Produktion og Målretning af Monovalent Quantum Dots

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

Dynamikken af ​​enkelte molekyler på levende celler bidrager til deres biologiske funktion. Enkelt molekyle fluorescensimagografi er en populær metode til at studere enkelt molekyle dynamik på celleoverfladen 1,2,3. Men det mest almindeligt anvendte billeddiagnostiske prober i disse undersøgelser har flere vigtige ulemper. For eksempel, konventionelle organiske farvestoffer og fluorescerende proteiner giver moderat lysstyrke, omkring 10 5 -10 6 M-1cm-1, men er fotokemisk ustabile, blegning efter udledningen af omkring 10 5 -10 6 fotoner under typiske live-cell imaging betingelser 4,5. I modsætning hertil halvleder nanopartikler, ofte kaldet kvantepunkter (QDs), er betydeligt lysere og mere stabil, med ekstinktionskoefficienter i størrelsesordenen 10 6 -10 7 M -1 cm -1 og over 10 7 -10 8 udsendte fotoner før photobleaching 5. Den forbedrede lysstyrke og fotostabilitet af QDs end organiske fluoroforer muliggør observation af enkelte molekyler til væsentligt hurtigere frame rates og over meget længere baner 6.

På trods af deres fordele og kommercielle tilgængelighed, forbliver flere forpligtelser for disse magtfulde billeddannende midler. For det første har de dårligt defineret målretning valens, som kan resultere i tværbinding af målrettede biomolekyler 6. For det andet, de generelt har en stor hydrodynamisk størrelse (> 20 nm), der begrænser adgangen til visse overfyldte cellulære miljøer 7. For det tredje har de begrænset målretning modulopbygning 7. Adskillige strategier har forsøgt at løse disse problemer 8,9,10, men generelt kræver specialiseret viden og reagenser til at gennemføre.

For at løse disse problemer, vi for nylig rapporteret om en "Sterisk Udelukkelse" strategien for forberedelsen af ​​monovalente, små, ogmodulære QDs 11. De QDs er omviklet med en enkelt lang phosphorthioat- DNA (ptDNA) polymer. Den ptDNA binder sig til QD overfladen gennem flere Zn-S-interaktioner mellem overfladeeksponerede Zn atomer og de phosphorthioatgrupper af ptDNA polymer. En enkelt bundet polymer sterisk og elektrostatisk udelukker binding af yderligere ækvivalenter af polymeren uden væsentlig forøgelse af partiklens samlede størrelse (ca. 2 nm). Alle reagenser er kommercielt tilgængelige produkter, der dannes i højt udbytte, og processen kræver kun afsaltningen afdrypper trin til oprensning. Når mærket, QDs omviklet med et enkelt ptDNA (mQDs) binder til komplementære DNA-strenge, der bærer målretning domæner (f.eks benzylguanine (BG), benzylcytosine eller -alkylhalogenider).

Disse funktionaliteter målrette mQDs specifikt enzymatiske mærker, såsom SNAP CLIP & HALO, som er genetisk fusioneret til proteinet af interesse. Dette er en protokol til syntese, Målretning og live-cell imaging af mQDs produceret af sterisk udelukkelse.

Protocol

1. Produktion af Monovalent Quantum Dots

  1. Fase overførsel af QDs fra organisk og vandig fase
    1. Fortyndes 200 pi af en 1 uM opløsning af organiske fase QDs med 400 pi af chloroform i et 5 ml hætteglas.
    2. Bland 400 pi af en 0,3 M tetrabutylammoniumbromid (TBAB) chloroformopløsning med 36 ul pæn afmPEG thiol (CH 3 O (CH2CH 2 O) 6 C 2 H 5 SH) og ryst O / N.
    3. Tilføj 800 pi af en 0,2 M NaOH vandig opløsning, og ryst i 30 sek. Et fase overførslen sker inden for et par minutter, som angives med overførslen af ​​de farvede partikler til den vandige fase over det tættere organiske fase.
    4. Hvis partiklerne aggregerer i en tredje fase mellem den vandige og den organiske fase, øge inkubationstiden med MPEG thiol. Hvis den vandige fase forbliver klar, QDs ikke faseoverføring (se figur 3A). Alternativt øge concentration af mPEG thiol i trin 2 for at afhjælpe dårlig fase overførsel.
    5. Den (farvede) vandig fase Recover og derefter koncentrere de indsamlede QDs med en Centricon spinkolonne (30 kDa molekylvægt cut-off) til 1 ml.
    6. Tilsæt koncentreret QD opløsningen i en Sephadex NAP10 søjle præ-ækvilibreret med 10 mM Tris-buffer indeholdende 30 mM NaCI (pH 8,0). Eluere QDs med 1,5 ml elueringsbuffer ved tyngdestrømning.
    7. Måle koncentrationen af ​​QDs absorptionen spektroskopi ved 350 nm.
  2. Fremstilling af mQDs
    1. Køb (eller syntetisere) ptDNA. Denne protokol anvender sekvensen 5'-A-S 50 (CT) 10 (ACTG) 5 -3 "(se tabel 1).
DNA Sekvens
5'-A S 50 (CT) 10 (ACTG) 5 A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH2 - (CT) 10 (CAGT) 5 -3 ' NH2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-DNA BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

Tabel 1. DNA-sekvenser anvendes til at producere og målrette mQDs.

  1. Forbered 1 ml 100 nM QD opløsning i 10 mM Tris-buffer indeholdende 30 mM NaCI (pH 8).
  2. Tilføj dråbevis 500 pi af 100 nM ptDNA løsning på de vandige QDs i 1 minut under kraftig omrøring. Rør eller lægge på et rysteapparat i yderligere 9 timer.
    Bemærk: Dette burde i teorien producere en 1: 2 forholdet ptDNA: QD. Men det faktiske støkiometri er aldrig perfekt - som regel resultatet er tættere på 1: 1,5. For at fremstille en 1: 1-forhold mellem ptDNA: QD er nødvendig densitometri efter gelelektroforese præcist at kvantificere forholdet konjugation givet de kendte anvendte mængder ovenfor.
  3. Fjern ~ 10 ul af QD blandingen til at køre på en analytisk agarosegel. Også fjerne en lignende koncentration af ukonjugerede QDs i vandig fase (fra trin 1.2.1).
    1. Tilføj ~ 2 μ; L 6x Ficoll loading buffer (for at øge opløsningen tæthed) og køre disse to prøver sammen på en 0,8% vægt / vol agarosegel i natriumboratpuffer i 15 minutter ved 150 V. Et enkelt bånd i det ukonjugerede kontrol bane migrerer tæt på brønden, og to bands i vognbane med konjugerede QDs ses (se geler i figur 2B).
  4. Beregn ukonjugeret QD fraktion ved hjælp af den relative intensitet af de to bånd (se ligningen i figur 2B). Så brug denne fraktion til at beregne den yderligere mængde på 100 nM ptDNA løsning nødvendig for at matche antallet af QDs.
  5. Gentag trin 1.2.3 til 1.2.5 endnu en gang med denne beregnede volumen eller indtil konjugerede QDs kollaps i et enkelt bånd på gelen tyder på fuldstændig konjugation af alle QDs.
  6. Tilsæt 100 pi af 10 mM (CO2H) CH2 O (CH2 CH2 O) 6 C 11 H 23 SH (carboxy PEG6 alkan thiol) i 10 mM Tris-puffer containing 30 mM NaCl (pH 8) til de konjugerede mQDs produceret ovenfor, og ryst i 10 min.
    Bemærk: Disse PEG ligander passivere QD overflade. En længere PEG vil bedre passivere QDs, dog vil det også øge deres størrelse. Den hydrofobe alkan Thiolfunktionaliteten har en meget højere affinitet for QDs, samlet, end den mindre hydrofobe PEG-thiol brugt til fase overførsel. Derfor skal du ikke lade dette trin for at fortsætte for lang eller ptDNA vil blive erstattet af den alkan-PEG-thiol. Efter en ~ 30 minutters inkubation, vil en betydelig del af DNA er blevet fordrevet fra QDs (figur 3B).
  7. For at fjerne overskydende alkan PEG-thiol, tilsættes 0,5 ml af QD opløsningen til en Sephadex NAP5 søjle præ-ækvilibreret med elueringsbuffer (10 mM Tris-buffer indeholdende 30 mM NaCI). Saml mQDs med 1,0 ml elueringsbuffer ved tyngdestrømning.
  8. Koncentrer de indsamlede QDs med en Centricon spinkolonne (30 kDa). Opbevar disse mQDs ved 4 ° C i flere måneder. Må ikke frEeze dem.
    Bemærk: Hvis en farvet pellet i bunden af ​​røret ses, har prikkerne aggregeres og sandsynligvis ikke længere anvendelig.

2. Produktion af Målretning (Benzylguanine-) DNA

  1. Producere eller købe aminendestillet DNA. Denne protokol anvender sekvensen 5'-NH2 - (CT) 10 - (CAGT) 5 -3 "(se tabel 1). Poly-CT linker øger tilgængeligheden til funktionalitet begravet dybt i glycocalyx men kan ikke bruges til alle applikationer. Hvis der er adgang til en DNA-synthesizer, producerer amino-modificeret DNA ved hjælp af en passende 5 'amino-modifier (5' amino-modificerende C6).
  2. Opløs BG-N-hydroxysuccinimid (BG-NHS) i tørt dimethylsulfoxid (DMSO) ved en koncentration på 10 mg / ml.
    Bemærk: BG-NHS vil absorbere vand fra luften og føre til hydrolyse af den reaktive NHS-ester, især i hygroskopiske opløsningsmidler som DMSO og dimethylformamid (DMF). BG-NHS er bedst butikd ved -80 ° C som et pulver i sin egen hætteglas i en sekundær beholder, der indeholder tørremiddel. Varme op til rt før åbning af hætteglasset. Alternativt straks afmåling til engangsbrug BG-NHS-ester i et tørt polært opløsningsmiddel og fryse ved -80 ° C, eller reagere fuldstændigt med aminen DNA i trin 2.2.
  3. React ved blanding af BG-NHS i DMSO fra trin 2.1 med amin-terminerede DNA i HEPES (4 (2-hydroxyethyl) -1-piperazinethansulfonsyre) pufret (pH 8,5) vand. I en typisk reaktion 20 ul 10 mg / ml BG-NHS i DMSO med 2 pi 2 mM NH2 - (CT) 10 - (CAGT) 5 i 58 ul deioniseret vand bufret med 20 gl 0,5 M HEPES, pH 8,5. Foretag reaktioner i et 1,5 ml mikrocentrifugerør. Bland hurtigt som reaktionen forløber hurtigt og må konkurrere med NHS-esterhydrolyse.
  4. Sonikeres i 5-10 minutter for at sikre grundig blanding. Inkuber ~ 1 time ved stuetemperatur. Det støkiometriske forhold BG: DNA kan ændres for at drive reaktionen til færdiggørelse.
  5. Renses BG-DNA fra den uomsatte amin-DNA ved revers-fase HPLC kører en 100 mM TEAA: acetonitril (ACN) gradient mellem 8% og 95% acetonitril i løbet af 30 minutter. Det uomsatte amin-DNA vil eluere før BG-DNA. Saml BG-DNA-fraktionen i et konisk rør.
    1. Brug en C18 Zorbax kolonnen for standard oligonukleotid oprensning og følgende gradient:
      0 → 15 min: 8 → 30% ACN;
      15 → 21 min: 30-90% ACN;
      21 → 25 min: 90 → 8% ACN;
      25 → 30 min: 8% ACN;
  6. Frys i flydende nitrogen og lyofilisere opsamlede fraktion. Resuspender DNA i deioniseret vand. For at være ekstra forsigtig, lyofilisere to gange mere for at fjerne resterende TEAA. Resterende TEAA kan være toksisk for celler i højere koncentrationer.
  7. Resuspender frysetørret BG-DNA i vand, og sørg for at vaske siderne af the rør og fortyndes til ~ 25 uM lager. Alikvot og opbevares ved 4 ° C. Prøverne blev opbevaret i ~ 9 måneder uden mærkbar forringelse.

3. Mærkning levende celler med Monovalent Quantum Dots

  1. Eventuelt passivere de mQDs lige før et billeddannende forsøg under anvendelse af reagenser, såsom kasein (0,5%) eller bovint serumalbumin (BSA, 1-3%).
  2. Plate celler, der udtrykker en SNAP-mærkede protein på total intern refleksion fluorescens (TIRF) -kvaliteten glas. I dette eksperiment, bruger vi en U2OS cellelinie, der udtrykker en SNAP-tagget Notch1 receptoren og høj kvalitet glasoverflader.
  3. Efter cellerne er bundet til glas (~ 24 timer), fjernes vækstmedier, vaskes med PBS og inkuberes cellerne i 10-30 minutter ved stuetemperatur i ~ 100-150 pi PBS eller celle medier indeholdende ~ 1 uM BG- DNA fra trin 2.6 ovenfor.
  4. Efter inkubation med BG, omhyggeligt vaske cellerne med PBS eller cellemedier. Inkubér cellerne i ~ 5-10 min med the mQDs fremstillet i trin 1.2.9 (og eventuelt passiveres i trin 3.1).
  5. Eventuelt vaskes ubundne mQDs og returnere cellerne til en puffer / medier velegnet til både billedbehandling og kultur. For celler, der skulle afbildes i TIRF tilstand en slutvasketrin ofte unødvendig, da ubundne mQDs i opløsning diffunderer så hurtigt sammenlignet med bundne mQDs som at være upåviselig under analyse.

4. Mikroskopi & Analyse

  1. Billede cellerne ved hjælp af en TIRF mikroskop.
    Bemærk: Anvendelsesområdet skal have adskillelige excitation og emission filtre, eller en brugerdefineret QD-filter terning. QDs er bedst spændt med en lav bølgelængde laser (405 eller 488 nm). QDs af forskellig diameter har karakteristiske emissionsbølgelængder, typisk forbundet med et stort Stokes skift.
  2. På grund af lysstyrke mQDs, indsamle billeder ved høje frame rates i TIRF mens billeddannelse basal side af en levende celle.
    Bemærk: Alternativt kan enkelt-molekyle dynamik være følgenons på andre brændpunktsflader ved hjælp af en roterende skive konfokalt mikroskop. Automatiseret enkelt partikel tracking software er generelt vellykket på præcis sporing de lyse og fotostabile mQDs.

Representative Results

Overførslen fase af QDs fra en organisk til en vandig fase er afgørende for fremstilling af mQDs, men kan være både konditionering og QD-specifik. Fase overførsel i afsnit 1.1 skal fremstå som rene som de første to hætteglas i figur 3. Hvis overførslen vises mere som hætteglas 3, så skal man prøve igen med forskellige betingelser.

Når QDs er belagt med negativt ladet DNA bør migrere på en gel adskilt fra de ikke-indpakket QDs. Ved anvendelse af en portion af uindpakkede QDs som en kontrol, en anden skal hurtigere migrerende bånd vises ved tilsætning af ptDNA, som det ses i den første gel i figur 2B. Komplet dannelse af mQDs påvises med tabet af immobile bånd og kollapset i den mobile bånd, som ses i den sidste gel i figur 2B. Hvis en portion af dit MQD produkt migrerer som et enkelt bånd kan adskilles fra de uindpakkede QDs, så dine mQDs er monovalente og r eady der skal anvendes i yderligere trin.

Cellemærkning bør være specifikke for målet for dit valg og bør være afhængig af protein ekspressionsniveauer og MQD koncentration. Empirisk optimering af både MQD koncentration og MQD passivering er ofte nødvendigt for en given applikation. Figur 4B viser mærkningen af U2OS celler, der udtrykker en SNAP-mærket Notch receptoren med mQDs spænder i koncentration fra 0,5 nM til 10 nM.

Figur 1
Figur 1. Modulær målretning af mQDs. MQDs hybridiserer til ssDNA funktionaliseres ved forskellige målsøgningsmolekyler. Benzylguanine-bundet DNA-mål mQDs at snap-mærkede fusionsproteiner. Andre 5 'modifikationer og DNA-sekvenser gør det muligt at målrette mQDs til en række andre biomolekyler./files/ftp_upload/52198/52198fig1highres.jpg "target =" _blank "> Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Ordning for produktion af mQDs. (A) økologisk-fase QDs overføres til den vandige fase ved behandling med MPEG thiol- og TBAB, omviklet med ptDNA, og passiveret med carboxy PEG6 alkan thiol. Repræsentant TEM billeder er økologiske QD545, QD585 og QD605 hhv. (B) en metode til empirisk bestemmelse af støkiometri samspillet mellem QDs og ptDNA i trin to ovenfor. QD & ptDNA støkiometrier empirisk bekræftet ved densitometri sådan, at den endelige reaktion støkiometrien er 1: 1 (QD: ptDNA). Det oprindelige antal mol ptDNA multipliceres med forholdet QD: MQD, og ​​justeret med den faktiske mængde AF ter konjugation at give antallet af mol kræves for at opnå 1:. 1 konjugation Klik her for at se en større version af dette tal.

Figur 3
Figur 3. Eksperimentelle oplysninger om produktion af mQDs. (A) Repræsentative billeder af vellykkede og mislykkedes fase overførsel. QDs bør visuelt overføres mellem tætte organiske fase, og de mindre tætte vandige fase. Ufuldstændig faseseparation indikerer dårlig overførsel. (B) ptDNA kan erstattes af alkan-PEG-thiol. Højre gel-data er repræsentativ for en reaktion, hvor en betydelig del af ptDNA er blevet fordrevet fra QDs på grund af over-passivering.es.jpg "target =" _blank "> Klik her for at se en større version af dette tal.

Figur 4
Figur 4. Mærkning SNAP-taggede proteiner på levende celler. (A) Skematisk demonstrere udtryk, udlæg og mærkning af en SNAP-mærket receptor med en BG-målrettet MQD. (B) Repræsentant mærkning af celler, der udtrykker en SNAP-Notch-mCherry konstruere ved forskellige MQD koncentrationer. mQDs passive med PEG12 colocalize med mCherry indikerer specifik mærkning. Lavere mærkning tætheder (<0,5 nM) generelt foretrækkes enkelt partikel sporing. Målestokken er 10 um. Klik her for at se en større version af dette tal.

Discussion

Modularitet MQD design giver en øget grad af eksperimentel fleksibilitet. For eksempel kan en række mQDs hurtigt fremstilles i unikke farver giver mulighed for den samtidige afbildning af flere mål. Den målrettende sekvens ssDNA kan dirigere mQDs til proteiner, sukkerarter 12, lipider og overflader 13. En række enzymatiske tags er tilgængelige med ortogonale reaktiviteter, så flere mål, der skal afbildes samtidigt med differentielt målrettede mQDs. Ud over at koncentrere med SNAP-tag, var mærkning af target-proteiner med mQDs med clipsen tag, HALO tag, og biotinylerede proteiner også en succes. Denne protokol viser specifik mærkning af en overflade receptor på levende celler med disse mQDs, men protokollen kunne let tilpasses til en række forskellige sammenhænge.

Den betydelige metodisk indsigt i at producere mQDs med definerede valens er, at ~ 50 phosphorthioat-linkedbaser er forpligtet til at ombryde QDs (og dermed forhindre to molekyler binde samtidigt). En poly-A-S 50-sekvens reproducerbart og stabilt bundet 605 nm QDs fra Life Technologies. Selvom dette produkt er udgået, den steriske udelukkelse strategi er generaliseres til lignende produkter fra andre leverandører, der har forskellige størrelser, former, spektrale egenskaber.

Den effektivitet og stabilitet i ptDNA-indpakkede QDs afhænger kritisk på overfladen kemi og strukturen af ​​QDs. Derfor vil succesen af ​​en protokol afhænger af kommerciel kilde og kemiske struktur af QDs. Ved anvendelsen af ​​denne protokol, findes der tre vigtige punkter forskel mellem forskellige kommercielle kilder QDs: en forskel i forhold, der er nødvendige for fase overførsel; en forskel i styrken af ​​oprindelige PEG-thiol-ligand-binding, eventuelt hindrer forskydning af ptDNA; og en forskel i mængden af ​​udsatte CdSe kerne, som kan leannonce til slukning af QD af MPEG-thiol faseoverførselsbetingelser.

Som for offentliggørelse, QDs med den bedste struktur for produktion af mQDs er 4-10 nm CdSe / ZnS kerne / skal QDs købt hos Life Technologies med emissionsspektre på 545, 585, 605 & 625 nm (figur 2A). QDs baseret på den "Levende" formulering (545, 605, etc.) af dæmpning ved tilsætning af mPEG thiol og er ikke egnede til denne anvendelse. QDs fra Aldrich og Ocean Nanotech fungerer godt, men kræver længere faseoverførselsbetingelser trin og forbehandling med trioctylphosphinoxid. Denne protokol er blevet optimeret til QDs fra Life Technologies.

Poly-A-phosphorthioat-sekvens anvendes til at indpakke QDs afsluttes med en nativ 20-mer DNA-hale indeholdende sekvensen (ACTG) 5 som en målsøgende streng kan hybridisere. Denne sekvens er praktisk, da det har lidt at ingen sekundær struktur, og vil forblive hybridized ved 37 ° C i PBS. Hvis der er adgang til en DNA-synthesizer, kan ptDNA af syntetiseret og derefter oprenset ved omvendt fase højtydende væskekromatografi (HPLC) under anvendelse af en C-8-søjle. Den ptDNA vil elueres senere på HPLC end tilsvarende oligonukleotider med en indfødt rygrad. Vi typisk forlader 5'DMT beskyttende gruppe på vores phosphorthioatoligonukleotider efter rensning.

Passivering af ptDNA-indpakkede QDs normalt kræves for at forbedre kolloid stabilitet QDs og reducere baggrunden bindende for de fleste eksperimentelle applikationer. Protokollen anvender en PEG-lag til at passivere de QDs. Carboxy PEG alkan thiol med ekstra PEG-enhed ((CO2H) CH2 O (CH2 CH2 O) 12 C 11 H 23 SH, carboxy-PEG12 alkan thiol) giver betydeligt reduceret baggrund, selvom længere PEG'er er både større, og generelt dyrere. mQDs overtrukket med carboxy PEG alkane thiol ligander er meget stabile i fysiologiske puffere, såsom phosphatpufrede saltopløsninger og dyrkningsmedier. Langtidsopbevaring (> 8 måneder) af mQDs ved 4 ° C viste ingen signifikant aggregering eller ptDNA detachement 11. Afhængigt af forsøget, PEG passivering af QDs alene ikke altid tilstrækkelig reducere ikke-specifik binding af mQDs. Inkubering begge celler og mQDs i phosphatpufret saltvand (PBS) indeholdende 3% BSA i 20 minutter før brug i det væsentlige reducerer ikke-specifik binding til celler, men det gør øge den tilsyneladende hydrodynamiske radius mQDs med ~ 50%. Passivering med 0,5% casein reducerer ikke-specifik binding yderligere, men det øger tilsyneladende størrelse i et større omfang end BSA.

5'-enden af ​​en DNA-streng komplementær til mQDs kan modificeres for at muliggøre målretning af en række forskellige biomolekyler. Der er en række kendte teknikker til rådighed for kovalent modificere proteiner, lipids & sukker med enkeltstrenget DNA (ssDNA). Så længe ssDNA'et præsenteres ekstracellulært, er den tilgængelig for opløselige mQDs. mQDs med ovennævnte sekvenser vil hurtigt hybridisere med deres komplementære DNA-streng under celledyrkningsbetingelser. Der kan kræves en 10-20x poly (CT) spacer mellem ptDNA og den målsøgende sekvens for effektiv målretning, således at hæve bindende sekvens over den tykke og negativt ladede glycocalyx af cellen. Til denne protokol valgte vi at producere en BG-DNA med en komplementær sekvens af (CAGT) 5, som både vil hybridiseret til mQDs og kovalent knytte sig til en SNAP-tag protein til hurtig og specifik mærkning. En lignende protokol fungerer godt til at koble andre NHS-estere til amino-modificerede oligonukleotider.

For enkelt-molekyle billeddannelse, er en lav tæthed for mærkning typisk kræves for at løse de enkelte molekyler. En endelig MQD koncentration på ~ 0,5 nM i PBS med passiverende middeler et godt mål. Men disse høje fortyndinger resulterede somme tider i under-mærkning af cellerne. Hvis dette sker, kan yderligere MQD tilføjes indtil en optimal tæthed af mærkning overholdes. I tilfælde af SNAP-mærkede humane Notch1 koncentrationer> 10 nM MQD fremstillet tætte mærkning celler, mens 0,5 nM MQD resulterede i fastgørelse af ~ 20 mQDs på den basale overflade af målcellen (se figur 4B). Cellemærkning med mQDs var stærkt afhængig af konfluens af udpladede celler. Overdrevent konfluente celler ikke mærke på deres basale overflader.

Sammenfattende en simpel metode generere monovalente og modulære QDs blev beskrevet. Disse mQDs finde nytte i bred vifte af levende celle billedbehandlingsprogrammer, som påvist af imaging Notch receptoren på levende U2OS celler. Anvendeligheden af ​​mQDs er ikke begrænset til dette specifikke tilfælde, men kan potentielt udvides til andre cellulære mål, såsom andre proteiner, nukleinsyrer og enzymer.

Acknowledgements

Finansiering fra DOD W81XWH-1023/10/01 (ZJG), tilskud P50 GM081879 fra UCSF Center for Systemer og syntetisk biologi (ZJG), NIH 5R21EB015088-02 (YJ) og NIH 1R21EB018044 (ZJG & YJ). DS blev støttet af Human Frontier Science Program tværfaglig postdoc forskning fællesskab.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats