Verfahren zur Haut Verwundung und Assays für Wound Antworten in

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die C. elegans Epidermis und Cuticula bilden eine einfache, aber anspruchsvolle Hautschicht, die lokalisierte Schäden durch Verwundung was zu reparieren. Untersuchungen der Wunde Antworten und Reparatur in diesem Modell haben unser Verständnis des Zytoskeletts und genomische Reaktionen auf Gewebeschäden beleuchtet. Die beiden am häufigsten verwendeten Verfahren, um die C gewickelt elegans erwachsenen Haut sticht mit Mikroinjektionsnadeln und lokale Laserbestrahlung. Nadel lokal Verwundung stört die Kutikula, Epidermis und der extrazellulären Matrix assoziiert und können auch innere Gewebe beschädigen. Laserbestrahlung führt zu mehr lokalisiert Schaden. Verwundung löst eine Reihe von leicht getestet Antworten einschließlich erhöhter epidermaler Ca 2+ (Sekunden-min), die Bildung und die Sperrung eines aktinhaltigen Ring an der Wundstelle (1-2 h), erhöhte Transkription des antimikrobiellen Peptids Gene (2-24 h) und die Narbenbildung. Im Wesentlichen alle erwachsenen Tiere Wildtyp überleben Verwundung, woMutanten in der Wundheilung oder andere Reaktionen defekt zeigen verringerte Überleben. Detaillierte Protokolle für die Nadel und Laser Verwundung und Assays zur Quantifizierung und Visualisierung von Wundantworten und Reparaturprozesse (Ca Dynamik Aktindynamik, antimikrobielles Peptid Induktion und Überlebensrate) dargestellt.

Introduction

Wundheilung der Haut Mechanismen der biologischen Grundlagen Interesse und relevant für die menschliche Gesundheit. Wundheilung in Wirbeltieren und Säugetieren umfaßt eine komplexe Reihe von koordinierten Antworten von mehreren Geweben und Signalisierungs 1. Viele einfache genetische Modellorganismen sind auch fähig, Heilung von Hautwunden 2. Es ist daher von Interesse, genetisch manipulierbaren Modelle der Haut die Wundheilung zu untersuchen. Wir und andere haben damit begonnen, Caenorhabditis elegans Verwendung als neues Modell für die Haut Wundheilung 3,4. Ziel dieses Protokolls ist es, eine breitere Gruppe von Forschern, C. nutzen zu können elegans als Werkzeug zur molekularen und zellulären Mechanismen der epidermalen Wundheilung zu untersuchen.

Die C. elegans Haut besteht aus der Epidermis (auch als Unterhaut bekannt) und die extrazelluläre Schuppenschicht 5. Die erwachsenen Epidermis ist aus einer kleinen Anzahl von mehrkernigen Syncytien, von denen der größte der Syncytium k gebildetnown als hyp7. Die Epidermis ist ein einfaches Epithel, das die Nagelhaut auf ihrer apikalen Oberfläche absondert. Die Haut kann aktiv gegen die Haut eindringenden Krankheitserreger zu verteidigen und zu reparieren kleine Wunden 4. Wundreparatur des C. elegans Haut ist robust, da fast alle Wildtyp-Tiere überleben können kleine Stichverletzungen durch Nadeln oder lokale Hautschäden durch Laserbestrahlung verursacht überleben. C. elegans Haut Verwundung löst eine Reihe von Reaktionen, einschließlich einer epidermalen angeborenen Immunantwort, Wundverschluss und die Narbenbildung 4. Die erwachsenen Epidermis ist postmitotischen und Wundheilung umfasst lokale Zellreaktionen im Gegensatz zu epidermalen Proliferation oder Zellmigration. Wir haben gezeigt, dass Haut Verwundung löst einen starken und nachhaltigen Anstieg der epidermalen Ca 2+, erfordern die Membran TRPM Kanal GTL-2 und der internen Ca 2+ Geschäfte 3. Für Bildung und Schließung von F-Actin Ringe an der wo ist der epidermale Ca 2+ Signal erforderlichund Ort. Verwundung induziert auch angeborene Immunantworten, die die Transkription AMPs wie NLP-29 zu aktivieren. Die Verwundung induzierten Transkription AMPs ist abhängig von einer TIR-1 / PMK-1 p38 MAP-Kinase-Kaskade wirkt sich autonom in der Epidermis 4. Defekte entweder in der Ca 2+ Signalweg oder in der angeborenen Immunantwort zu niedrigeren Überleben nach der Verwundung führen. Der relativ einfache Aufbau der C. elegans Epidermis, seine genetische Lenkbarkeit und Vorteile für die in-vivo-Bildgebung machen es ein ausgezeichnetes System, um mehrere Aspekte der Wundheilung zu untersuchen.

Hier präsentieren wir Protokolle für die beiden häufigsten Methoden der Verwundung: needle Verwundung und Laser Verwundung. Needle Verwundung erfordert keine spezielle Ausrüstung (mit Ausnahme der Nadel puller) und mit der Erfahrung kann auf Hunderte von Würmern pro Tag durchgeführt werden. Needle Verwundung auf Tiere wachsen auf Agar-Platten durchgeführt. Im Gegensatz dazu wird die Laser Verwundung auf anes geführtthetized Tieren montiert auf Agar-Pads unter einem Deckglas, und ist für die Live-Darstellung der zellulären Reaktionen auf Schäden geeignet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Die folgenden Protokolle beschreiben die detaillierte Prozedur für C. elegans Haut zu verletzen und zum Testen von Wundreaktionen.

1. Nadel Verwundung 3,4

  1. Wachsen gesunde unstarved Würmer auf Standard NGM (Nematoden Wachstumsmedium) Platten mit E. coli OP50 Bakterien als Nahrung, in einem 20 ° C Inkubator gehalten.
    HINWEIS: Methoden für die NGM-Agar-Platten und Routine Anbau von C. elegans kann www.wormbook.org 6.
  2. Wählen Sie 25 L4-Stadium Würmer zu einer frisch ausgesät Platte 1 Tag vor Verwundung und Kultur bei 20 ° CO / N.
  3. Vor der Verwundung, ziehen Nadeln aus Kapillaren mit einer Nadel Magnet. Die in Verwundung verwendeten Nadeln identisch mit denen für die Mikroinjektion von C verwendet werden elegans.
  4. Stellen Sie sicher, dass alle Würmer sind bei jungen Erwachsenen Bühne. Die Platte von Würmern auf Eis für ca. 30 min. Kühlung bewirkt, dass die Tiere träge zu sein, erleichtert Nadel Verwundung.
  5. Entfernen Sie die Agar-Platte aus dem Eis zu einem Präpariermikroskop Stereomikroskop. Mit einem Pick-Wurm, verschieben 25 Würmer in der Mitte der Agar-Platte.
  6. Stecken Sie die Nadel in einen 100 ul Pipettenspitze leichter halten Sie die Nadel. Punktion der vorderen oder hinteren Teil des Körpers der Schnecke mit der Nadel, die Vermeidung der Gonaden. Im allgemeinen versuchen, zwischen der hinteren Rachen und vorderen Gonade, oder zwischen dem hinteren Gonade und Rektum gewickelt. Wiederverwendung Nadeln mehrmals, bis sie brechen.
    HINWEIS: Achten Sie darauf, die Wunden sind kurze, sanfte Stiche, die die Nagelhaut und die Haut durchbohren, durchdringen ~ 5-10 um in das Tier. Die Nadel sollte das anim eingebenal ungefähr in einem rechten Winkel zu der Haut. Die Wunden sollten nicht dazu führen, offensichtlich Schäden an inneren Organen oder unmittelbaren Bruch des Körpers. Beachten Sie eine kleine Menge von Cytoplasma Nässen aus für ein paar Sekunden nach der Wunde; Wenn jedoch Zellinhalt austreten kann über einen längeren Zeitraum die Tiere nicht überleben. Für eine optimale Bildgebung, Wund die seitliche epidermalen Syncytium (hyp7) oder die seitliche Naht.
    HINWEIS: Dieses Verfahren umfasst die Verwendung einer Glasnadel.
  7. Lassen Würmer bei RT bei 20 ° C zu erholen, dann Kultur. Beurteilen den Erfolg der Nadel Verwundung von einer Reihe von unten beschriebenen Assays. Mehr als 95% der Wildtyp-Tiere überleben 24 h nach der Nadel zu verletzen im jungen Erwachsenenstadium. Die Wirkung der Verwundung in Larven oder älteren Erwachsenen ist noch nicht umfassend untersucht.

2. Laser Verwundung 3

Verwenden Femtosekunden-Laserstrahlung (800 nm), um genauere Verwundung durchzuführen.

  1. Bereiten Agar pAnzeigen auf einem Objektträger mit geschmolzenem 2% Agar 7. Achten Sie darauf, die Pads ähnlich wie die Agar-Pads für die Live-Darstellung von C verwendet werden, elegans.
  2. Übertragen Sie 10 jungen erwachsenen Würmer auf den Agarose-Pad mit Wurm holen, und fügen Sie ein 2 ul Tropfen 12 mM Levamisol Lösung. Decken Sie die Tiere und die Flüssigkeit mit einem Deckglas. Warten Sie 1-2 Minuten für die Würmer zu lähmen.
  3. Legen Sie die Objektträger auf eine sich drehende Scheibe konfokalen Mikroskop. Bewegen Sie die Bühne, um die Würmer zu finden und sich auf den seitlichen vorderen oder hinteren Syncytial Epidermis mit einer 100X Objektiv (NA 1,4 bis 1,46).
  4. Stellen Sie die Macht der Femtosekundenlaser bis 140 mW (gemessen vor dem Ziel). Verwenden der Femtosekundenlaser mit einer Wiederholungsrate von 80 MHz.
    HINWEIS: Zwei Pulse von 200 msec je (von 20 ms getrennt) sind ausreichend für Verwundung in unseren Händen.
  5. Konzentrieren Sie sich auf der apikalen Oberfläche der epidermalen Zell und Wund die Epidermis. Beachten Sie die örtlichen Störung des Zytoplasma (Blasenbildung), oder lokale Bleich of jeder Fluoreszenzmarker eingesetzt.
    HINWEIS: Befolgen Sie die entsprechenden Lasersicherheitsverfahren bei der Verwendung des Femtosekundenlaser. Linien- oder Punkt Scans mit Femtosekundenlasern, wie sie in zwei Photonenmikroskope sollte ausreichend Leistung für die Laser Verwundung bereitzustellen.
    HINWEIS: Während wir keine direkte Erfahrung mit anderen Lasern im Prinzip Verwundung sollte möglich sein, mit konventionellen UV-Laser (wie verwendet in C. elegans Zelle Ablationen). Optional können Sie eine Fluorescence Recovery After Photobleaching (FRAP) Modul auf Spinning-Disk-konfokale um die Epidermis (N. Pujol, persönliche Mitteilung) aufgewickelt.

3. Visualisierung von Epidermal Ca 2+ Responses to Verwundung

  1. Verwenden transgenen C. elegans-Stämme, die Ca 2+ Sensoren (wie beispielsweise solche der GCaMP Reihe) in der Epidermis exprimieren, unter der Kontrolle des Erwachsenen epidermalen spezifischen Promotor col-19 (1A; Transgene aufgeführt Anmerkung: Wir haben tdTomato als interne Kontrolle für die Expression des Transgens verwendet werden, wie epidermaler tdTomato Fluoreszenz relativ stabil ist und nicht mit GCaMP Abbildungs ​​stören.
  2. Sowohl Nadel und Laser Verwundung Trigger Ca 2+ Erhebung in der Epidermis. Als Nadel Verwundung nicht ohne weiteres auf einer sich drehenden Scheibe konfokalen geführt werden, ist jedoch Laser Verwundung bevorzugt für die quantitative Analyse des Ca 2+ Antwort (Abbildung 1).
  3. Erwerben Sie Zeitreihen-Aufnahmen in mehrdimensionalen Erfassungsmodus (Intervallzeit 2 s mit 114 ms Erregungslaserbelichtung) mit einer sich drehenden Scheibe konfokalen mit 100X Objektiv (NA 1,4 bis 1,46) und geeigneter Filtersätze (GFP Filter für GCaMP3 funktionieren).
    HINWEIS: Erwerben Sie Zeitraffer-Aufnahmen alle 30 Sekunden für ca. 2 Stunden, um die Ca 2+ bzw. prüfenonse zu verwunden über einen längeren Zeitverlauf.
  4. Verwendung von Bildanalysesoftware messen die durchschnittliche GCaMP Fluoreszenz in Zehn-Äquivalent Regionen von Interesse (ROI), von denen fünf auf der epidermalen Zellcytosol und fünf im Hintergrund zentriert.
  5. Erhalten Fluoreszenzbasis (F 0) durch Mitteln Fluoreszenz in 5 ROIs in der Epidermis dann Subtrahieren der Durchschnitt von 5 ROIs im Hintergrund vor Verletzung. Drücken die Fluoreszenzänderung & Dgr; F als Verhältnis der Änderung gegenüber der Basislinie [(F t F 0) / F 0].

4. Visualisierung von F-Actin Dynamics Nach Verwundung

  1. HINWEIS: Als Reaktion auf die Nadel Verwundung, beobachten eine Aktin-Ring an der Wundstelle, die nach und schließt sich um die Wunde. Diese Protokollabschnitt Assays Wundverschluss durch Messung der Aktin-Ringdurchmesser.
  2. Gene transgenen Würmer, die eine F-Aktin-Marker Eil wie Drosophila Moesin Aktin-Bindedomäne fusioniertGFP, exprimiert unter der Kontrolle eines Epidermis-spezifischen Promotor, wie col-19 (2A) (Transgen juIs352).
    HINWEIS: Wir haben ähnliche Ergebnisse mit anderen Aktin-Bindedomäne Marker wie LifeAct oder F-tractin (unveröffentlichte Ergebnisse) erhalten.
  3. Führen Nadel Verwundung auf P col-19-GFP-Moesin transgenen Würmer. Nach Nadel Verwundung, beobachten einen Ring von GFP-Moesin um die Wunde von ca. 5 min. Die Aktin-Ring kleiner im Durchmesser und schließlich schließt 2-3 Stunden nach der Verwundung in Wildtyp-Tiere (Abbildung 2A).
  4. Bereiten Sie eine 2% Agar-Pad auf einem Glasträger und übertragen 10 Würmer auf das Pad in 2 ul 12 mM Levamisol Lösung. Bild der GFP-Moesin Ringe 1 Stunde nach der Verletzung mit herkömmlichen konfokalen Mikroskopie.
    HINWEIS: Die Verwendung der konfokalen Mikroskopie, um z-Stapel (13 x 0,5 um) von Aktin-Ringe 1 Stunde nach der Verletzung zu erwerben.
  5. Messen Sie die Aktin-Ringdurchmesser nach der Verwundung. Zur Quantifizierung epidermalen GFP-Moesin, zuerst eine maximale Intensität Projektion der Z-Stapel und ziehen 4 Linien-Scans (bei 45 ° zueinander) über die GFP-Moesin Ring. Ringdurchmesser wird als die mittlere Spitze-Spitze-Abstand der vier Zeilenabtastungen (2B) definiert ist. Für Ringe, die bereits geschlossen haben, wird der Durchmesser als 0 & mgr; m definiert.
    HINWEIS: F-Actin-Ringe sind bequem gemessen 1 h nach der Verwundung, da dies etwa auf halbem Weg durch den Wundverschluss Prozess im Wildtyp. F-Actin-Ringe können auch zu mehreren Zeitpunkten gemessen werden, um einen zeitlichen Verlauf des Wundverschlusses abzuleiten. Zeitraffer-Filme des Wundverschlusses kann mit Levamisol-immobilisiert Würmer und Spinning-Disk-konfokale Mikroskopie erworben werden.

5. Assay Induktion von Epidermal antimikrobielle Peptide

HINWEIS: Verwundung löst auch angeborenen Immunantwort in der C elegans Haut. Transkription von Genen, antimikrobielle Peptide (AMP) kodiert, indin der Epidermis uced. Die NLP-29 (Neuropeptid-like protein) AMP ist stark durch Verwundung 4 induziert. Um zu untersuchen, wie sich die Epidermis steuert AMP Expression nach Verwundung, verwenden transgenen Reporter oder Echtzeit-PCR, einzelne AMP Transkriptniveaus erkennen.

  1. Transgene Reporter-Assay für die angeborene Immunantwort zu verwunden 4.
  2. Führen Nadel Verwundung (wie in Protokoll 1) an erwachsenen Tieren die transgenen Reporter frIs7, die P nlp-29- GFP und P col-12-DsRed als interne Kontrolle enthält auszudrücken. Beachten unverwundete erwachsenen Tieren so dunkel rot oder orange in einer GFP-Langpassfilter.
    HINWEIS: Verwundung Wildtyp-Würmer P nlp-29 -GFP Expression zu induzieren, jedoch nicht auf P col-12 -dsRed, was zu Würmern, orange, gelb, grün oder unter GFP langen Pass Beleuchtung angezeigt. Der Verlust der Funktion von Genen in der p38 MAPK-Weg, wie Tempel-1 oder NSY-1 blockieren nlp-29 -GFPInduktion nach Verwundung 4. P nlp-29- GFP wird in großen Mengen in Larvenstadien exprimiert
  3. Führen AMP Induktionsassays in reife junge Tiere. Stellen Sie sicher, dass unverletzten Kontrolltiere haben geringe Mengen an GFP.
    HINWEIS: P nlp-29- GFP-Expression wird auch durch osmotischen Stress 8 induziert, wobei jedoch auch andere Umwelteinflüsse sein.
  4. 6 Stunden nach der Verwundung, punkten die Anzahl der Würmer, die P-29 nlp -GFP Induktion (Abbildung 3) 9 mit einem Fluoreszenz Binokular mit GFP Langpassfilter haben.
    HINWEIS: Bei 1 Stunde nach der Verwundung P nlp-29- GFP sichtbar induziert und erreichte einen Höchststand von 6 Stunden nach der Verwundung und dann bleibt bis zu 24 Stunden nach der Verletzung erhöht. Quantifizieren Ausdruck durch visuelle Scoring 4,9. Alternativ zu quantifizieren Expressionsniveaus mit Hilfe eines Fluoreszenz-aktivierten Wurm Sortierer 4. Für die Schneckensortierer, müssen mindestens 50 Tieren, die verletzt werden.
  5. Echtzeit-PCR-Assay für quantitating Transkriptniveaus der einzelnen AMP-Gene. Assay Transkriptionsniveaus für mehrere Gene: NLP-29, NLP-30, CNC-1 und CNC-5.
  6. Führen Nadel Verwundung auf Wildtyp oder mutierten Würmer (siehe Protokoll 1)
  7. Sammeln Sie 50 verwundet Würmer und 50 unverwundete Würmer zu den gewünschten Zeiten (zB 3, 6, 24 Stunden) nach der Verwundung.
  8. Extrahieren RNA unter Verwendung eines kommerziellen Kits nach den Anweisungen des Herstellers.
  9. Führen Sie die reverse Transkription zu insgesamt 20 ul cDNA erhalten unter Verwendung eines kommerziellen Reverse-Transkriptase-Kit.
  10. Für die RT-PCR, verwendet 0,2 ul cDNA (1/40) von jeder Probe in Kombination mit einem grünen supermix mit Fluorescein und 0,2 uM Primer. Um RNA-Qualität zu vergleichen, verwenden ama-1 oder snb-1-RT-PCR als Referenz; Vergleichen Sie die relativen Expressionslevel AMP durch die Normalisierung der internen Kontrolle (ama-1 oder snb-1), oder vergleichen fache Induktion nach der Verwundung (AMP Induktion in verwundeten Würmern / unverwundete Würmer) von Normalizing die interne Kontrolle.
    HINWEIS: CNC-1 und CNC-5 sind caenacin Familie antimikrobielle Peptide, deren Transkription durch Verwundung 10 aktiviert. Typischerweise Nadel Verwundung induziert Ausdruck (~ 500fach für CNC-1) über einen Zeitverlauf von 4 h 10. Primer, die in veröffentlichten Arbeiten sind in Tabelle 2 aufgeführt.

6. Assay Überleben nach der Verwundung

  1. HINWEIS: Anschweissen aktiviert mindestens zwei unabhängige Signalwege in der Epidermis: die Ca 2+ abhängige Wundreparaturwegs und der angeborenen Immunantwort Wegs. Beide Wege sind für die vollständige Überlebens steriler Verwundung erforderlich. Um zu testen, ob eine Mutante oder RNAi-Behandlung wirkt Wundheilung, messen Überleben nach 24-48 Stunden nach der Verwundung. Optional können Sie mit herkömmlichen Lebensdauer-Tests, um die Wirkung der Verwundung auf Langlebigkeit 4,9 zu bestimmen.
  2. Führen Nadel Verwundung auf junge Erwachsene (L4 + 24 h) Schnecken (50 Würmer, wiederholen several mal) folgende Protokoll 1 oben. Pflegen Sie eine entsprechende Anzahl von unverletzten Würmer als Kontrollen.
  3. Überprüfen Überleben alle 24 h (Transfer verwundet Würmer auf eine neue Agarplatte alle 24 h). Beachten ~ 50% Überlebensrate 24 Stunden nach der Verletzung in Mutanten, die an der Wundheilung defekt sind, wie gtl-2 oder tir-1, bei Normierung auf unverletzten Kontrolltieren. Der Tod wird als ein Mangel der lokomotorischen Reaktion auf durch Schnecken Pick berühren definiert.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Laser oder Nadel Verwundung wird eine schnelle und anhaltende Erhöhung der epidermalen Ca Ebenen auslösen wie bei Ca Sensoren wie GCaMPs (Abbildung 1) visualisiert. Das Ca Höhen tritt innerhalb von Sekunden und erhöht bleibt für zehn Minuten. Nadel Verwundung reproduzierbar resultiert in der Bildung von F-Actin-Ringe an Wundstellen (Figur 2); erscheinen diese innerhalb von Minuten, und nach und nach in der Nähe über 1-2 Stunden nach der Verwundung. Aktin-Ringe weniger oft nach genauer Laser Verwundung gebildet. Sowohl Nadel und Laser Verwundung induziert Expression des epidermalen antimikrobiellen Peptiden (AMPs), wie NLP-29, mit transkriptionalen Reporter (Figur 3) erkannt wird. AMP Induktion zeigt sich innerhalb von 2-4 Stunden nach der Verletzung und dauert etwa 24 Stunden. Needle Verwundung des Wildtyps nicht signifikant beeinflussen Lebensfähigkeit (bei 24 Stunden nach der Verletzung gemessen) oder Lebensdauer.

Figur 1
Abbildung 1. Laser Verwundung löst eine Ca 2+ Antwort in der C elegans Epidermis. (A) Epidermal GCaMP3 Fluoreszenz (P col-19 -GCaMP3 (juIs319)) Stufen nach Femtosekundenlaser Verwundung. Seitenansicht der Epidermis in anterior-Körper; x, Laser-Wunde; N, epidermalen Zellkern. Spinning-Disk-konfokale Bilder, Intensität Code. UW: unwounded, B:. Verwundet (B) Quantifizierung von GCaMP3 Dgr; F / F 0 bei 20, 40, und 60 & mgr; m von der Wundstelle; Vertreter Spur. Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.

Abbildung 2
Abbildung 2. Nadel Verwundung löst Aktin-Polymerisation um Wundstelle. (A) col-19-GFP-Moesin (juIs352) sichtbar gemacht. Maßstab: 10 um. UW: unverwundete, B:.. Verwundet (B) Quantifizierung von Aktin Ringdurchmesser von Linien-Scans, 4 Linien-Scans pro Tier (gestrichelte rote Linien in Platte (A), WT) Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.

Figur 3
Abbildung 3. Epidermal Verwundung aktiviert angeborenen Immunantwort. Vertreter Bilder (WT unverletzt, verletzt WT + 3 h) P nlp-29 -GFP (frIs7) Induktion nach Verwundung Nadel. Maßstab:. 200 & mgr; Bitte klicken Sie hier, um einen BlickGrößere Version der Abbildung.

Reporter Transgene Fluoreszenz Allel
Kalzium Pcol-19-GCaMP3; Pcol-19-tdTomato GFP / tdTomato juIs319 X
Actin Pcol-19-GFP :: Moesin GFP juIs352 I
NLP-29 Pnlp-29-GFP / Pcol-12-DsRed GFP / DsRed frIs7 IV

Tabelle 1. Transgene in Wundantwort Assays verwendet. In dieser Tabelle sind chromosomal integrierte Transgene am Caenorhabditis Genetics Center (http://www.cbs.umn.edu/research/resources/cgc) zur Verfügung.

Genname Reihenfolge
NLP-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
NLP-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
CNC-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
CNC-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ama-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
snb-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Tabelle 2 Primer für die RT-PCR von AMP-Transkripte verwendet wird. Arbeitskonzentration liegt bei 0,2 uM. Snb-1 dient als interne Kontrolle.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Die Nadel und Laser Verwundung hier dargestellten Verfahren stellen komplementäre Ansätze, um die Fähigkeit des Epidermisepithel um Schäden zu reparieren. Laser Verwundung relativ lokalisierte und (je nach Laserkonfiguration) kann auf die Epidermis beschränkt werden, wobei nadel Verwundung stört die Epidermis, Kutikula und wahrscheinlich interne Basalmembranen. Needle Verwundung kann genauer ähneln Wunden, die durch Krankheitserreger oder mechanische Schäden in der natürlichen Umwelt zugefügt hat. In der Regel erfordert Nadel Verwundung mehr Praxis präzise Wunden, die mit das Überleben der Tiere sind kompatibel zu erzielen. Die zellulären Reaktionen auf Nadel und Laser Verwundung Display viele Ähnlichkeiten. Allerdings sei darauf hingewiesen, dass die Bildung von Aktin-Ringe ist nicht reproduzierbar nach der Femtosekundenlaser Verwundung beobachtet werden.

Eine Einschränkung der Nadeleinstich ist, dass es nicht eine präzise gewickelten: die Nadel beschädigt auch innere Gewebe, deren Beiträge zur SchneckenÜberleben wurden nicht untersucht. Eine mögliche Änderung dieses Protokolls wäre, Mikrofluidik-basierten Mikroinjektionssystem 11 und fluoreszierende Reporter zu kombinieren, um eine genauere körperliche Verwundung durchzuführen.

Die Nadel und Laser Verwundung Methoden detailliert hier sind einfach, aber ziemlich arbeitsintensiv und besten mittleren Durchsatz, so dass es eine Herausforderung, um genomische oder biochemische Ansätze zur Charakterisierung der Wundreaktion zu verwenden. Cuticle Eindringen von Krankheitserregern wie Pilzen oder Protozoen 12,13 auf größere Populationen von Tieren geliefert werden und können Reaktionen, die mit der Reaktion auf Verwundung überlappen auslösen, noch zusätzliche Komplexität von erregerspezifischen Reaktionen einzuführen. Weitere Arbeiten sind erforderlich, um zu erforschen, ob andere abiotische Methoden wie ballistische Bombardierung 14 oder Arrays von mikromechanischen Stechstrukturen 15 können für große Verwundung angepaßt werden kann.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics