Author Produced

רצף של מיקרופלורת חיידקים דם היקפיים: הניסיון שלנו עם HIV נגועים חולים

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

הניסוי שלנו יציגו כיצד לבצע ניתוח רצף של מינים translocating חיידקי בדם ההיקפי של חולי איידס.

Cite this Article

Copy Citation | Download Citations

Merlini, E., Bellistri, G. M., Tincati, C., d'Arminio Monforte, A., Marchetti, G. Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients. J. Vis. Exp. (52), e2830, doi:10.3791/2830 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

מערכת העיכול בריאה מבחינה פיזיולוגית יישבו על ידי מגוון רחב של חיידקים commensal המשפיעים על התפתחות של 1,2 מערכת הריריות הלחות ואת החיסונית התאית.

החיידקים הוא מוגן מפני מערכת החיסון דרך מחסום הרירית חזק. זיהומים ואנטיביוטיקה ידועים לשנות גם את המכשול נורמלי מערכת העיכול ואת הרכב של חיידקים תושב, אשר עלול לגרום הפרעות החיסון ניתן 3.

HIV גורם פרצה מחסום העיכול עם כישלון מתמשך של חסינות זליגת הרירית תוך מחזור מערכתי של bioproducts חיידקי, כגון lipopolysaccharide ושברי DNA בקטריאלי, אשר תורמת להפעלת מערכת החיסון מערכתית 4-7. טרנסלוקציה מיקרוביאלית הוא מעורב immunopathogenesis HIV / איידס ועל התגובה לטיפול 4,8.

אנו שמטרתו לאפיין את ההרכב של חיידקים translocating בדם ההיקפי של HIV-נגועים. כדי לרדוף אחרי המטרה שלנו הקמנו תגובת PCR עבור הגן 16S panbacteric ribosomial ואחריו ניתוח רצף.

בקצרה, כל דם משני הנושאים HIV נגועים ובריאים משמש. בהתחשב בעובדה אנשים בריאים הנוכחית הומאוסטזיס מעיים רגילה ללא טרנסלוקציה של מיקרופלורת צפוי בחולים אלו. לאחר איסוף הדם כולו על ידי venipuncture והפרדה פלזמה, הדנ"א מופק פלזמה המשמש לביצוע מגוון רחב PCR תגובה עבור 16S panbacteric ribosomial גן 9. ניתוחים לאחר טיהור PCR המוצר, שיבוט רצף מבוצעות.

Protocol

טיפול של דגימות דם נגוע ב-HIV דורש כמה המלצות חשובות.
דגימות דם של כל חייב להיות מועבר דליפה הוכחה מכולות חזקים. יש להקפיד בעת לקיחת הדגימה, כדי למנוע זיהום חיצוני של מכולה של כל הניירת המלווה את הדגימה.
כל האנשים עיבוד דם נגוע חייב ללבוש כפפות. כפפות יש לשנות לרחוץ ידיים לאחר השלמת עיבוד הדגימה.
עיבוד של HIV-נגוע דגימות דם חייבת להיעשות ברדס II הקבינט Biohazard בכיתה.
עזרי pipetting מכונות אמור לשמש.
שימוש של מחטים או מכשירים חדים אחרים (כולל למשל pipettes זכוכית או צינורות נימי) חייב להיות מוגבל למצבים בהם אין ברירה.
משטחים מעבדה יש ​​לחטא עם חומר חיטוי כימי מתאים לאחר לשפוך דם וכאשר פעילויות עבודה הושלמו.
חומרים המשמשים מזוהמות חייב להיות חיטוי לפני שימוש חוזר או חייב להיות מסולק בדרך הנכונה דרך תוואי פסולת קליניים.
בכל מקרה של חשיפה תעסוקתית דם או נוזלים מדבקים בפוטנציה (כלומר, אלה הדורשים אמצעי זהירות אוניברסליים) יש להתייחס כאל מקרה חירום רפואי כמו התערבויות חייב להיות יזם מיד כדי להיות יעיל.
הפרוטוקול דורש 5 ימים להשלמתו. הזמן הוא מפורט באיור 1.
מין חיידקית מזוהים באמצעות השיטות המתוארות באיור 2.

1. לדוגמה אוסף

  1. 9 מ"ל של דם מלא נמשך לתוך צינורות המכיל EDTA.
  2. צינורות הם centrifuged ב 2000 סל"ד במשך 10 דקות על RT כדי לקבל פלזמה.
  3. פלזמה נאסף בתוך צינור Eppendorf סטרילי 2 מ"ל.

2. הפקת דנ"א מדגימות פלזמה

  1. לחטא כראוי, מכסה המנוע pipettes חומר הדרוש לצורך הניסוי על מנת להבטיח סטריליות.
  2. מיקום כל החומרים תחת אורות UV במשך 30 דקות לפחות.
  3. נגב כפפות בחומר חיטוי.
  4. משרים מגבות נייר כמה אתנול למקם אותם מתחת למכסה המנוע. בכל פעם טיפ נמחקת לנגב את פיפטה על מגבות נייר רטוב.

הדנ"א מופק באמצעות ערכת מסחרי בהתאם להוראות היצרן (Easy-DNA קיט, Invitrogen, בקרלסבד קליפורניה, ארה"ב).

  1. 350 μL של פלזמה ממוקמים צינור סטרילי Eppendorf 2ml.
  2. 350 μL של מים מסוננים ultrapure משמשים בקרה שלילית.
  3. הוסף 10 μL של ליזוזים (1mg/ml) על דגימות.
  4. דגירה במשך 30 דקות על 37 ° C.
  5. הוספת 500 μL הפתרון תמוגה ומערבבים בעדינות את הדגימות.
  6. דגירה של 7 דקות 65 ° C.
  7. הוספת 900 μL של כלורופורם על דגימות.
  8. וורטקס במרץ עד דגימות הן צמיג אחיד.
  9. הוספת 200 μL הפתרון רטיבות ו מערבולת במרץ.
  10. צנטריפוגה דגימות 10500 סל"ד במשך 10 דקות ב RT להפריד בין השלבים ויוצרים את הממשק.
  11. מעבירים את השלב מימית העליון צינור microcentrifuge טריים המכילה 1 מ"ל של 100% אתנול.
  12. צנטריפוגה דגימות 10500 סל"ד במשך 10 דקות ב 4 ° C.
  13. הסר אתנול.
  14. הוסף 1ml של אתנול 70%.
  15. צנטריפוגה דגימות במהירות מקסימלית במשך 10 דקות ב 4 ° C.
  16. הסר אתנול. אתנול שיורית יש להסיר עם pipettator.
  17. Resuspend את הכדור ב 50 μL מים ultrapure.
  18. קרא את ריכוז ה-DNA עם ספקטרופוטומטר.

3. 16S rRNA ג'ין PCR

הגברה PCR מתבצעת 9 כפי שתואר לעיל.

  1. Amplify DNA בתערובת 100 תגובה μL המורכב μL 10 של חיץ PCR 10X, 5 μL של 25 מ"מ MgCl2, 5 μL של 2 dNTPs הכולל מ"מ, 1 μL של פריימר 50 מיקרומטר RW01 (AACTGGAGGAAGGTGGGGAT), 1 μL של פריימר 50 מיקרומטר DG74 (AGGAGGTGATCCAACCGCA), 34 μL של H20 ו 0.5 μL של פולימראז תקי (AmpliTaq זהב, אפלייד Biosystem, פוסטר סיטי, קליפורניה, ארה"ב).
  2. מעבירים את תערובת PCR במסננים כדי למנוע זיהום אפשרי של פולימראז תקי חיידקי.
  3. צנטריפוגה מסננים (Microcon, Millipore, Billerica, מסצ'וסטס, ארה"ב) במשך 30 דקות ב RCF 500 ב 4 ° C.
  4. Aliquot PCR לערבב לפי מספר דגימות אשר צריך להיות מוגבר (חיוביות ושליליות שולטת PCR, דגימות מים חילוץ).
  5. השתמש התנאים הבאים Cycler תרמי: 94 מעלות צלזיוס למשך 10 דקות, 40 פעמים במשך דקה 1 בכל פעם ב 94 ° C, 55 ° C ו 72 ° C, ו - 10 דק 'ב 72 ° C.
  6. דמיינו את המוצר PCR על ג'ל agarose 2%. השתמש 100 נ"ב סולם הדנ"א. גודל PCR המוצר על 360 נ"ב (איור 3).

4. PCR טיהור מוצר

רק דגימות חיוביות PCR צריך להיות מטוהרים. הטיהור מתבצע באמצעותערכת מסחרי הבאים הוראות היצרן (PureLink PCR microkit, Invitrogen, בקרלסבד קליפורניה, ארה"ב).

  1. הוסף 4 כרכים של הצפת עקידת המכיל isopropanol לכל נפח 1 של המוצר PCR.
  2. העברת מוצר PCR עם הצפת עקידת לעמודה.
  3. צנטריפוגה דקה 1 ב RCF 10,000 ב RT.
  4. לשטוף טור עם הצפת לשטוף המכיל אתנול.
  5. צנטריפוגה דקה 1 ב RCF 10,000 ב RT.
  6. צנטריפוגה במהירות המרבית למשך דקה 1 ב RT לייבש את הממברנה סיליקה להסיר כל חוצץ לשטוף שיורית עם אתנול.
  7. הוסף 10 μL מים ultrapure.
  8. דגירה דקה 1 ב RT.
  9. צנטריפוגה במהירות המרבית למשך 2 דקות על RT כדי לאסוף את ה-DNA מטוהרים.

5. שיבוט

Lysogeny מרק (LB) אופן ההכנה פלייט

  1. ממיסים 25 גרם של תערובת LB ב כ 800 מ"ל מים.
  2. תביאו את הנפח הסופי ל 1 ל
  3. הוסף 15 גר 'של Bactoagar.
  4. החיטוי במשך 20 דקות.
  5. לאחר מעוקר, במרץ מערבולת הפתרון בבקבוק לערבב אגר מותכת.
  6. מגניב הפתרון 50 ° C.
  7. הוסף אמפיצילין (50 מיקרוגרם / מ"ל) ומערבלים עד שהוא נמס.
  8. יוצקים צלחות לעומק של כ 3 מ"מ.
  9. השאירו את הצלחות החוצה בטמפרטורת החדר.
  10. מורחים X-גל (40mg/ml) ו IPTG (100 מ"מ) על כל צלחת LB ו לדגור על 37 מעלות צלזיוס עד מוכן לשימוש.

טרנספורמציה תאים המוסמכת

השינוי מתבצע באמצעות הוראות ערכה המסחרי הבא של היצרן (Topo ת"א ערכה שיבוט, Invitrogen, בקרלסבד קליפורניה, ארה"ב).

  1. מכינים את תערובת התגובה שיבוט (1-4 μL של מוצר ה-PCR טריים, 1 μL של תמיסת מלח, 1 μL של וקטור מים במידת הצורך).
  2. מערבבים בעדינות התגובה דגירה למשך 5-10 דקות ב RT.
  3. מניחים את התגובה על הקרח.
  4. הוסף 2 μL התגובה שיבוט לתוך בקבוקון של תאים המוסמכת ומערבבים בעדינות.
  5. לדגור על קרח במשך 30 דקות.
  6. חום הלם התאים למשך 30 שניות על 42 ° C.
  7. מיד להעביר את הצינור לתוך הקרח.
  8. הוספת 250 μL של המדיום.
  9. שווי צינור tighly ולנער את הצינור אופקית ב 37 מעלות צלזיוס במשך שעה 1.
  10. מורחים 50 μL מן התמורה כל על צלחת סלקטיבית prewarmed.
  11. דגירה לילה בשעה 37 ° C.

לאחר דגירה, מושבות לבן וכחול לפתח על צלחות. מושבות לבן הן חיוביות עבור החדרת מוצר ה-PCR ומושבות כחול הן שליליות עבור החדרת מוצר ה-PCR.

6. סידור ניתוח

סידור התגובה

  1. לערבב נעשית באמצעות ריאגנטים אלה: 2,5-DNA μl, 1 פריימר μl (5pmol / μl) 1,1 BigDye μl (Applied Biosystem, פוסטר סיטי, קליפורניה, ארה"ב).
  2. Cycler התנאים תרמי: 96 ° C עבור 1 דקות; 25 פעמים עבור 96 ° C למשך 10 שניות, 55 ° C למשך 15 שניות ו - 60 מעלות צלזיוס למשך 4 דקות.

טור טיהור

  1. עבור כל תגובה, להכין עמודה אחת MicroSpin (Qiagen, מילאנו, איטליה).
  2. היפוך עמודה מערבולת לערבב שרף.
  3. הצמד את החלק התחתון של הטור, לשחרר את המכסה ¼ בתורו, ועמודה מקום צינור microcentrifuge.
  4. צנטריפוגה 3200 סל"ד במשך דקה 1.
  5. העברת עמודה צינור microcentrifuge נקי.
  6. בזהירות pipet התגובה רצף שלם PCR למרכז העמודה.
  7. צנטריפוגה 3200 סל"ד במשך דקה 1.
  8. ה-DNA מטוהרים יהיה eluite לתוך הצינור (20 μl מים ultrapure).

סידור ניתוח

  1. טען המדגם מטוהרים (20 μl) לתוך צלחת 96-multiwell.
  2. טען את הצלחת לתוך ברצף. Sequencers DNA אוטומטי ליצור chromatogram בארבעה צבעים להציג את התוצאות של הפעלת רצף.
  3. קלט את רצף נוקליאוטידים כשאילתת נגד מאגרי רצף הציבור. החיפוש מבוצע על צמח השדה מסדי נתונים ושרתים, בסיסי עם כלי חיפוש מקומי המערך (תפציץ).
  4. קחו רק עם חיידקים homologies 98-100%.

7. נציג תוצאות

איור 1
באיור 1. ציר הזמן של ההליך.

איור 2
איור 2. תרשימי זרימה של הליך הזיהוי כולו החיידק.

איור 3
איור 3. 2% ג'ל agarose מראה מגוון רחב 16S rRNA גן מוצרים PCR. ליין 1 מכיל דנ"א 100bp סולם, מסלול 2 מכיל את השליטה PCR חיובי, במסלול 3 מציג את השליטה שלילי PCR. ליין 4 מראה דגימות מכל חולה איידס, לבין מסלול 5 מכיל מים. ליין 6 shows דגימות מאדם בריא תגובה שלילית PCR; נתיב 7 מכילה מים. רק חולי איידס מציג הגברה PCR חיובי. מים ultrapure לשמש מלאה שלילית במהלך שלב החילוץ, עולה כי הזיהום לא התרחשה.

איור 4
איור 4. 0.7% ג'ל agarose מראה פלסמיד חילוץ עם הליך miniprep. ליין 1 מכיל סולם 1 Kilobase DNA, מסלול 2 מכיל את המושבה לשלוט כחול, נתיבים 3 עד 12 מכילות מושבות לבן. הפלסמיד מהמושבה הכחול אינו מכיל את להכניס מוצר PCR. כל 10 מושבות לבן מכילים פלסמיד עם הוספת הנכון.

איור 5
איור 5. מציג דוגמה לניתוח רצפי החיידקים פלזמה מאדם עם HIV אחד. התוצאות שלנו מראות כי טרנסלוקציה חיידקים מחלת האיידס כרוכה צומח polimicrobic, אשר אינו נראה HIV-שלילי נושאים, דבר המצביע על כשל ניכר חסינות במעי בשליטה טרנסלוקציה חיידקים.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

אין ניגודי אינטרסים הכריז.

Acknowledgements

אנו אסירי תודה ג'יאני Scimone לסיוע מעולה עם ביצוע וידאו.

Materials

Name Company Catalog Number Comments
Easty-DNA Kit Invitrogen K 180001
Chloroform Sigma-Aldrich C2432
Ethanol Sigma-Aldrich E7203
UltraPure Waer Invitrogen 10977049
Lysozyme Fluka 62970 10 μg/mL in Distillated Water
AmpliTaq Gold Applied Biosystems 26478701
Microcon 100 EMD Millipore 42413
PCR primers Invitrogen
Agarose Eppendorf C1343
DNA ladder Invitrogen 15628019
Purelink PCR micro kit Invitrogen K310050
LB Agar, powder Invitrogen 22700025
Bactoagar Invitrogen
Ampicillin Invitrogen 11593027 10 mg/mL in Distillated Water
X-gal Invitrogen 15520034 40mg/mL in DMF
IPTG Invitrogen 15529019 100mM in Distillated water
Topo TA cloning kit Invitrogen K450002
Purelink Quick Plasmid Miniprep kit Invitrogen K210010
Big dye Applied Biosystems 4337455
DyeEx 2.0 spin kit Qiagen 63204

DOWNLOAD MATERIALS LIST

References

  1. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  2. Macpherson, A. J., Harris, N. L. Interactions between commensal intestinal bacteria and the immune system. Nat Rev Immunol. 4, 478-485 (2004).
  3. Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. Modification of intestinal flora in the treatment of inflammatory bowel disease. Curr Pharm Des. 9, 333-346 (2003).
  4. Brenchley, J. M. Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat Med. 12, 1365-1371 (2006).
  5. Brenchley, J. M., Price, D. A., Douek, D. C. HIV disease: fallout from a mucosal catastrophe. Nat Immunol. 7, 235-239 (2006).
  6. Jiang, W. Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection. J Infect Dis. 199, 1177-1185 (2009).
  7. Marchetti, G. Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy. AIDS. 22, 2035-2038 (2008).
  8. Marchetti, G. Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART. The 17th Conference on Reteroviruses and Opportunistic Infections (CROI), San Francisco, CA, USA, (2010).
  9. Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol. 32, 335-351 (1994).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics