Vouwen en Karakterisatie van een Bio-responsieve Robot van DNA Origami

Chemistry
 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Het DNA nanorobot een holle zeshoekige nanometrische inrichting, ontworpen om in reactie op specifieke stimuli en presenteren lading binnen afgezonderd. Zowel stimuli en lading kan worden afgestemd op specifieke behoeften. Hier beschrijven we de DNA nanorobot fabricage protocol, met behulp van de DNA origami techniek. De procedure initieert door het mengen van korte enkelstrengs DNA-nietjes in een voorraad mengsel dat vervolgens naar een lange, cirkelvormige, enkelstrengs DNA scaffold wordt toegevoegd in aanwezigheid van een opvouwbare buffer. Een standaard thermo cycler geprogrammeerd om het mengen reactietemperatuur geleidelijk te verlagen om de krammen te scaffold gloeien, de drijvende kracht achter het vouwen van de nanorobot vergemakkelijken. Nadat het 60 uur vouwreactie is voltooid, wordt overmaat nietjes verwijderd met behulp van een centrifugaal filter, gevolgd door visualisatie via agarose-gelelektroforese (AGE). Tenslotte wordt een succesvolle vervaardiging van de nanorobot geverifieerd door transmissie- elektronenmicroscopie (TEM),het gebruik van uranyl-formiaat als negatief vlek.

Introduction

De toepassingen voor nucleïnezuren nanotechnologie zijn verbazingwekkend. De volgzaamheid van de Watson-Crick baseparing en het gemak en de relatief lage kosten van grootschalige synthese van op maat gemaakte oligo 2 een explosie toepassingen 3 en onderzoek op het gebied van DNA nanotechnologie gegenereerd. Structurele DNA nanotechnologie, gebaseerd op de immobiele Seeman knooppunt 4,5 als hoeksteen maakt gebruik van DNA als een zelfassemblerende elementaire eenheid voor de constructie van willekeurige vormen 6-8.

De recente ontwikkeling van de steigers DNA Origami 9-techniek maakt de constructie van complexe 2D / 3D nano-architecturen 10-12 met sub-nanometer precisie en een efficiënte route voor het bouwen van nieuwe functionele objecten met toenemende complexiteit en verbazingwekkende diversiteit. De constructie is gebaseerd op een lange scaffold enkelstrengs DNA, gewoonlijk afgeleid van een viraal genoome, die kunnen worden gevouwen door de hybridisatie van honderden korte enkelstrengs DNA-oligo genoemd nietjes. De hoge structurele resolutie verkregen met deze techniek is het directe gevolg van de natuurlijke omvang van de DNA dubbele helix, terwijl de reproduceerbaarheid van fabricage is het resultaat van afstemming van de korte enkelstrengs sequenties nietje de maximum waterstofbinding complementariteit haalbaar vergemakkelijken. Met het gebruik van een langzame temperatuur annealing de helling gemaakt laagste energie thermodynamisch voorkeur nanostructuur in hoge opbrengsten en betrouwbaarheid wordt bereikt. De eenvoudige implementatie van ontwerpregels knooppunt in een computercode kon de ontwikkeling van CAD-hulpmiddelen, zoals caDNAno 13, dat zeer de taak van het ontwerpen van grote, complexe structuren met honderden verbonden knooppunten vereenvoudigen.

Eerder beschreven we het ontwerp van een DNA nanorobot met behulp van het gereedschap caDNAno 14,15. Hier tonen we de fabricage envisualisatie via transmissie-elektronenmicroscopie (TEM) van de nanorobot een 3D holle zeshoekige nanodevice, met afmetingen van 35 x 35 x 50 nm 3, die een belangrijke conformationele verandering in reactie ondergaan een voorafbepaalde stimuli en dit specifieke lading, zoals eiwitten of nucleïnezuur oligo, afgezonderd binnen. Terwijl 12 laadstations zijn beschikbaar in de holle chassis, het werkelijke aantal gebonden lading verschilt met lading grootte. Lading moleculen variëren van kleine DNA-moleculen enzymen, antilichamen en 5-10 nm goud nanodeeltjes. Cargocan ofwel uniform of heterogeen, zodat elke nanorobot bevat een mengsel van verschillende moleculen. Sensing wordt bereikt via twee dubbele helix vergrendeling poorten ontwerp tot eiwitten, nucleïnezuren of andere chemische stoffen te voelen, hetzij op basis van aptasensor 16,17 of DNA-streng verplaatsing 18 technologieën. Recente ontwikkelingen in aptameer selectie protocollen 19-21 staat het ontwerp van nanorobots reagereneen steeds groeiend aantal moleculen en celtypen.

Eerder werk toonde een nanorobot met een specifiek antilichaam, die bij kan binden aan het antigeen ervan relais ofwel een remmend of een vruchtbare signaal naar de binnenkant van specifieke celtypen in een gemengde celpopulatie 15. Een interessante eigenschap van deze nanodevices is hun vermogen om nog meer complexe taken en logische regeling uitvoeren met de introductie van verschillende nanorobot subtypes in één populatie. Onlangs toonden we specifieke subtypen van nanorobots uitvoeren als positief of negatief regelen, besturen van een effector populatie die een actief molecuul cargo 22.

De hier gepresenteerde protocol beschrijft de vervaardiging, zuivering en beeldvorming van een nanorobot omheind met sensor aptameer sequenties die selectief PDGF binden aan de opening van de nanorobot 15,22 vergemakkelijken. Het fabricageproces beschreven is vergelijkbaar met de nanorobot fabricageproces aanvankelijk afgebeeld door Douglas et al. 15 met de veranderingen die gericht zijn op vermindering van de totale duur proces, terwijl het verhogen van de opbrengst en zuivering tarieven.

Protocol

1. Voorbereiding van Staples Pool Mixture

  1. Order gevriesdroogd DNA nanorobot nieten 96 putjes zoals vermeld in Tabel 1 (zie Materialen) en normaliseren tot 10 nmol. Voor een uitvoerige beschrijving van het ontwerp en de architectuur van het DNA nanorobot Zie Ben-Ishay et al. 14 en Douglas et al. 15).
  2. Reconstitueer iedere kram goed met DNase / RNase-free ultrazuiver tot een concentratie van 100 uM. Voor nietjes genormaliseerd tot 10 nmol, reconstitueren met 100 ul van ultrapuur water.
  3. Zwembad samen 20 pi van elke nietje met behulp van een multichannel pipet en een steriele 55 ml oplossing bekken.
    Opmerking: Aangezien de nanorobot vorm bestaat uit 254 stapelvezels strengen (inclusief Core, randen, handvatten en Guides sequenties tabel 1), de concentratie van elk van de nietjes in het nietjes zwembad 394 nM. Het verwijderen van nietjes uit het nietje zwembad, of het toevoegen van een aantal op verschillende vollumes, kan de opbrengst aanzienlijk verminderen of anderszins gevolg ongevouwen aggregaten.

2. Voorbereiding van Fabrication Reaction Mixture

  1. Voor een standaard reactiemengsel gebruiken 40 ul van M13mp18 virale genoom circulair enkelstrengs DNA, wat overeenkomt met 4 pmol steiger DNA (100 nM voorraad oplossing, zie Materials). De eindconcentratie van scaffold in de fabricage mengsel 20 nM, eindvolume 200 pl.
    1. Pas de hoeveelheid steiger DNA volgens specifieke behoeften; echter, houdt de eindconcentratie van scaffold DNA in het reactiemengsel bij een constante 20 nM.
  2. Nietjes toe te voegen aan een steiger om nietjes verhouding van 1 te bereiken tot 10, respectievelijk. Voor een 20 nM steiger DNA-concentratie, elk van de uiteindelijke concentratie 254 nietjes 'is 200 nm. Voor een 200 ul laatste reactie volume toe te voegen 102 ul van de nietjes zwembad mengsel (paragraaf 1.2).
    1. Voeg specifieke Gate sequenties apart the vouwen reactiemengsel op dit moment. Deze oligo's worden apart besteld en vereisen HPLC zuivering. Zorg ervoor dat Gate oligo's aanwezig zijn in een 01:10 steiger aan Gate volgorde verhouding zijn, dat wil zeggen 200 nm van elke oligo voor een 20 nM steiger concentratie. Voor een 200 ul reactievolume vouwen, voeg 0,4 ul van elk van de vier Gate oligo in een 100 pM voorraad concentratie.
  3. Voeg 10 x TAE stock buffer tot een eindconcentratie van 1 x TAE (40 mM Tris-acetaat, 1 mM EDTA) te bereiken. Voor een 200 ul reactievolume vouwen, voeg 20 ul van 10x TAE.
  4. Voeg 1 M MgCl2 tot een eindconcentratie van 10 mM. Voor een 200 ul reactievolume vouwen, voeg 2 pl 1 M MgCl2.
  5. Voeg 36 ul DNase / RNase vrij ultrapuur water om een ​​eindvolume van 200 pl te bereiken.
  6. Vortex en monster 100 ul monsters in PCR flesjes.
    Opmerking: Raadpleeg thermocycler specificatie met betrekking tot de maximale reactie volumes worden gebruikt.Vermindering van het volume aan deze limieten voldoen zal de verkregen opbrengst verminderen. Reactie volumes boven de maximale opgegeven zal de opbrengsten in gevaar brengen.

3. Temperatuur Annealing Ramp van Fabrication Reaction

  1. Programma thermische cycler als volgt:
    1. Helling 85 ° C tot 60 ° C met een snelheid van 5 min / ° C.
    2. Helling 60 ° C tot 4 ° C bij een snelheid van 75 min / ° C.
    3. Houd bij 4 ° C voor onbepaalde tijd.
  2. Na fabricage is opslag samples beëindigd bij -20 ° C.

4. Verwijdering van Excess Staples

  1. Voeg 100 ul van vouwen reactiemengsel tot een 0,5 ml centrifugaal filter met een MWCO van 100 kDa. Sla een 10 ui monster van nanorobots voorzuivering voor latere analyse.
  2. Centrifugeer 10 minuten bij 9600 x g.
  3. Voeg 400 gl vouwingsbuffer (1 x TAE, 10 mM MgCl2).
  4. Herhaal de stappen 4,2 en 4,3 keer meer.
  5. Centrifugeer gedurende 5 minuten bij 9600 x g.
  6. Herstel het concentraat door het plaatsen van de filter ondersteboven in een schone microcentrifugebuis en centrifugeren gedurende 1 min bij 9.600 x g. Final volumes kunnen variëren afhankelijk van het oorspronkelijke volume fabricage reactiemengsel dat in de filter werd gezet. Typisch een 25-60 ul eindvolume van geconcentreerde nanorobot monster wordt verkregen.
  7. Meet concentratie van DNA in de monsters via spectrofotometer bij 260 nm. Gebruik moleculair gewicht van 5,3 ug / pmol bij de berekening van molaire concentraties van nanorobot monsters.
    Opmerking: De molaire extinctiecoëfficiënt van dsDNA, 50 ug / OD 260 is voldoende voor de meeste toepassingen. 48 ug / OD 260 houdt rekening met de poly thymine ssDNA strekt de randen nietjes.

5. Agarosegelelektroforese Analyse van gevouwen Nanorobots

  1. Bereiding van 0,5 x TBE (45 mM Tris-boraat, 1 mM EDTA), 2% agarosegel gesupplementeerd met 10 mM MgCl2 et al. 21):
    1. Bereid 0,5x TBE buffer door verdunning van 6,25 ml van 10x TBE voorraad buffer in 118,75 ml van DDH 2 O.
    2. Oplossen in 125 ml 0,5X TBE buffer 2,5 g agarose.
    3. Kook in de magnetron tot de agarose volledig is opgelost.
    4. Voeg 1,25 ml van 1 M MgCl 2 tot eindconcentratie van 10 mM.
    5. Voeg 7 pl van 10 mg / ml ethidiumbromide.
    6. Wachten voor oplossing enigszins afkoelen en vul de gel lade voordat de agarosegel stolt. Installeer de gewenste kam onmiddellijk.
    7. Bereid 1 L 0,5x TBE loopbuffer door toevoeging van 50 ml 10 x TBE-buffer voorraad en 10 ml 1 M MgCl 2 om 940 ml van DDH 2 O.
    8. Zodra gel vast add loopbuffer om de elektroforese-inrichting en zet inrichting in een ijsbad.
  2. Belasting 1 ug totaal DNA van de nanorobots voorzuivering (stap 3.2), en na zuivering (stap 4.7), naast een steigerDNA-monster en een 1 kb DNA-merker, op de gel. Een voorbeeld wordt gegeven in figuur 2. Werkelijke hoeveelheden monsters afhankelijk van de concentratie verkregen na zuivering. Elk monsters geladen met laadbuffer in een 1: 6 eindvolume ratio.
  3. Stel stroombron tot 80 V en draaien gel voor 3 uur. Voer de gel in een bad gevuld met ijs en water. Nanorobots zal ontvouwen en verschijnen als een uitstrijkje als de agarosegel wordt tijdens elektroforese. Tijdens elektroforese voeg extra ijs om het apparaat te houden van verwarming.
  4. Bekijk gel op een UV tafel (Figuur 2).

6. Negative Stain van Nanorobot met Uranyl-formaat

  1. Bereiding van 2% uranyl-formiaat stockoplossing (naar Castro et al. 23):
    1. Weeg 100 mg van uranyl-formaat poeder in een 15 ml buis.
    2. Kook DNase / RNase gratis ultrapuur water gedurende 3 minuten om de-oxygenaat-.
    3. Voeg 5 ml gedeoxygeneerd heet water (~ 60 ° C)in de 15 ml buis met het uranyl-formiaat poeder (uit de vorige stap). Goed sluit het deksel, wikkel in aluminiumfolie en vortex grondig gedurende 10 min (Fasten buis naar een vortex). Oplossing moet troebel met een gele kleur verschijnen.
    4. Filter oplossing door een 0,2 um spuit fi lter. Oplossing moet helder worden.
    5. Aliquot 200 ul van de oplossing in microcentrifugebuizen.
    6. Centrifugeer bij maximale snelheid gedurende 5 minuten in een tafelmodel centrifuge pool monsters op de bodem van de buis.
  2. Laden van het monster op raster en negatieve kleuring:
    1. Ontdooi een 200 pi hoeveelheid van 2% uranyl-formiaat oplossing (bereid in paragraaf 6.1). Voeg 10 ul van 0,5 M NaOH-oplossing en grondig vortex gedurende 3 min. Centrifuge bij maximale snelheid gedurende 5 minuten met behulp van een tafelblad centrifuge.
    2. Ondertussen, glow-ontlading raster met kamer lucht bij 0,2 mbar en 25 mA voor 30 sec.
    3. Voeg 15 ul van 2 nM nanorobot monster na zuivering (sectiop 4,7) op de bovenzijde van het rooster (gehouden met een pincet) en laat absorberen 1 min. Gebruik fi filter papier om het overtollige vocht weglopen door het plaatsen van het rooster boven op het filterpapier. Raak het oppervlak rooster niet aan.
    4. Voeg 10 ul van de 2% uranyl-formaat (van stap 6.2.1) op de bovenzijde van het rooster (gehouden met een pincet).
    5. Gebruik Snel fi filter papier om het overtollige vocht weglopen door het plaatsen van het rooster boven op het filterpapier. Raak het oppervlak rooster niet aan.
    6. Herhaal de stappen 6.2.4 en 6.2.5.
    7. Voeg 10 ul van de 2% uranyl-formaat (van stap 6.2.1) op de bovenzijde van het rooster (gehouden met een pincet). Laat kleurstofoplossing inwerken 30 sec.
    8. Gebruik fi filter papier om het overtollige vocht weglopen door het plaatsen van het rooster boven op het filterpapier. Raak het oppervlak rooster niet aan.
    9. Laat het rooster drogen gedurende ten minste 30 min, open op een filterpapier, vóór het injecteren in de TEM.

Representative Results

Representatieve resultaten worden getoond in figuur 2A. Alle lanen bevatten 1 ug totaal DNA, gemeten via de spectrofotometer (OD 260). Vergeleken met cirkelvormige enkelstrengs DNA scaffold (Baan 2), zijn nanorobots gehinderd in de gel als gevolg van hun hogere molecuulgewicht gevolg nietjes hybridisatie met het DNA scaffold (Lane 3. Rode pijl). Het laagmoleculaire band in Lane 3 vertegenwoordigt overtollige nietjes die niet binden aan de steiger DNA (groene pijl). Na zuivering via centrifugale filtratie merendeel van de overtollige nietjes verwijderd (lanen 4-6) en de nanorobots zijn klaar om te worden geladen met lading moleculen geconjugeerd aan de handgrepen complementaire streng 14,15,22. Lanen 4-6 bevatten hoog moleculair gewicht bands vertegenwoordigen nanorobot dimeren (blauwe pijl), een bevolking van nanorobots die aan elkaar zijn gebonden. Het verminderen van de concentratie van de steiger in de fabricageprocedure (hetzij 5 of 10 nM) kunnen mogelijk reduce de relatieve hoeveelheid van deze hoge gewicht moleculaire structuren. Lanen 4-6 tonen nanorobots post-zuivering met lichte variaties op de beschreven zuivering protocol, namelijk het oorspronkelijke volume van gefabriceerde nanorobots aan de spin-filter (Stap 4.1 toegevoegd Lane. 4: 50 pl; Lane 5: 100 pl; Laan 6: 100 gl), en het aantal keren dat de buffer werd toegevoegd aan het filter (Stap 4,4 Laan 4: 2 maal, Laan 5:. 2 maal, Laan 6: 5 keer).

Vergelijking van de opbrengst en zuivering resultaten tussen de verschillende variaties van het protocol (figuur 2C) blijkt dat het oorspronkelijke volume van gefabriceerde robots den centrifugaal filter geladen (stap 4,1) weinig effect op de opbrengst en zuivering tarieven. Verder verhoging van het aantal buffer uitwisseling en centrifugaal spins (stap 4,4) heeft marginale invloed op de zuiverheid van de nanorobots, terwijl de opbrengst aanzienlijk verminderen. Vandaar de beschreven protocol, overeenkomend met 100 glbeginvolume en 2 buffer toevoegingen (Baan 5), wordt als optimaal beschouwd.

Opbrengst schattingen zijn gebaseerd op spectrofotometer (OD 260) metingen van elk monster na zuivering en berekend op de aanvankelijke hoeveelheid in elk centrifugaal filter geplaatst. Zuivering is gebaseerd op het gewichtspercentage van de nanorobots van de gehele DNA in het monster, overeenkomend met de nanorobots en overtollige nietjes die niet spoelen tijdens de zuivering. Zuivering schattingen worden berekend uit de relatieve intensiteit van de nanorobots (rode en blauwe pijlen in figuur 2A) met dat van de overtollige nietjes (groene pijl in figuur 2B). De relatieve nanorobots / nieten intensiteiten werden genormaliseerd met de vooraf gezuiverde monster (baan 3), waarbij het totale DNA gewicht van de nietjes (groene pijl) ~ 4,5 maal die van het ongezuiverde nanorobots (rode pijl), overeenkomend met een eerste 10: 1 scaffoldnietjes molverhouding in de fabricage protocol.

Definitieve validatie van de structurele integriteit wordt bereikt via de transmissie-elektronenmicroscopie met 2% uranyl-formaat als een negatieve vlek. Foto's worden weergegeven in figuur 3.

Figuur 1
Figuur 1: Ontwerp schema van de nanorobot (A) Zijaanzicht van een gesloten nanorobot.. Poort dubbele helix, door een aptameer-sequentie en een complementaire streng, wordt aangegeven door een groene pijl. (B) vooraanzicht van een gesloten nanorobot toont eiwit lading binnen gebonden. (C) Dwarsdoorsnede schema van gesloten nanorobot geproduceerd. Handvatten nietjes worden gemarkeerd door een rode pijl. Groene cirkels geven helixen die scharnieren aan de ene kant en een poort sequentie aan de andere kant bevatten. (D) Blauwdrukken vaneen nanorobot in zijaanzicht. Handgrepen zijn aangegeven met rode pijlen. Poort sequenties zijn aangegeven door groene pijlen. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2:. Agarose gel-elektroforese resultaten (A) Laan 1: 1kb Marker. Laan 2: M13mp18 ronde enkelstrengs schavot. Laan 3: nanorobots voorzuivering. Lanen 4-6: nanorobots plaatsen zuiveringen. Laan 4: 50 ul oorspronkelijke volume; 2 buffer toevoegingen. Laan 5: 100 pi oorspronkelijke volume; 2 buffer toevoegingen. Laan 6: 100 pi oorspronkelijke volume; 5 buffer toevoegingen. Overtollige nietjes worden aangegeven met een groene pijl Vervaardigd nanorobots worden aangegeven met een rode pijl. Blauwe pijl aangegeven nanorobot dimeren. (B) 3D weergave van de relatieve intensiteit van de band in de agarosegel. (C) opbrengst en zuivering schattingen.

Figuur 3
Figuur 3: TEM foto van DNA nanorobots genomen uit meerdere verzinsels / kleuringen.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> Core 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
Aantal Aanwijzing Sequentie
1 Kern AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 Kern GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 Kern TACGATATAGATAATCGAACAACA
4 Kern CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 Kern GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 Kern GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 Kern AAAATCACCGGAAGCAAACTCTGTAGCT
8 Kern CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 Kern CATGTAAAAAGGTAAAGTAATAAGAACG
10 Kern ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 Kern ATAGTCGTCTTTTGCGGTAATGCC
12 Kern AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 Kern AACTATTGACGGAAATTTGAGGGAATATAAA
14 Kern ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 Kern AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 Kern GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 Kern GCACCGCGACGACGCTAATGAACAGCTG
18 Kern AACTTCATTTTAGAATCGCAAATC
19 Kern CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 Kern CCAATCAAAGGCTTATCCGGTTGCTATT
21 Kern AGAGGCGATATAATCCTGATTCATCATA
22 Kern CCGTAATCCCTGAATAATAACGGAATACTACG
23 Kern AAATGGTATACAGGGCAAGGAAATC
24 Kern TCCTCATCGTAACCAAGACCGACA
25 Kern CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 Kern ACCCGCCCAATCATTCCTCTGTCC
27 Kern CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 Kern CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 Kern TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 Kern
31 Kern AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 Kern ACATTCAGATAGCGTCCAATATTCAGAA
33 Kern AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 Kern GAGATGACCCTAATGCCAGGCTATTTTT
35 Kern TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 Kern GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 Kern AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 Kern ACCAATCGATTAAATTGCGCCATTATTA d>
39 Kern ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 Kern CCCTAAAAGAACCCAGTCACA
41 Kern GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 Kern CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 Kern TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 Kern TTCCTTATAGCAAGCAAATCAAATTTTA
45 Kern ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 Kern AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 Kern TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 Kern AAAGAAACAAGAGAAGATCCGGCT
50 Kern TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 Kern TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 Kern ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 Kern AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 Kern ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 Kern TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 Kern AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 Kern CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 Kern TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 Kern ATAACGCAATAGTAAAATGTTTAAATCA
60 Kern ACGAATCAACCTTCATCTTATACCGAGG
61 Kern TAATGGTTTGAAATACGCCAA
62 Kern CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 Kern ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 Kern AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 Kern AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 Kern GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 Kern TTTTAGAACATCCAATAAATCCAATAAC
69 Kern AAATGTGGTAGATGGCCCGCTTGGGCGC
70 Kern ACGGATCGTCACCCTCACGATCTAGAATTTT
71 Kern CGCCATAAGACGACGACAATAGCTGTCT
72 Kern GCGTATTAGTCTTTAATCGTAAGAATTTACEEN
73 Kern AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 Kern AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 Kern TAATTTAGAACGCGAGGCGTTAAGCCTT
76 Kern ACCAGGCGTGCATCATTAATTTTTTCAC
77 Kern CAGCCTGACGACAGATGTCGCCTGAAAT
78 Kern ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 Kern CTCGAATGCTCACTGGCGCAT
80 Kern GGGCAGTCACGACGTTGAATAATTAACAACC
81 Kern
82 Kern TCAACCCTCAGCGCCGAATATATTAAGAATA
83 Kern ATTATACGTGATAATACACATTATCATATCAGAGA
84 Kern GCAAATCTGCAACAGGAAAAATTGC
85 Kern ATAATTACTAGAAATTCTTAC
86 Kern TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 Kern AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 Kern CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 Kern TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 Kern AAATCAAAGAGAATAACATAACTGAACACAGT
92 Kern CTGTATGACAACTAGTGTCGA
93 Kern ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 Kern TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 Kern ATAAGAATAAACACCGCTCAA
96 Kern CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 Kern AACCGCCTCATAATTCGGCATAGCAGCA
98 Kern AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 Kern CAGTATAGCCTGTTTATCAACCCCATCC
100 Kern TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 Kern CGTCGGAAATGGGACCTGTCGGGGGAGA
102 Kern AAGAAACTAGAAGATTGCGCAACTAGGG
103 Kern CCAGAACCTGGCTCATTATACAATTACG
104 Kern ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 Kern CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 Kern GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 Kern ACATCGGAAATTATTTGCACGTAAAAGT
109 Kern CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 Kern AAATCGTACAGTACATAAATCAGATGAA
111 Kern TTAACACACAGGAACACTTGCCTGAGTATTTG
112 Kern AGGCATAAGAAGTTTTGCCAGACCCTGA
113 Kern GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 Kern AGCTGCTCGTTAATAAAACGAGAATACC
115 Kern CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 Kern CACCCTCTAATTAGCGTTTGCTACATAC
117 Kern GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 Kern GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 Kern ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 Kern GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 Kern GGCTTGCGACGTTGGGAAGAACAGATAC
122 Kern TAAATGCCTACTAATAGTAGTTTTCATT
123 Kern TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 Kern TGACCATAGCAAAAGGGAGAACAAC
125 Kern CGAGCCAGACGTTAATAATTTGTATCA
126 Kern GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 Kern AGACGCTACATCAAGAAAACACTTTGAA
128 Kern AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 Kern GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 Kern GGTATTAAGGAATCATTACCGAACGCTA
131 Kern GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 Kern
133 Kern ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 Kern AACGAGATCAGGATTAGAGAGCTTAATT
135 Kern TACCAAGTTATACTTCTGAATCACCAGA
136 Kern CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 Kern AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 Kern TTTCAACCAAGGCAAAGAATTTAGATAC
139 Kern TTGAAATTAAGATAGCTTAACTAT
140 Kern CTATTATCGAGCTTCAAAGCGTATGCAA
Kern CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 Kern GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 Kern CGAACGTTAACCACCACACCCCCAGAATTGAG
144 Kern GTGTGATAAATAAGTGAGAAT
145 Kern GCTATATAGCATTAACCCTCAGAGA
146 Kern AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 Kern CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 Kern CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 Kern
150 Kern ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 Kern ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 Kern TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 Kern AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 Rand TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 Rand TTTTTTTTTTTTTTTTAATAAGAGAATA
156 Rand TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 Rand
158 Rand TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 Rand TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 Rand TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 Rand TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 Rand TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 Rand TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 Rand TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 Rand TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 Rand TTTTTTTTTTTTTTTACCGGATATTCA
167 Rand TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 Rand TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 Rand CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 Rand CAATGACAACAACCATTTTTTTTTTTTTTTT
171 Rand TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 Rand TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 Rand
174 Rand TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 Rand TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 Rand TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 Rand CCACACAACATACGTTTTTTTTTTTTT
178 Rand TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 Rand TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 Rand TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 Rand TTTTTTTTTTTTTTTACGGCGGAT
182 Rand TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 Rand TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 Rand TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 Rand TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 Rand TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 Rand TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 Rand ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 Rand
190 Rand TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 Rand GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 Rand GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 Rand ATAACGTGCTTTTTTTTTTTTTTTTTT
194 Rand TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 Rand TTTTTTTTTTTTTTTACAAAATAAACA
196 Rand TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 Rand
198 Rand TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 Rand GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 Rand TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 Rand CACTAAAACACTTTTTTTTTTTTTTTT
202 Rand TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 Rand TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 Rand TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 Rand TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 Rand TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 Rand CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 Rand TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 Rand AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 Rand ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 Rand TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 Rand TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 Rand TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 Rand TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 Rand TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 Rand TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 Rand TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 Rand AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 Rand CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 Rand TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 Rand TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 Rand TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 Rand AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 Rand CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 Rand TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 Rand TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 Rand TTTTTTTTTTTTTCATCTTTGACCC
230 Rand TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 Rand GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 Rand TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 Rand GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 Rand TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 Rand TTTTTTTTTTTTTTTATAGCAATAGCT
236 Grepen AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 Grepen ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 Grepen CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 Grepen CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 Grepen CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 Grepen CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 Grepen AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 Grepen CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 Grepen CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 Grepen TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 Grepen AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 Grepen GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 Gidsen AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 Gidsen ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 Gidsen CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 Gidsen GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 Gidsen AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 Gidsen TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 Gidsen TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 Gidsen Removal GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 Gidsen Removal GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 Gidsen Removal TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 Gidsen Removal AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 Gidsen Removal CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 Guides Removal GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 Gidsen Removal ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 Gates Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 Gates Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 Gates Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 Gates Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

Tabel 1: Lijst van de voornaamste sequentiesgebruikt om de nanorobot construeren. nietjes 1-153 worden aangeduid Core en vormen het grootste deel van de structuur. Nietjes 154-235 worden aangeduid randen en liggen aan elk van de uiteinden van de spiralen 61 van de constructie. Edge nietjes bevatten poly thymine staart ontworpen om aggregatie van nanorobots voorkomen. Staples 236-247 zijn aangewezen Handvatten en deel uitmaken van de lading docking sites. Verwerkt nietjes een uniek sequentiegebied, ze aansluit op de specifieke locatie van de structuur, en een consensus sequentie gebied dat wordt gebruikt als docking site voor de lading moleculen. Staples 248-254 zijn aangewezen Gidsen en bevestig de twee helften van het apparaat tijdens de gloeiproces. Na de fabricage Guides verwijderd door toevoeging van Guide Verwijdering nietjes 255-261 (stap 6), waarbij de inrichting vergrendeld door de twee sensoren van het nanorobot. Sensor sequenties worden aangeduid Gates. Beide sensoren bestaat uit een PDGF aptameer en een complementaire streng. Voor een meer gedetailleerde TOELICHTInatie Ben-Ishay et al. 14 en Douglas et al. 15. nietjes worden commercieel besteld op drie 96-wells platen (diepe ronde bodem). Elke stapelvezels hoeveelheid is genormaliseerd tot 10 nmol. Behalve voor de Poort sequenties, die HPLC zuivering nodig hebben, hoeft nietjes geen speciale zuivering procedure vereisen.

Discussion

We beschreven de vervaardiging, zuivering en visualisatie van de DNA nanorobot. Na vervaardiging van de hexagonale chassis van de inrichting, is de functie van de nanorobot geprogrammeerd met de eenvoudige introductie van specifieke vracht en waarneming strengen de robot die gemakkelijk hun aangewezen positie ondervinden van de waterstofbinding complementariteit met beschikbare enkelstrengs docking plaatsen 14 , 15,22.

De fabricage beschreven protocol gebruikt een langzame annealing helling, die over het algemeen wordt gebruikt in ons lab uiteenlopende origami vormen vouw. Als productietijd wordt een sleutelfactor andere protocollen, zoals de snelle vouwen protocol beschreven door Sobczak et al. 24 worden gebruikt. Dit protocol wordt gemeld aan origami vouwen in hoge opbrengst te bereiken, maar het kalibratie voor elke origami vorm vereist.

Spin filtratie wordt gebruikt om de robots overmaat nietjes zuiveren. Bij het laden van de spin kolom met monsters of buffer, moet ervoor worden gezorgd het membraan niet te beschadigen met de pipetpunt. Het membraan kan eventueel scheuren resulteert in drastisch verminderde opbrengsten. Het is raadzaam om de doorstroming niet weg totdat de nanorobots worden gevisualiseerd door AGE.

Voor bepaalde toepassing een hogere zuivering tarief is gewenst; Dit kan worden bereikt door herhaaldelijk filtreren met de originele spinkolom. Voor nog hogere zuiverheid kan een nieuwe spin kolom worden gebruikt, maar dit zal een dramatische negatieve invloed op de opbrengst tarieven. Andere werkwijzen voor het zuiveren van DNA origami structuren werd getest zoals excisie uit agarosegel na elektroforese en dialyse van overtollige nietjes. Deze methoden resulteerden in beide poor yield of slechte zuivering tarieven opzichte van het beschreven protocol. Andere methoden, zoals PEG-gebaseerde zuivering 25 en de snelheid-zonale ultracentrifugatie 26 werden niet getest. Deze methoden worden gerapporteerd aan Achivooravond hoge zuivering tarieven, maar ze ofwel leiden tot slechte opbrengsten (rate-zonale ultracentrifugatie) of eisen neerslag (PEG-based) die potentieel schadelijk kunnen zijn de holle nanorobot vorm.

Nanorobots worden gefabriceerd met Guide nietjes die de vorm in de gesloten stand om fabricage yeilds 15 verhogen vergrendelen. Het is belangrijk om deze nietjes verwijderen door toevoeging Guide verwijderen nietjes voor nanorobots effectief openen als reactie op de ontworpen stimuli (PDGF in het beschreven protocol). Guide nietjes zijn ontworpen met een toehold enkele streng regio voor de docking van Guide Verwijdering nietjes die de Guide nietjes vrijgeven door een proces van strengverplaatsing 18 .Deze nietjes worden toegevoegd bij een 10: 1 molaire verhouding aan het einde van de zuivering van overtollig stadium nietjes (stap 4,7) en gedurende 2 uur bij kamertemperatuur op een shaker over de kop.

Visualisatie door TEM werd beschreven, including uranyl-formaat 2% negatieve kleuring. Vergeleken met uranyl-acetaat, uranyl-formaat produceert fijnere korrel structuren die zorgen voor een betere resolutie van DNA-origami ontwerpen. Wees voorzichtig als uranyl formiaat stollen als monsters gedurende langere tijd worden bevroren. Het is raadzaam om een ​​vers bereide 2% uranyl formiaat oplossing voor kleuring gebruikt. Beter resoluties zijn bereikt met het gebruik van Cryo-TEM 27.

De basis architectonisch ontwerp en fabricage protocol van de DNA nanorobot uiteindelijk uniform en eenvoudig. Echter, een groot flexibiliteit wordt geboden in de vorm van specifieke lading mengsels en detectie strengen. Bovendien is in een populatie vele subtypen kan worden ingebracht en hun relatieve stoichiometrie geprogrammeerd voor optimale specifieke behoeften. Nog grotere fijnafstelling van de specifieke kinetiek bij elke snelheidsbeperkende stap haalbaar met toenemende / dat kortere dubbele streng hybridisatie ofintroductie van mismatches op specifieke sleutelposities. Deze hoge mate van flexibiliteit met gemak van constructie zorgt voor de engineering van nanoschaal inrichtingen die in staat zijn zeer gevarieerd complexe taken in een biologisch relevante milieu.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs willen S. Douglas bedanken voor zeer waardevolle discussies en advies, en alle leden van de Bachelet lab voor nuttige discussies en werk. Dit werk wordt ondersteund door subsidies van de faculteit Life Sciences en het Instituut voor Nanotechnologie & Advanced Materials aan de Bar-Ilan Universiteit.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics