 la regulación en los nematodos y aportar algo de luz en el campo de la sinaptogénesis, comenzamos una pantalla de todo el genoma y se determinó que los principales genes de las proteínas del esperma (MSP) se induce en ausencia de pleno funcionamiento VSM-1 .

Para investigar los genes inducidos en la cepa de VSM-1 (ok1468) mutante de C. elegans, se realizó un análisis de microarrays de genes. Esto se hizo mediante las pruebas transcripciones aislados de tipo salvaje y el VSM-1 cepa mutante y la determinación de su enriquecimiento. En concreto, se aisló por primera vez el total de ARN sincrónica L4 y L3 de tipo salvaje y VSM-1 nematodos larvas mutantes. Entonces, hemos tratado el ARN total obtenido con DNasa I y examinó la calidad del ARN extraído por medio de electroforesis en gel de agarosa. En el experimento se muestra en la figura 2, una escalera se utilizó en el primer carril para representar el número de pares de bases para las normas. Muestras de tipo salvaje de pre-tratamiento y post-tratamiento con DNasa I se han cargado en los carriles 2 y 4, y VSM-1 mutante muestras de pre-tratamiento y post-tratamiento con DNasa I se han cargado en los carriles 3 y 5, respectivamente. Análisis de electroforesis en gel de ARN mostraron que el tipo salvaje y una VSM-muestras de ARN mutante estaban intactos y de buena calidad. Esto se determinó mediante la observación de dos bandas que representaron las dos subunidades de ARN ribosomal.

Microarrays de hibridación

Una vez que la calidad del ARN se determinó, se procedió a la síntesis de ADNc. Para ello, se transcriben de forma inversa del ARNm y se añade una secuencia de captura hasta la cola. El ADNc producido que contiene secuencias de captura para Cy3 y Cy5 se hibridó con microarrays de diapositivas y se envía para su análisis. Imágenes de microarrays se ingresaron en un programa de software de código abierto de computadora llamado MAGICTool desarrollado en el Davidson College de Laurie Heyer y sus estudiantes de pregrado. El uso de este software a sobreponer Cy3 y Cy5 imágenes, microarrays cuadriculada, y se analizaron los perfiles fluorescentes (ver Figura 3). Una vez que se completa grillado entonces segmentado cada cuadrado individual asegurarse de que el conjunto de oligonucleótidos impresos se estaba examinando. A continuación analizamos las relaciones de inducido y creado expresiones perfil genético muestra que los genes que codifican para la familia MSP se inducen en los nematodos con la sinaptogénesis mejorada. (Tabla 3).

Validación y cuantificación de la expresión génica mediante PCR en tiempo real.

Para entender mejor el perfil genético en el VSM-1 mutante se analizaron una serie de genes que codifican para los miembros de la familia MSP utilizando PCR en tiempo real. En primer lugar, el ARN total fue aislado de un tipo de cepas salvajes y una VSM (ok1468) mutante. Muestras de ARN se transcribe a continuación, en orden inverso ADNc y se utiliza para el análisis de PCR en tiempo real. Las evaluaciones de los perfiles de expresión en tiempo real PCR demostró que un miembro de la familia MSP parece ser inducida en VSM-1 (ok1468) mutantes. Por otra parte, PCR en tiempo real de datos valida los resultadosde microarrays y reducido la búsqueda a un candidato gen msp (Figura 4).

Figura 1
Figura 1. A. UNC-17 inmunotinción reveló que VSM-1 mutantes presentan mayor densidad sináptica a lo largo del cordón nervioso dorsal. Las imágenes fueron analizadas con un aumento de 63x, posterior (derecha) a la vulva. B. Análisis de la WT y VSM-1 (ok1468) sinapsis mutante denota estadísticamente significativa mayor densidad sináptica en el mutante VSM-1 (** p <0,01). Veinte nematodos fueron las imágenes de cada genotipo.

Figura 2
Figura 2. La calidad del ARN extraído se determinó mediante electroforesis en gel de agarosa. La presencia de dos subunidades ribosomales intacta antes y después del tratamiento con DNasa I se hizo evidente en el ARN extraído de tipo salvaje y las muestras de una VSM (ok1468).

Figura 3
Figura 3. A. La imagen de microarrays para un experimento en el que fue etiquetado como el control de color rojo (Cy5) y el mutante VSM-1 fue etiquetado verde (Cy3). B. Representante imagen muestra una de las 48 redes analizadas por microarrays. Cada pequeño cuadrado en una red es representativa de un único oligonucleótido impresa, y cada red está compuesta por 22 filas y columnas 22.

Tabla 2
Tabla 2. Microarray análisis de las transcripciones aisladas de larvas 4 (A) y larvas 3 (B) C. nematodos elegans mostraron que los genes que codifican para las proteínas de los espermatozoides más importantes son inducidos en los mutantes con mayor sinaptogénesis. Genes resaltado indica que los genes inducidos en 3 y 4 de larvas, tanto larvas.

Figura 4
Figura 4. Análisis en tiempo real PCR demostró que un miembro de la familia del gen msp, msp -32 fue inducida en VSM-1 (ok1468) mutantes. Representante gráfico normalizado expresión veces muestra que el VMS-1 (ok1468) ΔΔCT valores de msp-32 son significativamente diferentes en comparación con el tipo salvaje (WT) y tres genes de la casa se ​​utiliza para la normalización (ACT-1, CDC-42, y PMP -3). Promedio de tres réplicas se representan + / - desviación estándar.

Discussion

En este estudio se desarrolló un protocolo sencillo, fácil de usar que se puede utilizar para determinar perfiles de expresión genética subyacente varios fenómenos biológicos. En este protocolo, el ARN total fue aislado por primera vez y tratados con DNasa I. Nuestro método de aislamiento de ARN ha sido dramáticamente simplificadas omitiendo extracciones con fenol y el uso de resinas de afinidad para la limpieza 5,6. En pocas palabras, C. elegans membranas cuticulares y células estaban rotas, abiertas por los nematodos congelación con nitrógeno líquido y la molienda con resina molecular. A continuación, extrae el ARN fue tratado con DNasa I antes de la síntesis de ADNc. El paso posterior fue agregado a minimizar hibridaciones inespecíficas, las muestras de ARN contaminadas con ADN genómico podría introducir interferencias y producir muchos falsos positivos. Entonces, de tipo salvaje y VSM-1 (ok1468) ADNc mutantes fueron marcadas con Cy3 y Cy5 secuencias de captura y se hibridan en C. microarrays elegans obtiene a través del programa GCAT. Este sistema es más sensible que otros productos similares, y sus dos colores diseño reduce el número de arreglos necesarios, resultando en una mayor eficiencia de costes y el tiempo 7,8. Además, este sistema no requiere el equipo especializado de otros sistemas similares, por lo tanto, este procedimiento podría llevarse a cabo en cualquier entorno de laboratorio estándar 7. Imágenes en tercer lugar, fluorescentes conjunto híbrido fueron analizados utilizando el software de código abierto MAGICTool, y perfiles de expresión génica que fueron creados. MAGICTool es un programa fácil de usar que es fácilmente utilizada por personas de todos los niveles, desde el pregrado a la post-doctorado. Sin embargo, un funcionamiento óptimo requiere la disponibilidad de grandes cantidades de memoria. Por último, los genes candidatos obtuvieron mediante el análisis de microarrays fueron validados con PCR en tiempo real.

Aunque el enfoque genómico es un método eficaz para el estudio de los fenómenos biológicos, hay algunas limitaciones hay que tener en cuenta. En primer lugar, a pesar de la especificidad de este protocolo de microarrays, transcripciones dentro de una familia no se distinguen el uno del otro si el oligonucleótido impreso se ha tomado de secuencias conservadas. PCR en tiempo real compensa similitudes dentro de una familia de genes, e incluso se puede distinguir entre las isoformas específicas del mismo gen. Sin embargo, con PCR en tiempo real es un desafío para encontrar los controles de verdad que se expresan por igual durante toda la vida de un organismo. Debido a esto, los resultados serán relativos. Una aproximación proteómica es una alternativa a nuestra técnica. Proteínas individuales se pueden aislar mediante electroforesis en gel 2D y se identifica con la espectrometría de masas.

Nuestros estudios muestran específicamente que los miembros de muchas de las principales proteínas de los espermatozoides (MSP) de la familia son inducidos en VSM-1 nematodos mutantes con una mayor densidad sináptica. MSPs son exclusivas de C. elegans y son responsables de la maduración de oocitos y la ovulación. Chai 1 ha demostrado que la regulación del número y tamaño bouton presináptica en la unión neuromuscular en moscas de la fruta es probable controlada por moléculas que contienen grandes dominios de proteínas de esperma. Los estudios realizados por Tsuda y sus colegas han demostrado dos grandes dominios de la proteína de esperma puede servir como ligandos para los receptores Ephrine, provocando cascadas de señalización del receptor de la tirosina cinasa. Por otra parte, el análisis en tiempo real PCR validados y se redujeron los resultados de microarrays de un miembro de la familia msp, msp-32. En conjunto, el trabajo presentado aquí representa un análisis de todo el genoma de un dilema central de la neurociencia, así como el poder de la investigación de pregrado en el quehacer científico.

Disclosures

No hay conflictos de interés declarado.

Acknowledgments

Este trabajo fue realizado por estudiantes de pregrado en Southwestern Oklahoma State University, OK Weatherford. Este trabajo fue apoyado por la NSF Rui-0963258, NIH OK INBRE 2P20RR016478, GCAT y OCAST HR09-137S.

El vsm1 (ok1468) mutante fue aislado por el Consorcio golpe de gracia Oklahoma Gene.
Los autores agradecen a Dan Wheeler Stefanovic y Tanner por su valiosa ayuda durante la ejecución del proyecto.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics