EPA Metode 1615. Måling af Enterovirus og Roskildesyge Forekomst i Water af Kultur og RT-qPCR. Del III. Virus Detection ved RT-qPCR

1National Exposure Research Laboratory, U.S. Environmental Protection Agency, 2Technical Services Center, Office of Ground Water and Drinking Water, U.S. Environmental Protection Agency
Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Kvantitativ PCR (qPCR, se supplerende materialer til definitioner af udtryk, der anvendes i dette manuskript) og revers transkription-qPCR (RT-qPCR) er værdifulde værktøjer til påvisning og kvantificering af menneskelige enteriske virus i miljø- og drikke vand, og især for mange vira, der gør ikke replikere eller replikere dårligt i cellekultur-systemer. Begge værktøjer har vist, at mange virustyper er til stede i miljø- og drikke vand i hele verden 1-6. Deres anvendelse kombineret med sekventering af forstærkede genomiske fragmenter under sygdomsudbrud undersøgelser har fremlagt bevis for vandbåren virus transmission, da de har vist, at virus findes i drikkevandet er identisk med det skur ved udbrud patienter 7-10.

Både qPCR og RT-qPCR er nyttige folkesundheden værktøjer. For eksempel, data fra undersøgelser foretaget af det amerikanske Environmental Protection Agency (EPA) viste et stærkt forhold værelem indikator målinger af qPCR og sundhedsmæssige effekter i rekreative vandområder. Som et resultat, EPA endelige 2012 Rekreative Vand Kvalitetskriterier indeholder en qPCR metode til overvågning rekreative strande 11,12. Borchardt og kolleger fandt også en stærk sammenhæng mellem akut gastroenteritis i fællesskaber ved hjælp af ubehandlet grundvand og virus i grundvand som målt ved RT-qPCR 1.

Formålet med dette dokument er at beskrive den molekylære analyse komponent i EPA-metode 1615 13,14. Denne analyse bruger RT-qPCR at give en kvantitativ vurdering af enterovirus og norovirus genomiske kopier (GC) per liter baseret på det oprindelige volumen af ​​den miljømæssige eller drikkevand ledes gennem en elektropositivt filter. En oversigt over den molekylære procedure er vist i figur 1. Protokol § 1 detaljer procedurerne for udarbejdelse af standardkurven. Disse standarder fremstilles ud fra et reagens, som indeholder en RNEn kopi af målsekvensen for alle primer / probe sæt. Afsnit 2 beskriver den tertiære koncentration procedure. Afsnit 3 giver proceduren til ekstraktion af RNA fra de koncentrerede vand- og kontrolprøver. Den RNA fra hver prøve er omvendt transskriberet ved hjælp tredobbelte analyser og tilfældige primere til prime transkription (afsnit 4). CDNA fra hver revers transkription reaktion er opdelt i fem separate virusspecifikke assays, der analyseres i tre eksemplarer af qPCR (afsnit 5; figur 2). Analysen anvender primere og prober fra den videnskabelige litteratur (tabel 1), der er designet til at detektere mange enterovirus og norovira og et reagens indeholder hepatitis G-RNA til at identificere testprøver, der er hæmmende for RT-qPCR 15.

Protocol

Bemærk: Brug datablade til at spore alle trin i protokollen; eksempel datablade er angivet i den supplerende materialer Borde S2-S4.

1. Standard Curve Forberedelse

  1. Forbered en arbejdsgruppe bestand af standardkurven reagens (f.eks Armored RNA EPA-1615) ved at fortynde den fra koncentrationen leveres af fabrikanten til en koncentration på 2,5 x 10 8 partikler / ml (2,5 x 10 8 GC / ml) ved hjælp af TSM III buffer. Opdel arbejdslager i 250 pi prøver ved hjælp af 1,5 ml mikrocentrifugerør og opbevares ved -20 ° C.
    BEMÆRK: Se supplerende materialer protokol Trin S1 for anvisninger om de forbereder arbejder lagre af virus og plasmider til brug som alternativ standard kurve reagenser.
  2. Tø en eller flere af de arbejdende lager portioner. Fremstilles fem 10-fold seriefortyndinger under anvendelse af 1,5 ml mikrocentrifugerør, hvilket giver koncentrationer på 2,5 x 10 7, 2,5 x 10 6, 2,5 x10 5, 2,5 x 10 4 og 2,5 x 10 3 GC / ml.
    1. Forbered første fortynding ved tilsætning af 25 pi af 2,5 x 10 8 GC / ml arbejdslager til 225 pi TSM III puffer. Bland i 5-15 sek ved anvendelse af en vortex-blander.
    2. Forbered næste fortynding ved tilsætning af 25 pi fortyndingen forberedt i trin 1.2.1 til 225 pi TSM III buffer. Bland igen og fortsætte en lignende proces til fremstilling af de næste tre 10-fold fortyndinger.
  3. Uddrag RNA fra standardkurven arbejder materiel og de fem fortyndinger umiddelbart anvendelse af proceduren i punkt 3.

2. Tertiær Koncentration

  1. Der fremstilles en centrifugal-koncentrator (30.000 molekylvægtafskæring) for hver prøve opsamlet ved tilsætning af mindst 10 ml 1x PBS, 0,2% bovint serumalbumin (BSA) til den øverste prøvekammer. Sørg for, at løsningen har fyldt den tynde kanal koncentrationen kammer, og derefter holde O / N ved 4 ° C.
  2. Tilføj en mængde sekundære vand koncentrat fra hver prøve svarende til S, Assay Prøvevolumen i separate centrifugal koncentratorer.
    1. Beregn S hjælp ligning 1,
      Ligning 1
      Hvor D er Volumen af ​​Original vandprøve analyseret, TSV er den samlede Prøvevolumen og FCSV er finalen Koncentreret Prøvevolumen. Se supplerende materialer S2 for et eksempel på beregning af S.
  3. Centrifuger hvert prøven med 3,000-6,000 xg ved 4 ° C i en svingende spand rotor i 20 - 30 min. Check lydstyrken i tynde kanal koncentrationen kammer.
    1. Hvis mængden er større end 400 pi, centrifugeres igen i 20 minutter eller længere. Fortsæt med centrifugering, indtil prøven i the-koncentration tynd kanal kammer er blevet reduceret til mindre end 400 pi. Fjern ikke supernatanten.
  4. Vask siderne af centrifugal-koncentrator med 1 ml sterilt 0,15 M natriumphosphat, pH 7-7,5 at øge virusudvinding. Centrifuger igen på 3,000-6,000 xg og 4 ° C, indtil prøven er blevet reduceret til mindre end 400 pi. Gentag dette vasketrin én ekstra tid.
  5. Ved hjælp af en 100-200 ml mikropipette, omhyggeligt måle og overføre hver koncentrerede prøve til et 1,5 ml mikrocentrifugerør (dvs. overføre 200 pi til mikrocentrifugerør og derefter måle den resterende koncentrat ved at justere mikropipette, indtil den resterende fluid kan helt udarbejdes i pipette tip). Tilføj 0,15 M natriumphosphat, pH 7-7,5, til det endelige rumfang justeres til 400 ± 2 pi.
  6. Uddrag nukleinsyre straks ved at gå til trin 3. Hold eventuelle koncentrerede prøver, der ikke kan Processed umiddelbart ved 4 ° C i højst 24 timer.

3. nukleinsyreisolering

  1. Tilsæt 200 pi ekstraktionspuffer fremstillet som beskrevet i trin 3.3 og 200 pi af den tertiære koncentrat fra hver prøve fra trin 2,5 eller standardkurve fortynding fra trin 1.3 til adskillelse mærket 1,5 ml mikrocentrifugerør. Frys resterende tertiære koncentrater ved eller under -70 ° C. Uddrag nukleinsyrerne fra hver prøve ifølge den nukleinsyre ekstraktion kit fabrikantens anvisninger for spin protokol for blodprøver med følgende undtagelser.
  2. Tilsæt ikke protease til vandprøverne eller bruge ekstraktionsbuffer leveres med nukleinsyren ekstraktion kit.
  3. Forbered ekstraktionsbuffer med bærer-RNA
    1. Tilføj 310 pi bærer-RNA fortyndingsbuffer til et hætteglas indeholdende 310 ug bærer-RNA. Bland til at opløse og derefter opdele i 6 portioner, der indeholder omkring 50 pi. Opbevares ved -20° C.
    2. Tilføj 28 pi optøet bærer-RNA pr ml af ekstraktionsbuffer til opnåelse af en bærer-RNA koncentration på 0,027 pg / pl. Brug carrier-RNA-ændrede ekstraktionsbuffer i stedet for, at der leveres med udvinding kit.
  4. Der fremstilles en master-opløsning af elueringspufferen ved tilsætning ribonuclease (RNase) inhibitor til en endelig koncentration på 400 enheder / ml til elueringspufferen leveres med ekstraktion kit.
    1. Elueres RNA fra nukleinsyrebindingsdelen spinkolonne ved at placere 50 pi elueringspuffer med RNase inhibitor i kolonnen. Vent i 1 minut, og derefter centrifugeres ved 6000 x g i 1 min ved stuetemperatur.
    2. Gentag trin 3.4.1 og fjern derefter og kassér kolonnen.
  5. Forbered portioner af RNA ekstrakter fra trin 3.4.2. Forbered 6 portioner af standardkurven arbejdslager og hver standardkurve fortynding indeholder mindst 15 pi hver. Forbered 4 portioner af alle andre RNA-prøver indeholdende mindst22 pi hver. Opbevar en aliquot af hver prøve og kontrol standardkurve ved 4 ° C, hvis de kan behandles ved revers transkription inden 4 timer; ellers gemme alle prøver ved eller under -70 ° C.

4. Revers transkription (RT)

  1. Fremstilling af 100 pM stamopløsninger af hver oligonukleotidprimer og probe er anført i tabel 1 ved tilsætning af et volumen på PCR-grade vand til hvert hætteglas under anvendelse af en mængde (i mikroliter) svarende til ti gange antallet af nanomol (nmol) af oligonucleotid til stede i hætteglas (som vist på hætteglassets etiket eller i fabrikantens specifikation ark (f.eks resuspender en primer, der indeholder 36,3 nmol i 363 ul). Bland at opløse.
    1. Fortynde 100 uM løsninger 1:10 med PCR-grade vand til at forberede 10 uM arbejder løsninger.
  2. Forbered RT Master Mix 1 og 2 i et rent rum ved hjælp af vejledning i tabel 2. Pipette 16,5 pi RT MasteR Mix 1 til hver PCR-plade brønd med en multikanalpipette.
  3. Tø, hvis de er frosset, de nucleinsyreekstrakter fra hver prøve felt og Lab Berigede prøvematrixen (LFSM, dvs podet vand matrixprøve).
    1. Fortynd hvert felt og LFSM prøve 1: 5 og 1:25 i elueringsbuffer indeholdende 400 enheder / ml RNase inhibitor.
    2. Tø, hvis de er frosset, men ikke udvande Lab Fortified Blank (LFB, altså en positiv kontrol kvalitet ved hjælp seedet reagenskvalitet vand), Lab reagens Blank (LRB, altså en negativ kontrol kvalitet ved hjælp af reagenskvalitet vand), Performance Evaluation (PE , dvs podet reagenskvalitet vandprøver anvendes til at evaluere laboratorium funktion forud for starten af en undersøgelse), Performance Test (PT, dvs podet reagenskvalitet vandprøver med titere ukendte for en analytiker, der bruges til at evaluere laboratorium ydeevne under en undersøgelse ), NA Batch negativ udvinding kontrol, eller udvundet RNA fra standardkurven sæt.
    3. Placer 6,7 pi af RNA fra hver prøve, kontrol og standardkurve i separate PCR-plade brønde, ved hjælp af tredobbelte brønde for testprøver og kontroller og dobbelte brønde for standardkurver (se figur S1 for en RT plade eksempel).
      1. Placer 6,7 pi elueringsbuffer i separate PCR plade brønde til ingen skabelon kontroller (NTC). Medtag 2-8 NTC pr RT plade, ved hjælp af to til den første prøve, og derefter to mere for hver fjerde ekstra prøve.
      2. Fordel den negative udvinding og NTC kontrollen i hele pladen.
    4. Forsegl PCR-plade med en varmebestandig pladeforsegler. Bland prøverne i 5-10 sek og centrifugeres ved ≥ 500 xg kortvarigt.
    5. Inkubér pladen i 4 minutter ved 99 ° C og derefter afkøles hurtigt til 4 ° C i en termisk cycler. Centrifuger igen på ≥ 500 xg kortvarigt.
    6. Fjern forsigtigt pladen tætning og derefter tilføje 16,8 pi RT Master Mix 2 til hver brønd. Seal pladen igen med et varmebestandigt pladeforsegler, efterfulgt af blanding og en kort centrifugering ved ≥ 500 x g.
    7. Pladen anbringes i en thermal cycler og køre i 15 minutter ved 25 ° C, efterfulgt af 60 minutter ved 42 ° C, 5 minutter ved 99 ° C, og derefter ved 4 ° C hold cyklus.
    8. Process straks eller inden 8 timer ved qPCR (trin 5), eller opbevares prøver ved eller under -70 ° C, indtil de kan behandles. Opbevar prøver, der kan behandles inden 8 timer ved 4 ° C.

    5. Real-time kvantitativ PCR (qPCR)

    1. Bestem den gennemsnitlige hepatitis G Cq værdi for hvert parti af hepatitis G reagens, inden du kører nogen prøver.
      1. Kør en RT assay under anvendelse 10 replikater forberedt som beskrevet for NTC kontroller (trin 4.1.1). Kør hepatitis G qPCR assay som beskrevet nedenfor (trin 5.2 til 5.5.3). Beregne middelværdien Cq værdien af ​​10 gentagelser.
      2. Juster hepatitis G reagens mængde RT Master Mix 1 (tabel 2), Om nødvendigt, for at opnå en gennemsnitlig Cq værdi mellem 25 og 32 enheder. Kompensere for mængden hæves eller sænkes ved at ændre mængden af ​​vand tilsat for at holde RT Master Mix 1 slutvolumen på 16,5 pl pr assay.
      3. Bekræft eventuelle justeringer ved at gentage trin 5.1.1 til 5.1.2 og ændre Tabel 2 for at afspejle de justerede mængder.
    2. Forbered qPCR master-mix i et rent rum ved hjælp styrene i tabel 3 for enterovirus, tabel 4 og tabel 5 for norovirus genogruppe I, tabel 6 for norovirus genogruppe II, tabel 7 for murine norovirus (norovirus genogruppe V) og tabel 8 for hepatitis G. Bland hver mester mix og centrifugeres ved ≥ 500 xg kortvarigt.
    3. Tilføj PCR master-mix til de relevante brønde af en mærket optisk reaktion plade, ved hjælp af 14 pi per brønd og separate plader for hver qPCR assay (se figur S2 fig S1).
    4. Optø RT pladen fra trin 4.8 ved RT, hvis de er frosset. Bland bruge en plade mixer og centrifugeres ved ≥ 500 xg kortvarigt.
    5. Dispenser 6 pi af den relevante cDNA til de relevante brønde i den optiske reaktion plade. Bland prøverne i den optiske reaktion plade og centrifuger ved ≥ 500 xg kortvarigt.
      1. Kør hepatitis G qPCR analyse på ufortyndet og fortyndet felt og LFSM prøver før du kører alle andre qPCR analyser. Brug det laveste fortynding af marken eller LFSM prøve, som er <1 Cq værdi større end den gennemsnitlige hepatitis G Cq værdi for enterovirus og norovirus qPCR assays.
      2. Opsætning af kvantitativ PCR thermal cycler software i henhold til producentens anvisninger. Identificer standardkurven prøver som standarder og for hver standardkurve fortynding, indtast de genomiske kopi værdierne i tabel 9.
    6. Undersøg, om hver standardkurve opfylder de acceptable værdier i tabel 10. Se supplerende materialer afsnittet S3 for eksempler.
      1. Beregne den samlede standardafvigelse (Stdafv) for standardkurven ved hjælp af ligning 2,
        Ligning 2
        hvor Cq er værdien rapporteret for hver standard kurve gentagelse, CQ er middelværdien for hvert sæt af replikater, #Cq er det samlede antal af CQ-værdier til alle standard kontrol replikater, der har positive værdier (dvs. ikke ubestemt), og # kønssygdomme er antallet af standard kontroller, der har positive værdier.
      2. Hvis kvantitativ PCR thermal cycler software ikke beregne hældningen for hver standardkurve, beregne hældningen ved hjælp af ligning 3,60;
        Ligning 3
        hvor Cq er middelværdien af de højeste og laveste fortyndinger anvendes og log GC er loggen af den genomiske kopi værdi for de højeste og laveste fortyndinger anvendes fra tabel 9.
      3. Beregn R2 værdi ved anvendelse af ligning 4.
        Ligning 4
        hvor Cq er gennemsnittet af alle CQ værdier og Log GC er middelværdien Log GC værdi for hver gentagelse.
      4. Beregn% Effektivitet anvendelse af ligning 5:
        Ligning 5
    7. Registrere GC beregnede værdier den termiske variator software til alle prøveemner baseret på standardkurver, der opfylder kriterierne i tabel 10, og de ​​gennemsnitlige GC værdier for hver prøve. Gentages nogen prøver med standardkurver, der ikke opfylder kriterierne i
    8. Bestem GC per liter (GC L) for hver prøve ved hjælp af ligning 6:
      Ligning 6
      hvor GC er middelværdien genomiske kopi nummer fra trin 5.7, faktoren '199' er den samlede fortyndingsfaktor at reduktionerne volumen, der opstår under den tertiære koncentration, RNA-ekstraktion og RT-qPCR trin, DF er fortyndingsfaktoren, der kompenserer for hæmning , og D er Volumen af ​​Original vandprøve analyseret i liter. Se supplerende materialer afsnittet S4 for et eksempel på beregning af GC L.
    9. Beregne den fulde GC af LFB og LRB prøver ved at multiplicere den gennemsnitlige GC værdien fra trin 5,5 ved 199 og dividere med 0,3.

Representative Results

Samlet virus opsving blev bestemt ved anvendelse af parret felt og LFSM jorden vandprøver. I alt syv prøvesæt blev analyseret ved anvendelse af to sæt indsamlet ved forskellige lejligheder fra tre offentlige rensningsanlæg, og et prøvesæt indsamlet fra private godt. Seed niveauer for de LFSM prøver var 3 x 10 6 MPN af Sabin poliovirus serotype 3 og 5 x 10 6 PFU murine norovirus. Murint norovirus blev anvendt som et surrogat i fremgangsmåden evaluering på grund af en mangel på menneskelige norovirus lagre med en virus tilstrækkelig koncentration til LFSM prøver. For grundvandsprøver den gennemsnitlige poliovirus opsving var 20% med en standardafvigelse på 2%, 14 mens betyde muse norovirus opsving var 30% med en standardafvigelse på 3% (figur 3). Den regelmæssige felt grundvand prøve for hver LFSM havde ingen påviselig enterovirus eller norovirus.

LFB og LRB prøver blev målt under anvendelse af podede og upodede reagenskvalitet watER. Alle LRB prøver var negative (data ikke vist). Poliovirus-udvinding var gennemsnitlig 44% med en standardafvigelse på 1% (figur 3), mens murint norovirus-udvinding var gennemsnitlig 4% med en standardafvigelse på 0,5%.

RT-qPCR kræver anvendelse af passende standard curve reagenser. Figur 4 viser en typisk standardkurve for enterovirus og norovirus GII. Den norovirus GII kurve opfylder de almindelige kurve resultatkriterier (tabel 10) med en R2 værdi på 0,9987, en samlet standardafvigelse på 0,14, og 101% effektivitet. Norovirus GIA og GIB kurver (ikke vist) er næsten identisk med norovirus GII. Den enterovirus kurve opfylder kriterierne metode ydeevne med en R2 værdi på 0,9874, en samlet standardafvigelse på 0,58, og 103% effektivitet, men har omkring hundrede gange mindre følsomhed og dermed en højere detektionsgrænse end norovirus kurver.


Figur 1. Oversigt over Molekylær Procedure. Den molekylære procedure omfatter yderligere koncentration prøve ud over det udførte til måling smitsom virus, udvinding af nukleinsyrer, en to-trins revers transkription (RT) protokol, og kvantitativ PCR (qPCR). Lydstyrken start (S) repræsenterer en metode defineret andel af den oprindelige vandprøven.

Figur 2
Figur 2. RT-qPCR oversigt skematisk. Hver ekstraheret testprøve RNA revers transkriberet under anvendelse af assays in triplo (RT1, RT2 og RT3). CDNA fra hver af de tredobbelte RT assays derefter analyseres for bestemte virus ved hjælp af separate enterovirus (EV PCR), norovirus genogruppe I (NOV GIA PCR og NOV GIB PCR), norovirus genogruppe II (NOV GII PCR), og hepatitis G (HGV PCR) analyser.

Figur 3
Figur 3. Middel poliovirus og murine Norovirus Recovery (%) fra Ground og vand af reagenskvalitet. Den gennemsnitlige procent opsving er vist for poliovirus fra jorden ( Figur 3-1 ; n = 7) og fra reagenskvalitet ( Figur 3-2 ; n = 12) vand og for murine norovirus fra jorden ( Figur 3-3 ; n = 7) og fra reagenskvalitet ( Figur 3-4 ; n = 12) vand (1), hvor "n" er antallet af særskilte vandprøver forarbejdet. Fejlsøjler repræsenterer standardafvigelsen.

Figur 4 Figur 4. Enterovirus og Norovirus GII standardkurven. Typiske standard kurver for enterovirus og norovirus GII er vist. Formlerne giver hældning og R 2 værdier for hver kurve er beregnet ved den termiske cycler.

Supplerende fil 1. Klik her for at downloade denne fil.

Virus Group Primer / Probe navn (1) Sekvens (2) Reference
Enterovirus
EntF (EV-L) 20
Entr (EV-R) ACCGGATGGCCAATCCAA 20
ENTP (Ev-sonde) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA 21
Norovirus GIA
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA 22
Norovirus GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA 23
Norovirus GII
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA 25
Norovirus GV
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 VIC-TGGCCAGGGCTTCTGT-MGB 14
Hepatitis G
HepF (5'-NCR forward primer) CGGCCAAAAGGTGGTGGATG 19
HepR (5'-NCR revers primer) CGACGAGCCTGACGTCGGG 19
Hepp (hepatitis G TaqMan Probe 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA 1

Tabel 1. Primere og TaqMan Sonder til Virus Detection ved RT-qPCR.
(1) Metode 1615 primer og probe navne er de tre første bogstaver i virus navn sammenkædet til F, R eller P for frem, tilbage, og sonde. Den norovirus genogruppe betegnes ved at tilføje GI og GII til navnene. De to norovirus GI primersæt også skelnes ved hjælp af A og B. Primer og probe navne fra de primære henvises der i moderselskabetheses.
(2) orienteringen af ​​primer og probesekvenser er 5 'til 3'. Følgende degenererede base-indikatorer anvendes: N-en blanding af alle fire nukleotider; R-A + G; Y-T + C; W-A + T; og I-inosin.

Ingrediens Volumen pr reaktion (pi) (2) Slutkoncentration Volumen pr Master Mix (pl) (3)
RT Master Mix 1
Tilfældig primer 0,8 10 ng / pl (c. 5,6 uM) 84
Hepatitis G Armored RNA (4) 1 105
PCR-kvalitet vand 14.7 1543,5
Tiltal 16,5 1732,5
RT Master Mix 2
10x PCR-buffer II 4 10 mM Tris, pH 8,3, 50 mM KCI 420
25-mM MgCI2 4.8 3 mM 504
10 mM dNTP'er 3.2 0,8 mM 336
100-mM DTT 4 10 mM 420
RNase Inhibitor 0,5 0,5 enheder / pl 52.5
SuperScript II RT 0,3 1,6 enheder / pl 31.5
Total 16.8 1764

Tabel 2. RT Master Mix 1 og 2 (1).
(1) Forbered RT Master Mixes i en clean værelse, dvs et rum, hvor der ikke udføres molekylære og mikrobiologiske procedurer.
(2) Det endelige RT assayvolumen er 40-pi.
(3) De mængder viser er baseret på 105 assays. Dette er tilstrækkeligt til en 96-brønds PCR-plade med de ekstra assays hvormed redegøre for tab. Beløbet kan skaleres op eller ned i forhold til antallet af prøver og kontroller, der vil blive analyseret.
(4) Bestem mængden af ​​hepatitis G reagens til at omfatte i RT Master Mix 1 som beskrevet i supplerende materialer trin S4.

Ingrediens Volumen pr reaktion (pi) (2) Slutkoncentration Volumen pr Master Mix (pl) (3)
2x LightCycler 480 Sonder Master Mix 10 Proprietære 1050
ROX henvisningfarvestof (4) 0,4 0,5 mM 42
PCR-kvalitet vand 1 105
10 uM EntF 0.6 300 nM 63
10 uM ENTR 1.8 900 nM 189
10 uM ENTP 0,2 100 nM 21
Total 14 1470

Tabel 3. PCR Master Mix for Enterovirus (EV) assay (1).
(1) Klargør alle PCR Master miks i et rent rum.
(2) Det endelige qPCR assay volumen er 20 pi.
(3) De mængder viser er baseret på 105 assays. Dette er tilstrækkeligt til en 96-brønds PCR-plade med de ekstra assays hvormed redegøre for tab. Beløbet kan skaleres op eller ned i forhold til antallet af prøver og kontroller, der vilanalyseres.
(4) Stedfortræder PCR-kvalitet vand for dette reagens, når du bruger instrumenter, der ikke kræver det.

Ingrediens Volumen pr reaktion (pi) (2) Slutkoncentration Volumen pr Master Mix (pl) (3)
2x LightCycler 480 Sonder Master Mix 10 Proprietære 1050
ROX referencefarvestof (4) 0,4 0,5 mM 42
PCR-kvalitet vand 1.4 147
10 uM NorGIAF 1 500 nM 105
10 uM NorGIAR 1 500 nM 105
10 uM NorGIAP 0,2 100 nM 21
Total 14 1470

Tabel 4. PCR Master Mix for Norovirus GIA (nov GIA) Indhold (1).
Se tabel 3 for fodnoter (1) - (4).

Ingrediens Volumen pr Reaktion (pi) (2) Slutkoncentration Volumen pr Master Mix (pl) (3)
2x LightCycler 480 Sonder Master Mix 10 Proprietære 1050
ROX referencefarvestof (4) 0,4 0,5 mM 42
PCR-kvalitet vand 0,3 31.5
10 uM NorGIBF 1 500 nM 105
10 uM NorGIBR 1.8 900 nM 189
10 uM NorGIBP 0,5 250 nM 52.5
Total 14 1470

Tabel 5. PCR Master Mix for Norovirus GIB (nov GIB) Indhold (1).
Se tabel 3 for fodnoter (1) - (4).

<td> 0,5 mM
Ingrediens Volumen pr Reaktion (pi) (2) Slutkoncentration Volumen pr Master Mix (pl) (3)
2x LightCycler 480 Sonder Master Mix 10 Proprietære 1050
ROX referencefarvestof (4) 0,4 42
PCR-kvalitet vand 0,3 31.5
10 uM NorGIIF 1 500 nM 105
10 uM NorGIIR 1.8 900 nM 189
10 uM NorGIIP 0,5 250 nM 52.5
Total 14 1470

Tabel 6. PCR Master Mix for Norovirus GII (nov GII) Indhold (1).
Se tabel 3 for fodnoter (1) - (4).

Ingrediens Volumen pr Reaktion (pi) (2) Slutkoncentration Volumen pr Master Mix (pl) (3)
2x LightCycler 480 Sonder Master Mix 10 Proprietære 1050
ROX referencefarvestof (4) 0,4 0,5 mM 42
PCR-kvalitet vand 0,3 31.5
10 uM MuNoVF1 1 500 nM 105
10 uM MuNoVR1 1.8 900 nM 189
10 uM MuNoVP1 0,5 250 nM 52.5
Total 14 1470

Tabel 7. PCR Master Mix for murin Norovirus Assay (1).
Se tabel 3 for fodnoter (1) - (4).

Ingrediens Bindpr Reaktion (pi) (2) Slutkoncentration Volumen pr Master Mix (pl) (3)
2x LightCycler 480 Sonder Master Mix 10 Proprietære 1050
ROX referencefarvestof (4) 0,4 0,5 mM 42
PCR-kvalitet vand 1.4 147
10 uM HepF 1 500 nM 105
10 uM HepR 1 500 nM 105
10 uM Hepp 0,2 100 nM 21
Total 14 1470

Tabel 8. PCR Master Mix for Hepatitis G (HGV) Indhold (1).
Se

Standard Curve Koncentration Genomiske Kopier pr RT-qPCR assay (1, 2)
2,5 x 10 8 502.500
2,5 x 10 7 50.250
2,5 x 10 6 5025
2,5 x 10 5 502,5
2,5 x 10 4 50,25
2,5 x 10 3 5,025

Tabel 9. Standard Curve qenomiske kopier.
(1) Identificer standardkurven brønde som standarder og placere de genomiske kopier pr RT-qPCR analyseværdier på et passende sted i termocykliseringsapparat software.
(2) En acceptabel standardkurve vil have en effektivitet på 70% -110%, En R2-værdi> 0,97, og en samlet standardafvigelse på <0,5 for norovirus og <1,0 for enterovirus.

Kriterier Acceptabel værdi
Norovirus Enterovirus
Samlet standardafvigelse <0,5 <1,0
R2 > 0,97 > 0,97
Effektivitet 70% til 115% 70% til 115%

Tabel 10. Standard Curve Acceptkriterier (1).
(1) Standard kurver med% Efficiencies på 70% -110% er acceptable, men værdier i 90% -115% interval er ideelle. Værdier mindre end 90% kan indikere pipettering eller fortynding fejl.

QA Komponent Mean Recovery Range (%) Variationskoefficient (%)
Lab reagens Blank; negative PT eller PE prøver 0 N / A (1)
Lab Berigede Blank; Lab Befæstet prøvematrix 5-200 N / A
Positive PT og PE prøver 15-175 ≤130

Tabel 11. Metode 1615 resultatkriterier.
(1) Ikke relevant.

Medier Sammensætning
0,15 M natriumphosphat, pH 7,0-7,5 Forbered 0,15 M natriumphosphat ved at opløse 40,2 g natriumphosphat, dibasisk (Na 2 HPO 4 · 7H 2 O) i et slutvolumen på 1 liter dH
5% BSA Forbered ved at opløse 5 g BSA i 100 ml dH 2 O. Steriliseres ved passage af opløsningen gennem et 0,2 um steriliseringsfilter.
PBS, 0,2% BSA Fremstilles ved tilsætning af 4 ml af 5% BSA til 96 ml PBS. Steriliseres ved passage af opløsningen gennem et 0,2 um steriliseringsfilter.
TSM III buffer Opløs 1,21 g Trisma base, 5,84 g NaCl, 0,203 g MgCl2, 1 ml Prionex gelatine, og 3 ml Microcide III i 950 ml reagenskvalitet vand. PH justeres til 7,0, og derefter bringe slutvolumenet til 1 L. steriliseres ved passage af opløsningen gennem et 0,2 um steriliseringsfilter.
0,525% natriumhypochlorit (NaCIO) Forbered en 0,525% NaCIO løsning ved at fortynde husholdningsblegemiddel 1:10 i dH 2 O. Opbevar 0,525% NaCIO løsninger i op til 1 uge ved stuetemperatur.
1-M natriumthiosulfat (Na 2 S 2 O 3) pentahydrat Forbered en 1 M opløsning ved at opløse 248,2 g Na 2 S 2 O 3 i 1 L dH 2 O. Store natriumthiosulfat i op til 6 måneder ved stuetemperatur.

Tabel 12. Tabel over Media.

Discussion

Store nationale undersøgelser af viral kontaminering af kilde- og drikke vand kræver brug af flere analyselaboratorier. Under disse betingelser er behov for en standard metode til at sikre, at de data, der genereres af de mange laboratorier er sammenlignelige. Der er mange publicerede molekylære metoder til virusdetektion, men meget få standardiserede molekylære metoder. EPA Metode 1615 er en standardiseret metode specielt designet til detektion af enterovirus og norovirus i vand matricer ved RT-qPCR. Standardiserede molekylære metoder er tilgængelige for virus påvisning i fødevarer (CEN / ISO TS 15216-1 og CEN / ISO TS 15216-2, April 7, 2013) 16,17, og er blevet anvendt til påvisning af hepatitis A-virus og norovirus i foråret vand 16. Alle standard metoder skal indeholde kvalitet ydeevne kontrol og kriterier for at minimere inter- og intra-laboratorium variation og falske positive data som følge af forurening laboratorium. For yderligere at reducere falske data, EPA Metode 1615 følger Miljøstyrelsens vejledning om molekylære metoder, 18, ​​som foreskriver adskillelse af arbejde under bearbejdning og en måde arbejde flow. Det omfatter en hepatitis G 1,19 interne kontrol og procedurer for at minimere falske negative resultater på grund af hæmmere af RT-qPCR 15. Det bruger kvantitative analyser sammen med standardiserede mængder af både vand samplet og vand analyseres, så alle data felt er udtrykt i genomiske kopier pr liter marken eller drikkevand i stikprøven. Selv effektivt indre rør (ettrins) RT-PCR-assays er kommercielt tilgængelige, fremgangsmåden bevidst bruger separate assays. Dette har den ulempe, at minimere mængden af ​​prøve, der kan analyseres i hver reaktion, men giver større fleksibilitet i anvendelsen af ​​multiple primersæt. RT-qPCR assays er begrænset af, og kun så god som de primere og prober anvendes, og sandsynligvis ingen primer sæt vil registrere alle virus varianter inden for en gruppe. Den enterovirus primer sæt blev valgt, fordidet er rettet mod konserverede 5'-non-kodende region, 20,21 detekterer en bred vifte af enterovirus serotyper, og virus detekteres af det er forbundet med sundhedsmæssige virkninger fra indtagelse af ubehandlede grundvand 1. To primersæt anvendes til påvisning af genogruppe I norovira 22,23. Den første blev valgt på grund af den stærke sammenhæng mellem sundhedsmæssige effekter hos små børn og påvist virus 1. Den anden genogruppe jeg primer sæt og primeren, der bruges til genogruppe II norovira blev valgt, fordi de opdager det bredeste udvalg af stammer 24,25.

På trods af de store fordele ved qPCR og RT-qPCR procedurer til påvisning viralt RNA i vand, er der flere begrænsninger. Først både infektiøse og ikke-infektiøse viruspartikler, herunder inaktiveret ved desinfektionsmidler, kan forstærkes af disse procedurer. Resultaterne af Borchardt tyder på, at dette er et mindre problem for ubehandlet grundvand from grundvandsmagasiner svarende til dem i de samfund studerede end for desinficerede overfladevand 1. For dyrkbare vira dette problem kan overvindes ved anvendelse af PCR i kombination med kultur 26,27. Problemet er også blevet behandlet for nogle vira ved anvendelse af nukleinsyre tværbindingsmidler 28-30. Sidstnævnte metode er mere effektiv for virus inaktiveret ved hypochlorit og ikke effektive for dem, inaktiveret ved UV.

En anden begrænsning af disse molekylære procedurer er, at mængden af koncentreret prøve, der kan analyseres typisk er meget mindre end den, der anvendes til dyrkning procedurer 6,31. Dette problem er ofte håndteres af enten erstatte en polyethylenglycol-baseret procedure for standard sekundære koncentration ved organisk flokkulation, som gør det muligt, at prøven resuspenderet i et mindre volumen, eller ved tilsætning af en tertiær prøvekoncentration trin 6,32,33 . Metode 1615 bruger centrifugalugal ultrafiltrering at tilvejebringe tertiær koncentration. Centrifugal ultrafiltrering fjerner vand og komponenter mindre end 30.000 dalton, hvilket resulterer i både koncentrationen af ​​virus i testprøver og en reduktion i lille molekylvægt inhibitorer af molekylære assays. Dette tertiære koncentration trin resulterer i en samlet koncentration faktor> 10 5 for en hvilken som helst virus, som var til stede i det vand, der testes.

En tredje begrænsning er tilstedeværelsen af ​​inhibitorer af molekylære procedurer i miljøprøver. Selvom mange tilgange til at fjerne hæmmere er blevet udviklet, ingen tilgang er effektiv for alle vand matricer og virustyper 6,34,35, hvilket gør brug af interne kontroller, der skal vurdere graden af hæmning af afgørende betydning. Hepatitis G reagens, der anvendes i denne fremgangsmåde opfylder dette krav ved at tilvejebringe et konstant niveau af viral RNA i alle reaktioner og en RT-qPCR assay til vurdering af inhibering. Når det bedste af than inhibitor fjernelse tilgange undlader at fjerne hæmning, prøve koncentrater kan fortyndes, så længe virus koncentrationer højere end inhibitor koncentrationer 14,15.

Standardkurven heri beskrevne procedure har både fordele og en væsentlig begrænsning. En fordel er, at det anvendte reagens forsyninger alle de nødvendige komponenter i en enkelt reagens, som tillader en enkelt kontrol, der skal anvendes til alle assays. Dette reagens er især en fordel for norovirus assays. Norovirus partikler kan kun opnås fra inficerede individer gør det meget vanskeligt at opnå viruspartikler til anvendelse som standarder. En mere vigtig fordel er, at det giver et RNA-standard for alle målrettede RNA-vira i ét reagens, som har en RNA standard er afgørende for nøjagtig kvantificering af RNA 36. Imidlertid er dens evne til at kvantificere virus nøjagtigt begrænset af det faktum, at der ikke tages hensyn til matrixeffekter. Det betyder, at genomiske kopitalværdier kan ikke betragtes som absolut og bør kun betragtes relativt. Det anbefales, at et tilstrækkeligt antal standard kurve arbejder lager portioner (trin 1.2) være parat til at dække komplette studier. For eksempel har hver 250 pi portion giver tilstrækkelig reagens til 6 RT plader. Hvis det er kendt, at en undersøgelse vil kræve analyse af 500 prøver, vil mindst 12 portioner være nødvendig (500 prøver / 7 prøver pr RT plade / 6 RT plader pr portion).

EPA Metode 1615 er en forestilling baseret metode. Mange producenter gør tilsvarende reagenser til dem, der er angivet heri, og disse reagenser kan substitueres, så længe kriterierne ydeevne er opfyldt. Standardkurven, der også fungerer som en positiv RT-qPCR kontrol, er af værdi fejlfinding problemer med ydeevnen i. Ydeevne kan falde som følge af nedbrydning af RNA, reagens holdbarhed, svigt af frysere, instrument kalibrering og teknisk fejl. Problemer med ydeevnen bør være under mistankeed hvis standard kurver adskiller sig fra den vist i figur 4, eller hvis de ikke opfylder kravene til ydelse specifikation for standard kurver. RT-qPCR analyse er ganske robust; komplet fiasko skyldes sandsynligvis forkert håndtering af RNA eller tekniske fejl (f.eks en manglende reagens). Stor omhu bør tages i håndtering af RNA-prøver mellem udvinding og RT skridt for at reducere RNA-nedbrydning fra ribonucleaser.

Poliovirus inddrivelser fra jorden og reagens lønklasse vande og murine norovirus inddrivelser fra grundvand mødte EPA Method 1615 ydeevne godkendelseskriterier (tabel 11) og svarer til dem rapporteret af andre 33,37,38. Murine norovirus inddrivelser fra LFB prøver var meget lavere end poliovirus og ikke ville have opfyldt kriterierne for modtagelse af poliovirus-specifikke. Årsagerne til lavere murine norovirus nyttiggørelse fra reagenskvalitet vand er ukendte. Svarende til resultaterne heri, Karim og colleagues rapporteret et opsving for norovirus GI.1 på 4% fra postevand 39. Lee et al. 37 rapporterede middelværdier inddrivelser for murine norovirus og human norovirus GII.4 på 18% og 26% fra destilleret vand ved hjælp af disc filtre, hhv. Brug lignende forhold til Lee og kolleger, Kim og Ko observerede inddrivelse af 46% og 43% for disse vira, henholdsvis 38. Gibbons et al. 40 opnået omkring 100% udbytte af human norovirus GII.4 fra havvand, men Kim og Ko 38 sig, at tilsætningen af salt til destilleret vand ved koncentrationer tilsvarende eller højere end havvand signifikant reducerede genfindelse af de murine virus og resulterede i omkring en to-fold reduktion i GII.4 genopretning.

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics