Metoder for Skin såre og Analyser for Wound Responses i

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

C. elegans epidermis og hårstråene danne en enkel, men sofistikert hudlaget som kan reparere lokalisert skade som følge av såret. Studier av sår svar og reparasjon i denne modellen har opplyst vår forståelse av cytoskeletal og genomiske svar på vevsskade. De to mest brukte metodene for å sår C. elegans voksen hud er stikk med mikroinjeksjon nåler, og lokale laser bestråling. Nål såret lokalt forstyrrer skjellaget, epidermis, og tilknyttet ekstracellulære matrise, og kan også skade indre vev. Laser bestråling gir mer lokaliserte skader. Såret utløser en rekkefølge av lett analysert responser inkludert epidermal forhøyet Ca 2 + (sekunder minutter), dannelse og lukking av en aktin inneholdende ring på sårstedet (1-2 timer), forhøyet transkripsjon av antimikrobielle peptid gener (2-24 hr), og arrdannelse. Hovedsak alle villtype voksne dyr overleve såret, hvorsom mutanter defekte i såret reparasjon eller andre reaksjoner viser redusert overlevelse. Detaljerte protokoller for nål og laser såret, og analyser for kvantifisering og visualisering av sår svar og reparasjonsprosesser (Ca dynamikk, aktin dynamikk, antimikrobielle peptid induksjon og overlevelse) presenteres.

Introduction

Hud sår helbredende mekanismer er av grunnleggende biologisk interesse og relevant for menneskers helse. Sårtilheling i virveldyr og pattedyr består av en kompleks serie av koordinerte reaksjoner fra flere vev og signalanlegg 1. Mange enkle genetisk modellorganismer er også i stand til å helbrede sår på huden to. Det er derfor av interesse å analysere genetisk medgjørlig modeller av huden sår reparasjon. Vi og andre har begynt å bruke Caenorhabditis elegans som ny modell for huden sårtilheling 3,4. Målet med denne protokollen er å muliggjøre et bredere sett av forskere til å bruke C. elegans som et verktøy for å undersøke molekylære og cellulære mekanismer for epidermal sårtilheling.

C. elegans hud består av epidermis (også kjent som hypodermis) og ekstracellulære cuticle 5. Voksen epidermis er dannet av et lite antall multinucleate syncytia, hvorav den største er syncytium known som hyp7. Overhuden er en enkel epitel som skiller ut skjellaget på sin apikale overflaten. Huden kan aktivt forsvare seg mot hud-trengende patogener og reparere små sår fire. Sårheling av C. elegans hud er robust, som nesten alle villtype dyr overlever kan overleve små sår forårsaket av nåler, eller lokale hudskader forårsaket av laserbestråling. C. elegans hud såret utløser en pakke med tiltak, inkludert en epidermal medfødte immunrespons, sårheling, og arrdannelse 4. De voksne epidermis er post-mitotisk, og sårtilheling involverer lokale cellulære responser i motsetning til epidermal spredning eller celle migrasjon. Vi har vist at hudens såret utløser en stor og varig økning av epidermal Ca 2+, krever membranen utvikler TRPM-kanalen GTL-2 og interne Ca 2 + 3 butikker. Epidermal Ca2 + signal er nødvendig for dannelse og lukking av F-aktin ringer på wound nettstedet. Sårende induserer også medfødte immunresponser som aktiverer transkripsjon av forsterkere som NLP-29. Sårene-indusert transkripsjon av forsterkere er avhengig av en TIR-1 / PMK-1 p38 MAP kinase kaskade selvstendig opptrer i epidermis 4. Defekter i enten Ca 2+ signalveien eller i det medfødte immunresponsen vil føre til lavere overlevelse etter såret. Den forholdsvis enkle konstruksjon av C. elegans epidermis, dens genetiske tractability og fordeler for in vivo avbildning gjør det til et utmerket system for å studere flere aspekter av sår reparasjon.

Her presenterer vi protokoller for de to vanligste metodene for såret: nål såret og laser såret. Nål såret krever ingen spesialutstyr (annet enn nålen avtrekker), og med erfaring kan utføres på hundrevis av ormer per dag. Nål såret er utført på dyr som vokser på agarplater. I kontrast er laser såret utført på anesthetized dyr montert på agar pads under et dekkglass, og er egnet for live avbildning av de cellulære responser til skade.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

De følgende protokoller beskrive detaljert prosedyre for C. elegans hud såret og for å analysere sår svar.

1. Needle såret 3,4

  1. Vokse sunne Usultede ormer på standard NGM (nematode vekstmedium) plater med E. coli OP50 bakterier som mat, vedlikeholdes i en 20 ° C inkubator.
    MERK: Metoder for NGM agar plater og rutine dyrking av C. elegans kan bli funnet på www.wormbook.org 6.
  2. Plukk 25 L4 scenen ormer til en fersk seeded plate 1 dag før såret og kultur ved 20 ° CO / N.
  3. Før såret, trekke nåler fra kapillærer ved hjelp av en nål avtrekker. Nålene som brukes i såret er identiske med de som brukes for mikroinjeksjon av C. elegans.
  4. Sørg for at alle ormene er på unge voksne stadiet. Plasser plate av ormer på is i omtrent 30 min. Kjøling fører dyrene til å være svak, tilrettelegging nål såret.
  5. Fjern agarplaten fra isen til en dissekere stereomikroskop. Ved hjelp av en snekke pick, beveger 25 ormer i sentrum av agarplaten.
  6. Sett nålen inn i en 100 mL pipette tips til lettere å holde nålen. Punktere den fremre eller bakre del av kroppen av ormen med nålen, å unngå gonade. Generelt, forsøke å såre mellom bakre svelg og anterior gonade, eller mellom den bakre gonade og endetarmen. Gjenbruk nåler mange ganger, før de bryter.
    MERK: Pass på sårene er korte, milde stikk som punkterer skjellaget og hud, gjennomtrengende ~ 5-10 mikrometer i dyret. Nålen bør gå inn i animal ved tilnærmet en rett vinkel til huden. Sårene bør ikke forårsake tydelige skader på indre organer, eller i umiddelbar ruptur av kroppen. Observere en liten mengde cytoplasma oser ut i noen sekunder etter at såret; imidlertid, hvis cellulære innholdet lekker ut over en lengre tid dyrene ikke vil overleve. For optimal bildebehandling, sår den laterale epidermal syncytium (hyp7) eller sidesømmen.
    MERK: Denne prosedyren omfatter bruk av et glass nål.
  7. Tillate ormer å gjenopprette ved RT deretter kultur ved 20 ° C. Bedømme suksessen av nålen såret av en rekke analyser som er beskrevet nedenfor. Mer enn 95% av villtype dyr overleve 24 timer etter nål såret i den unge voksne stadiet. Effekten av såret i larver eller eldre voksne har ennå ikke blitt grundig analysert.

2. Laser såret tre

Bruk femtosecond laser bestråling (800 nm) til å utføre mer presise såret.

  1. Forberede agar pannonser på et glass lysbilde med smeltet 2% agar 7. Sikre at putene er lik de agar pads brukes for live avbildning av C. elegans.
  2. Overføre 10 unge voksne ormer på agarose pad med orm plukke, og legge til en 2 ul dråpe 12 mM Levamisole løsning. Dekk dyrene og væske med en dekkglass. Vent 1-2 min for ormer å lamme.
  3. Plasser glass lysbilde på en spinnende disk konfokal mikroskop. Flytt scenen for å finne ormer og fokus på side fremre eller bakre syncytial epidermis med 100X objektiv (NA 1,4 til 1,46).
  4. Still inn effekten av femtosecond laser til 140 mW (målt før målet). Bruk femtosecond laser med en repetisjonsfrekvens på 80 MHz.
    MERK: To pulser av 200 msek hver (atskilt med 20 msek) er tilstrekkelig for såret i våre hender.
  5. Fokusere på den apikale overflaten av epidermal celle og sår epidermis. Observere lokal forstyrrelse av cytoplasma (bobler), eller lokal bleking of fluorescerende markør som brukes.
    MERK: Følg passende laser sikkerhetsprosedyrer når du bruker femtosecond laser. Linje- eller punktSkanning ved hjelp femtosecond lasere slik som de i to foton mikroskoper bør gi nok strøm til laser såret.
    MERK: Selv om vi ikke har direkte erfaring med å bruke andre lasere, bør i prinsippet såret være mulig ved hjelp av konvensjonelle UV lasere (som brukes i C. elegans celle ablations). Eventuelt bruke en fluorescens Recovery Etter fotobleking (FRAP) modul på spinne disk confocal å såre epidermis (N. Pujol, personlig kommunikasjon).

3. Visualisering av epidermal Ca 2+ Responses to såret

  1. Bruk transgen C. elegans stammer som uttrykker Ca 2 + sensorer (slik som de av GCaMP serie) i epidermis, under kontroll av den voksne epidermal promoter col-19 (figur 1A; transgener er oppført i MERK: Vi har brukt tdTomato som en intern kontroll for transgene uttrykk som epidermal tdTomato fluorescens er relativt stabil og ikke forstyrrer GCaMP bildebehandling.
  2. Både nål og laser såret trigger Ca 2+ høyde i overhuden. Men som nålen såret ikke lett kan utføres på en roterende disk konfokalt, er laser såret foretrekke for kvantitativ analyse av Ca 2+ respons (figur 1).
  3. Tilegne tid lapse bilder på flerdimensjonal oppkjøpet modus (intervall 2 sek med 114 msek eksitasjon laser eksponering) med en spinnende disk confocal med 100X objektiv (NA 1,4 til 1,46) og passende filtersett (GFP filtre vil arbeide for GCaMP3).
    MERK: Innhente time-lapse bilder hver 30 sek i ca 2 timer å undersøke Ca 2+ response til såret over lengre tid selvfølgelig.
  4. Ved hjelp av bildeanalyse programvare måle gjennomsnittlig GCaMP fluorescens i ti tilsvarende regioner av interesse (ROI), fem av dem er sentrert på epidermal celle cytosol og fem i bakgrunnen.
  5. Skaff baseline fluorescens (F 0) ved gjennomsnitt fluorescens i fem ROIs i epidermis deretter trekke gjennomsnittet av fem ROIs i bakgrunnen før skaden. Inn- endringen i fluorescens AF som forholdet mellom endringen i forhold til grunnlinjen [(F t -F 0) / F 0].

4. Visualisering av F-aktin Dynamics Etter såret

  1. MERK: Som svar på nål såret, observere en aktin ring på sårstedet som gradvis stenger rundt såret. Denne protokollen delen analyser sårheling ved å måle diameteren aktin ring.
  2. Generere transgene ormer som uttrykker en F-aktin markør som Drosophila moesin aktinbinding domene smeltet tilGFP, uttrykt under kontroll av en epidermal spesifikk promotor, slik som col-19 (Figur 2A) (transgen juIs352).
    MERK: Vi har fått lignende resultater ved bruk av andre aktinbinding domene markører som Lifeact eller F-tractin (upubliserte resultater).
  3. Utføre nål såret på P col-19- GFP-moesin transgene ormer. Etter nål såret, observere en ring av GFP-moesin rundt sårstedet ved ~ 5 min. Aktin ringen blir mindre i diameter og til slutt lukker 2-3 timer etter såret i villtype dyr (Figur 2A).
  4. Forberede en 2% agar pad på et glass lysbilde og overføre 10 ormer på puten i 2 ul 12 mM Levamisole løsning. Image de GFP-moesin ringer en time etter såret bruk av konvensjonell konfokalmikroskopi.
    MERK: Bruk konfokalmikroskopi å tilegne z-stacks (13 x 0,5 mikrometer) av aktin ringer en time etter såret.
  5. Mål diameteren aktin ring etter såret. For å kvantifisere epidermal GFP-moesin, først gjøre en maksimal intensitet projeksjon av z-stack og deretter trekke fire linjeavsøkingene (45 ° til hverandre) over GFP-moesin ring. Ringdiameter er definert som den gjennomsnittlige topp-til-topp avstand av de fire linjeavsøkingene (figur 2B). For ringer som allerede har stengt, er diameteren definert som 0 mikrometer.
    MERK: F-aktin ringene er beleilig målt en time etter såret da dette er omtrent halvveis gjennom lukking av sår prosess i villtypen. F-aktin ringer kan også måles på flere tidspunkter for å utlede en gang kurs for sårheling. Tid lapse filmer av sårlukking kan fremskaffes med levamisole-immobilisert ormer og spinne disk konfokalmikroskopi.

5. Analyse Induksjon av epidermal Antimikrobielle Peptider

MERK: såret utløser også medfødte immunresponser i C. elegans hud. Transkripsjon av gener som koder for antimikrobielle peptider (amp) er induced i overhuden. NLP-29 (neuropeptide-lignende protein) AMP er sterkt indusert av såret fire. For å analysere hvordan epidermis styrer AMP uttrykk etter såret, bruker transgene journalister eller real-time PCR for å påvise individuelle AMP transkripsjonsnivåer.

  1. Transgen reporter analysen for medfødte immunrespons på såret fire.
  2. Utføre nål såret (som i protokoll 1) på voksne dyr som uttrykker den transgene reporter frIs7, som inneholder P nlp-29- GFP og P col-12- DsRed som en intern kontroll. Observere unwounded voksne dyr som mørk rød eller oransje i en GFP lang pass filter.
    MERK: såret vill-type ormer vil indusere P NLP-29 -GFP uttrykk, men vil ikke påvirke P col-12 -dsRed, noe som resulterer i ormer som vises oransje, gul eller grønn i henhold GFP langpasning belysning. Tap av funksjon av gener i p38 MAPK-reaksjonsveien, slik som PMK-1 eller nsy-en vil blokkere nlp-29 -GFPinduksjon etter såret fire. P NLP-29- GFP er uttrykt i høye nivåer i larvestadier
  3. Utføre AMP induksjons analyser hos unge voksne dyr. Sørg for at unwounded kontrolldyrene har lave nivåer av GFP.
    MERK: P NLP-29- GFP uttrykk er også indusert av osmotisk stress 8, og kan være følsomme for andre miljømessige belastninger.
  4. 6 timer etter såret, score antall ormer som har P NLP-29 -GFP induksjon (figur 3) 9 ved hjelp av en fluorescens dissekere omfang med GFP lang-pass filter.
    MERK: På 1 time etter såret P nlp-29- GFP er synlig indusert, og nådde en topp ca 6 timer etter såret og deretter gjenværende forhøyet opp til 24 timer etter såret. Kvantifisere uttrykk ved visuell scoring 4,9. Alternativt kvantifisere uttrykk nivåer ved hjelp av en fluorescensaktivert orm sorter 4. For ormen sorter, minst 50 dyr trenger å bli skadet.
  5. Real-time PCR-analyse for quantitating transkripsjonsnivåer til de enkelte AMP gener. Analysetranskripsjonsnivåer for flere gener: nlp-29, NLP-30, cnc-en, og cnc-5.
  6. Utføre nål såret på villtype eller mutante ormer (se protokoll 1)
  7. Samle 50 sårede ormer og 50 unwounded ormer til ønsket tid (f.eks 3, 6, 24 timer) etter såret.
  8. Pakk RNA ved hjelp av et kommersielt kit å følge produsentens instruksjoner.
  9. Utføre revers transkripsjon å få total 20 fil cDNA ved hjelp av en kommersiell revers transkriptase kit.
  10. For RT-PCR ved å bruke 0,2 pl cDNA (førtindedel) fra hver prøve i kombinasjon med en grønn SuperMix med fluorescein og 0,2 pM primere. Å sammenligne RNA kvalitet, bruker ama-en eller SNB-1 RT-PCR som referanse; sammenligne AMP relative uttrykk nivå ved å normal til internkontroll (ama-en eller SNB-1), eller sammenligne fold induksjon post-såret (AMP induksjon i såret ormer / unwounded ormer) av normalizing til intern kontroll.
    MERK: cnc-en og cnc-5 er caenacin familie antimikrobielle peptider som transkripsjon aktiveres ved såret 10. Vanligvis induserer nål såret uttrykk (~ 500 ganger for cnc-1) over en tid løpet av 4 timer 10. Primere som brukes i publisert arbeid er angitt i tabell 2.

6. Analyse Survival Etter såret

  1. MERK: såret aktiverer minst to uavhengige signalveier i overhuden: Ca 2+ avhengige såret reparasjon sti og det medfødte immunresponsen sti. Begge veier er nødvendig for full overlevelse av sterile såret. For å teste om en mutant eller RNAi behandling påvirker sårtilheling, måle overlevelse på 24-48 timer etter såret. Eventuelt bruke konvensjonelle levetids analyser for å fastslå effekten av såret på levetid 4,9.
  2. Utføre nål såret på ung voksen (L4 + 24 timer) ormer (50 ormer, gjentar several ganger) etter protokoll 1 ovenfor. Opprettholde et tilsvarende antall unwounded ormer som kontroller.
  3. Sjekk overlevelse hver 24-timers (overføring sårede ormer til en ny agar plate hver 24 timer). Observere ~ 50% overlevelse 24 timer etter såret i mutanter som er defekt i sårreparasjon som GTL-2 eller tir-en, når normalisert til unwounded kontroll dyr. Døden er definert som en mangel på bevegelses respons å røre ved ormen hakke.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Laser eller nål såret vil utløse raske og vedvarende økning i epidermal Ca nivåer, som visualiseres med Ca sensorer som GCaMPs (figur 1). Ca heving skjer i løpet av sekunder, og forblir forhøyet for titalls minutter. Nål såret reproduserbart resulterer i dannelsen av F-aktin ringer på såret områder (figur 2); disse vises i løpet av minutter, og gradvis avslutning over 1-2 timer etter såret. Aktin ringene er sjeldnere dannet etter mer presis laser såret. Både nål og laser såret indusere uttrykk for epidermal antimikrobielle peptider (ampere) som NLP-29, oppdages med transkripsjons journalister (figur 3). AMP induksjon er tydelig innen 2-4 timer etter såret og varer ca 24 timer. Needle såret av villtypen bør ikke signifikant påvirker levedyktighet (målt til 24 timer etter såret) eller levetid.

Figur 1
Figur 1. Laser såret utløser en Ca 2+ respons i C. elegans epidermis. (A) epidermal GCaMP3 fluorescens (P col-19 -GCaMP3 (juIs319)) nivåer etter femtosecond laser såret. Lateral visning av epidermis i anterior-kroppen; x, laser såret; N, epidermal kjernen. Spinning disk konfokale bilder, intensitet kode. UW: unwounded, W:. Såret (B) Kvantifisering av GCaMP3 AF / F 0 etter 20, 40, og 60 mikrometer fra såret nettstedet; representative spor. Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Needle såret utløser aktin polymerisasjon rundt sårstedet. (A) col-19 GFP-moesin (juIs352). Skala: 10 mikrometer. UW: unwounded, W:.. Såret (B) Kvantifisering av aktin ring diameter fra linjeavsøkingene, 4 linjeavsøkingene per dyr (stiplet røde linjer i panel (A), WT) Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. epidermal såret aktiverer medfødte immunrespons. Representative bilder (WT unwounded, WT såret + 3 t) av P NLP-29 -GFP (frIs7) induksjon etter nål såret. Skala.: 200 mikrometer Klikk her for å vise enstørre versjon av dette tallet.

Reporter Transgen Fluorescens Allel
Kalsium Pcol-19-GCaMP3; Pcol-19-tdTomato GFP / tdTomato juIs319 X
Actin Pcol-19-GFP :: moesin GFP juIs352 jeg
NLP-29 Pnlp-29-GFP / Pcol-12-DsRed GFP / DsRed frIs7 IV

Tabell 1. transgener brukes i sår respons analyser. Denne tabellen viser kromosomer integrert transgener tilgjengelig på Caenorhabditis Genetics Center (http://www.cbs.umn.edu/research/resources/cgc).

Gene navn Sekvens
NLP-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
NLP-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
cnc-en F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
cnc-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ama-en F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-en F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Tabell 2. Primere som brukes for RT-PCR av AMP transkripsjoner. Arbeide konsentrasjonen er 0,2 mikrometer. SNB-en fungerer som intern kontroll.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Metodene som er presentert her for nålen og laser såret gi komplementære fremgangsmåter for å vurdere muligheten av epidermal epitel for å reparere skaden. Laser såret er relativt lokalisert og (avhengig av laser konfigurasjon) kan være begrenset til epidermis, mens nål såret forstyrrer epidermis, skjellaget, og sannsynlige interne basalmembraner. Nål såret kan mer nøyaktig ligne sår påført av patogener eller mekaniske skader på naturmiljøet. Som regel nål såret krever mer trening for å oppnå presise sår som er kompatible med dyr overlevelse. De cellulære responser til nål og laser såret visnings mange likheter. Imidlertid bør det bemerkes at dannelsen av aktin ringene ikke er reproduserbart observert etter femtosecond laser såret.

En begrensning av nålestikk er at det er ikke en presis sår: nålen også skader indre vev som bidrag til ormoverlevelse er ikke undersøkt. En mulig modifikasjon av denne fremgangsmåte vil være å kombinere mikrofluidbasert mikroinjeksjon systemet 11 og fluorescerende reportere til å utføre mer nøyaktige fysiske såret.

Nålen og laser såret metoder beskrevet her er enkel, men ganske arbeidskrevende, og i beste fall middels gjennomstrømning, noe som gjør det utfordrende å bruke genomisk eller biokjemiske metoder til karakterisering av såret respons. Cuticle trengende patogener som sopp eller protozoer 12,13 kan leveres til større bestander av dyr, og kan utløse reaksjoner som overlapper med responsen på såret, men likevel innføre ytterligere kompleksiteten av patogen konkrete svar. Videre arbeid vil være nødvendig for å undersøke om andre abiotiske metoder som ballistisk bombardement 14 eller matriser av mikromekaniske piercing strukturer 15 kan tilpasses for storskala såret.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics