amplification isotherme (LAMP) Essais de boucle médiation pour la détection des espèces spécifiques de

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

La production de poulet mondial a été multiplié par dix au cours des dernières 50 années avec le monde en développement qui accueillent près de quatre fois l'expansion assisté dans le monde développé (www.faostat.org) . Comme la pertinence de la production de poulet à la sécurité alimentaire mondiale a augmenté de façon trop a le profil d'agents pathogènes qui peuvent causer une maladie grave chez les poulets. Un excellent exemple est l'espèce Eimeria, protozoaires parasites omniprésents qui peuvent causer la maladie entérique une coccidiose. Partout où les poulets sont élevés une ou plusieurs espèces d'Eimeria sont susceptibles d'être commune 2-4. Dans le monde développé Eimeria sont principalement contrôlée par la chimioprophylaxie, employant programmes de navette ou de rotation pour minimiser l'impact de la résistance 5. Les vaccins vivants sont également utilisés dans les systèmes où la valeur des oiseaux est suffisant pour justifier le coût (par exemple, les animaux reproducteurs, des couches et des poulets de chair 5). En resull de ces mesures coccidiose clinique est souvent bien contrôlé, bien que l'infection sous-clinique est commune 5. Dans le monde en développement de la vaccination est rare et la demande de drogues souvent moins bien informé. En conséquence coccidiose sous-clinique et clinique est plus fréquente et exerce un impact économique significatif 3.

Diagnostic de l'infection eimerian a toujours compté sur lésion totalisant post-mortem, bien que même les auteurs de le système de notation plus largement utilisé remarquer que pour certaines espèces "il semble douteux qu'une telle procédure devrait être tentée dans tout mais modérément sévères infections" 6. Preuve supplémentaire peut être recueillie grâce à la détection au microscope au stade résistant à l'environnement du cycle de vie des oocystes dans des échantillons fécaux ou litière, bien que se chevauchant morphologie peut confondre tous, mais l'expert 6,7. Alternatives moléculaires utilisant la réaction en chaîne par polymérase (PCR), amplificatio aléatoiren de l'ADN polymorphe PCR (RAPD-PCR) et des technologies de PCR quantitative ont été disponibles pour un maximum de 20 années 8-10, mais à ce jour ils ne ont pas réussi à devenir populaire. Coût relatif et l'exigence de l'équipement de laboratoire spécialiste ou traitement ont limité leur adoption, en dépit de la nature souvent subjective et techniquement exigeante de la pathology- plus âgés et les approches basées sur la microscopie-10,11. Ces limitations peuvent être exagérées dans la plupart des régions les plus pauvres du monde comme l'Asie du Sud-Est, où l'impact de la coccidiose sur la pauvreté peut être proportionnellement plus 12. En réponse il ya une demande claire pour des tests de diagnostic, nouvelle Eimeria espèces spécifiques simple et sensible, mais rentable.

Boucle amplification isotherme facilitée (LAMP) est une technique facile à préparer entraînée par polymérase-ADN qui est capable d'amplifier de grandes quantités d'ADN. Plus important encore, LAMP utilise un polymera Bst ADNSE au lieu de l'ADN polymerase Taq utilisée dans la PCR, ce qui facilite l'amplification d'ADN à une température constante sans la seule exigence pour le cyclage thermique 13,14. LAMP peut se prêter à l'application même dans le laboratoire le plus rudimentaires ou dans le domaine. Caractérisée par la résistance par rapport à de nombreux inhibiteurs de la PCR, haute sensibilité et spécificité, des tests de LAMP ont été élaborés pour un large éventail d'agents pathogènes y compris le virus de la maladie de Gumboro, Clostridium perfringens et Cryptosporidium 15-17. En réponse à la demande pour de nouveaux diagnostics Eimeria rentables espèces spécifiques d'un panel de tests LAMP spécifiques à chacune des sept espèces d'Eimeria qui infectent les poulets a été développé 18. Applications pour les nouveaux tests comprennent la surveillance parasite occurrence, d'une valeur particulière donnée l'association d'espèces telles que Eimeria maxima ou Eimeria necatrix avec une mauvaise pe économiquerformance 3,4. D'autres applications comprennent l'évaluation de l'efficacité de la stratégie anticoccidienne d'une ferme, le diagnostic de l'infection sous-clinique ou clinique de la maladie et l'évaluation des risques posés par Eimeria à une ferme.

Protocol

1. Préparation modèle

NOTE: Toute matrice d'ADN génomique soupçonné de contenir de l'ADN dérivé de l'un des sept espèces d'Eimeria qui infectent les poulets peut être utilisé comme matrice à base de LAMP-identification de l'espèce Eimeria. Des échantillons de tissus intestinaux pour l'analyse de diagnostic sur le terrain doivent être recueillies pendant post-mortem de routine comme décrit ici.

  1. Choisir l'article (ou les articles) de l'intestin à tester. Voir le tableau 1 pour un guide à la sélection du site de l'échantillon et les espèces Eimeria les plus susceptibles d'être présents 18 et Figure 1 pour l'aire de répartition et l'emplacement des sites d'échantillonnage spécifiques à l'espèce.
    NOTE: Ce est d'une importance capitale depuis Eimeria sont notamment site hôte spécifique. Chaque espèce qui infecte des poulets est défini par la région intestinale qu'il cible 19. La décision peut être influencée par l'expérience précédente de la ferme, l'intérêt pour un ou more espèces Eimeria spécifiques ou d'autres indicateurs de diagnostic 6.
  2. Accise 5 cm ou plus grandes longueurs de la section intestinal (s) sélectionné pour tester Eimeria l'aide de ciseaux ou d'un scalpel stérile. Eventuellement, stocker les échantillons pour une analyse ultérieure dans un fixateur tel que par exemple dans le RNAlater 18 ou 95% d'éthanol.
    NOTE: Si le stockage dans de l'éthanol, l'échantillon doit être soigneusement lavés à l'acide tris-éthylènediaminetétraacétique stérile (TE) tampon avant de les utiliser.
  3. Couper l'échantillon ouverte longitudinalement, retirer contenus les plus intestinales (si présente) et gratter les cellules de la couche de muqueuse gratuitement en utilisant soit le bord d'une lame de microscope en verre stérile ou une lame de ciseaux éthanol / flamme stérilisé. Eventuellement pour un échantillon groupé inclure les cellules de tous les quatre des sites intestinales spécifiques à l'espèce dans un seul tube.
  4. Mettez le matériau raclé dans un tube de centrifugation de 1,5 ml vis-top stérile contenant tampon TE stérile 100 pi y compris une0% (p / v) de résine Chelex 100.
  5. Agiter chaque échantillon vigoureusement pendant 1 min. Assurez-vous que le haut de la vis est bien fermé, puis incuber dans un bain d'eau bouillante pendant 10 min.
  6. Après avoir fait bouillir permettre à chaque échantillon à refroidir à la température ambiante pendant 1 à 2 min.
  7. Centrifugeuse chaque échantillon en utilisant une microcentrifugeuse à vitesse de pointe (par exemple, ~ 10 000 xg) pendant 1 min.
  8. Recueillir 2 pi du surnageant résultant d'être modèle dans chaque test LAMP à entreprendre. Eventuellement, en commun plus d'un site intestinale dans un seul tube pour fournir un dosage multi-site.

2. Eimeria LAMP Primer Préparation (pré-test)

  1. Préparer Eimeria LAMP stocks amorces adéquates pour 100 dosages:
    1. Reconstituer chaque amorce Eimeria LAMP lyophilisée par addition d'eau moléculaire de qualité à une concentration de 100 uM (comme spécifié par le fabricant). Si non spécifié, calculer le volume d'eau nécessaire pour la biologie moléculaire using les Les poids physiques et moléculaires de chaque amorce.
    2. Pipette 60 pi d'eau de la biologie moléculaire dans un 0,5 ml flip-top microtube distinct pour chaque espèce Eimeria à doser.
    3. Ajouter amorces FIP, BIP, F3, B3, LF et LB spécifique de l'espèce Eimeria cibles à l'eau en utilisant les volumes indiqués dans le tableau 2, la création d'une série de mélanges d'amorces spécifiques sept espèces.
    4. Brièvement vortex mélanger la solution d'apprêt, puis impulsion microcentrifugeuse et congeler jusqu'à utilisation.
  2. Préparer un mélange maître de réaction de LAMP pour chaque espèce Eimeria à tester. Multipliez les volumes sont indiqués dans le tableau 3 par le nombre d'échantillons et ajouter trois à un contrôle positif, le contrôle négatif et pipetage rechange. Pipette, dans un 0,5 ou 1,5 ml flip-top microtube.

3. Eimeria LAMP Assay

  1. Espèces spécifiques ADN polymérase Bst / LAMP pipette 23 ul Eimeria Mastermix dans un 0.5 ml de tube à centrifuger.
  2. Ajouter matrice d'ADN de 2 pi (préparé à l'article 1), soit un volume de réaction final de 25 ul.
  3. Ajouter ADN génomique 2 pl Eimeria espèces spécifiques à une réaction (contrôle positif). Ajouter de l'eau pour la biologie moléculaire 2 pi à la réaction (contrôle négatif).
    NOTE: Si l'ADN génomique spécifique de l'espèce ne est pas disponible LAMP précédente positif ou un produit PCR standard peuvent être utilisés à la place.
  4. Incuber dans un bain d'eau ou d'un bloc thermique à 62 ° C pendant 30 min. Eventuellement, de réactiver la polymérase Bst ADN par chauffage à 80 ° C pendant 10 min si la réaction ne est pas va être lu immédiatement.

4. LAMP Lire test-out

  1. À la fin de l'incubation d'évaluer la couleur de chaque réaction à l'œil sous la lumière intérieure. Les résultats négatifs sont en rose au violet en couleurs, des résultats positifs apparaissent ciel bleu 20.
  2. Eventuellement, confirmer le résultat d'analyse de LAMP dans un laboratory en mélangeant le produit réactionnel d'LAMP 5 ul avec une pi de tampon de gel de l'ADN de chargement pour l'électrophorèse sur gel d'agarose en utilisant un gel d'agarose à 2% dans 1 x Tris / Borate / EDTA (TBE), pré-colorées en utilisant un colorant d'acide nucléique (5 ul par 50 ml d'agarose). Ajouter 5 ul d'une moléculaire échelle d'ADN de taille 1Kb à la piste 1 du gel pour permettre le calcul de la taille des fragments.

Representative Results

la validation de la Assay

Lors de la validation de chaque test LAMP spécifique de l'espèce Eimeria été testé en utilisant un panel d'échantillons d'ADN pur représentant les sept espèces d'Eimeria qui infectent le poulet, ainsi que l'ADN génomique de poulet comme un contrôle hôte. Une électrophorèse sur gel d'agarose a été utilisée pour chaque essai et résoudre démontré absolue spécificité d'espèce hôte sans réactivité croisée 18. Ensuite, une fois dix séries de dilution en série préparé en utilisant Eimeria tenella purifié l'ADN génomique a révélé une limite de sensibilité du dosage comprise entre un et dix copies de génome 18. Aucune limite supérieure a été déterminée avec des résultats positifs obtenus jusqu'à et y compris la plus forte concentration (100 000 copies du génome) 18.

Application aux échantillons de terrain

Les échantillons prélevés pour les tests Eimeria sont susceptibles d'être dérivé de poulets trouvés morts, abattus à la suite de pplancher santé ou abattus pour la surveillance de la santé sentinelle, indiquant une taille de l'échantillon susceptible d'entre un et trois lorsqu'une partie d'une routine. Test de trois oiseaux prélevés dans une ferme de poulets de chair US dans le cadre d'un programme de surveillance a donné trois séries d'échantillons intestinaux. Application des spécifiques aux espèces LAMP essais ciblée, la priorité des sites intestinaux préférés pour chaque espèce Eimeria (tableau 1), a permis l'identification visuelle de l'infection eimerian chez tous les oiseaux testés en utilisant hydroxynaphthol bleu comme un indicateur (figure 2A). La couleur obtenue avec une réaction LAMP négative lors de l'utilisation du bleu de hydroxynaphthol peut varier du violet au rose, mais est toujours distinct du bleu réalisé par un résultat positif. Confirmation par électrophorèse sur gel d'agarose a donné des résultats comparables (figure 2B). Lors de l'application sur le terrain, l'utilisateur peut choisir d'appliquer le plein écran contre tous les sept espèces, ou cibler uniquement les espèces prioritaires queimportante ou connue circulant sur la ferme ou dans les environs.

L'échec des approches basées sur la PCR de se établir en tant que diagnostic de l'apparition de Eimeria souligne l'exigence de simplicité dans tout nouveau test. Alors que LAMP propose une préparation simple et le traitement que la PCR, l'obligation de tester plusieurs sites intestinaux par oiseau reste décourageant. La production d'un seul échantillon d'ADN groupé par oiseau, qui peut ensuite être testé avec un ou plusieurs tests de lampe, est susceptible d'être plus attrayant. Traitement d'un échantillon regroupé par oiseau, la matière recueillie à partir de chacun des sites intestinaux spécifiques décrites dans le tableau 1 et regroupées avant la préparation de l'ADN, pour l'essai avec l'ensemble des sept essais de LAMP représentant à condition que le même résultat que lorsque chaque site intestinal a été générée séparément (figure 2 par rapport à la figure 3).

Figure 1 Figure 1. intestinaux sites d'échantillonnage pour la détection de LAMP de Eimeria parasites des espèces qui infectent les poulets. Les régions intestinales ciblées par chaque espèce Eimeria est mis en évidence par les lignes colorées, avec les sites préférés d'échantillonnage indiquée par le nombre entre les lignes noires pointillées (E. acervulina: jaune / 1, E. brunetti: rose / 2, E. maxima: bleu / 3, E. mitis: orange / 4, E. necatrix: rouge / 5, E. praecox: vert / 6 et E. tenella: gris / 7). Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. LAMP diagnostic de l'infection vient eimerianm trois poulets de chair commerciaux. réactions LAMP résolus en utilisant (A) hydroxynaphthol bleu, où une réaction bleu ciel était positif et un violet au rose réaction était négative, et électrophorèse sur gel (B) d'agarose. Les sites de l'intestin de l'échantillon étaient présentés dans le tableau 1 pour chaque espèce de parasite. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. Mitis, N = E. necatrix, E. P = praecox et E. T = tenella. Lane 1 contenait l'échelle GeneRuler ADN 1Kb. Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. LAMP diagnostic de l'infection en utilisant eimerian réac LAMP rassemblé des échantillons de trois poulets de chair commerciaux distincts.tions résolu en utilisant bleu hydroxynaphthol, où une réaction bleu ciel était positive et violet au rose réaction était négative. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. Mitis, N = E. necatrix, E. P = praecox et E. T = tenella. Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.

site de l'échantillon Eimeria dosage des espèces (le plus probable)
Duodénum (D) E. acervulina, E. praecox
Jéjunum / iléon * (J / I) E. maxima, E. necatrix
Caecum (C) E. necatrix, E. tenella
Iléon terminal (TI) E. brunetti, E. mitis Échantillon groupé (P) E. acervulina, E. brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella

Tableau 1. intestinale sélection spécifique à la région du candidat Eimeria essais d'espèces. Le choix de la région à échantillonner varie pour chaque espèce Eimeria comme illustré sur la figure 1. Échantillons communs comprennent matériel recueilli des quatre sites spécifiques qui ont ensuite été combinés pour la préparation d'ADN.

Primer * concentration en Stock (M) Volume (pi)
Eau - 60
Amorce interne avancée (FIP) 100 40
Pri arrière intérieuremer (BIP) 100 40
Primer externe avancée (F3) 100 10
Primer extérieur vers l'arrière (B3) 100 10
Boucle avant (LF) 100 20
Boucle arrière (LB) 100 20
Total 200

Tableau 2. Préparation d'un prémélange LAMP primaire. Les composants et les proportions nécessaires pour préparer un prémélange amorce pour LAMP. Les volumes sont présentés pour 100 réactions LAMP. * Identités Primer comme indiqué dans les matériaux et Barkway et al (2011) 18.

Stock conc n Réaction final n conc Volume par réaction (ul)
DDW - - 10,1
Tampon Thermopol 10 x X 1 2,5
MgSO 4 100 mM 2 mM 0,5
Mélange Primer * Tableau 2 2,5
dNTP 25 mM 400 uM 0,4
Bétaïne 5 M M 1 5
Hydroxynaphthol bleu 3 mM 120 pM 1
L'ADN polymerase de Bst 8000 U / ml 8 U 1
Total 23

Tableau 3. Préparation d'un LAMMastermix P de réaction. * Eimeria spécifique à l'espèce.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics