Méthodes pour étudier le rôle de réglementation de petits ARN ribosomal et l'occupation des * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La variation génétique responsable de l'allèle drépanocytaire (HbS) permet érythrocytes à résister à l'infection par le parasite du paludisme, P. falciparum. La base moléculaire de cette résistance, qui est connu pour être multifactorielle, reste mal compris. Des études récentes ont constaté que l'expression différentielle des microARN érythrocytaires, une fois transplantées dans des parasites du paludisme, affectent à la fois la régulation des gènes et de la croissance du parasite. Ces miARN ont ensuite été présentés pour inhiber la traduction de l'ARNm en formant une transcription de l'ARN chimérique via 5 «fusion d'ARN avec des sous-ensembles discrets d'ARNm de parasites. Ici, les techniques qui ont été utilisées pour étudier le rôle fonctionnel et mécanisme putatifs microARN érythrocytaires sous-jacentes sur la régulation des gènes et le potentiel de translation de P. falciparum, y compris la transfection de microARN synthétiques modifiés dans les érythrocytes d'accueil, seront détaillées. Enfin, une méthode de gradient de polysomes est utilisée pour déterminer l'étendue de translation de ces transcriptions. Ensemble, ces techniques nous ont permis de démontrer que les niveaux dérégulés de microARN érythrocytaires contribuent à la résistance du paludisme cellule-intrinsèque des érythrocytes falciformes.

Introduction

Le paludisme, causée par des parasites apicomplexes du genre Plasmodium, est la maladie parasitaire la plus fréquente humaine, infectant globalement environ 200 millions de personnes chaque année et provoque environ 600.000 décès 1. Parmi les cinq espèces de Plasmodium qui infectent les humains, les plus pertinents à la maladie humaine sont P. falciparum et P. vivax, en raison de leurs distributions généralisées et le potentiel pour des complications graves de paludisme. Le cycle de vie du parasite de la malaria infection nécessite à la fois les moustiques et les humains. Quand un moustique infecté pique un humain, les parasites dans la circulation sanguine vers le foie, où une première série de réplication. Après mérozoïtes rupture de l'hépatocyte hôte, ils infectent les globules rouges à proximité, initier la réplication soit sexuée ou asexuée. Le stade asexué de réplication, qui dure 48 heures dans P. falciparum, est l'objet de cette étude, car il est à la fois la source de la plupart malsymptômes aria et est facilement récapitulées in vitro.

Bien qu'un certain nombre d'initiatives de santé publique, y compris l'amélioration des thérapies anti-paludiques, ont quelque peu réduit la charge du paludisme à l'échelle mondiale, l'émergence continue de parasites résistants aux médicaments pose un problème pour les efforts de lutte contre le paludisme. Un aspect qui pourrait suggérer de nouvelles approches thérapeutiques est l'étude sur la façon dont diverses variantes génétiques confèrent une résistance au paludisme. Dans les régions où le paludisme est endémique, une variété de polymorphismes érythrocytaires sont assez commun 2,3. Ces mutations, avec la drépanocytose étant peut-être le plus important, sont souvent associées à une résistance substantielle à l'apparition de l'infection paludéenne 4 symptomatique. Les mécanismes sous-jacents qui causent érythrocytes ils à résister aux infections de paludisme sont encore mal compris. Hématies parasitées avec des mutations de l'hémoglobine sont soumis à la phagocytose renforcée par la rigidité cellulaire accrue et la déshydratation, quiest associé à une diminution de l'invasion par P. 5 falciparum. L'allèle HbC affecte également l'expression des protéines à la surface des érythrocytes et avec le remodelage du cytosquelette, l'inhibition de la poursuite du développement du parasite 6,7. Enfin, P. falciparum pousse mal dans les falciformes homozygote (HbSS) 8,9 érythrocytes in vitro, suggérant facteurs érythrocytaires intrinsèques de résistance du paludisme. Cependant, alors que l'ensemble de ces mécanismes semblent jouer un rôle, ils ne expliquent pas complètement les mécanismes derrière la résistance de la drépanocytose au paludisme.

Un ensemble potentiel des facteurs érythrocytaires qui restent mal compris est la grande piscine de miARN présents dans les érythrocytes matures. Les microARN sont de petits ARN non codants, 19-25 nt de taille, qui médient la traduction et / ou la stabilité des ARNm cibles par appariement de bases à l'intérieur de la 3 'UTR. Ils ont été impliqués dans la régulation de la réponse immunitaire des mammifères, y compris la suppression of 10 la replication du virus, et ont été montrés pour conférer une résistance aux virus dans des plantes Ils ont également été montré pour réguler plusieurs processus, y compris l'érythropoïèse érythrocytaires 11,12 et 13 le métabolisme du fer. Des études précédentes ont identifié une population abondante et diversifiée des miARN érythrocytaires, dont l'expression a été considérablement modifié dans HbSS érythrocytes 14,15. Depuis érythrocytes matures manquent transcription active et la traduction, le rôle fonctionnel de ces miARN érythrocytaires reste incertaine. En échange de matière important se produit entre la cellule hôte et P. falciparum au cours du cycle de développement intra-érythrocytaire (IDC) 16, il a été spéculé que le profil miARN modifié au érythrocytes HbS peut contribuer directement à la résistance du paludisme cellule-intrinsèque.

Ces études ont finalement abouti à l'élaboration d'un pipeline pour isoler, identifier et fonctionnellement étudier le rôle des miARN humain dans le malaria parasite, P. falciparum, qui a indiqué que ces hôtes / miARN humains finalement covalente fusible puis réprimer translation parasite transcriptions d'ARNm 17. Cela a fourni un exemple des premiers inter-espèces transcriptions chimériques formés par trans-épissage et implique que cette fusion miARN-ARNm pouvait se produire chez d'autres espèces, y compris d'autres parasites. Tous les ARNm trypanosomes sont trans-épissage avec une épissure leader (SL) pour réguler la séparation des transcriptions polycistroniques 18. Depuis P. falciparum manque orthologues pour Dicer / Ago 19,20, il est possible que miARN érythrocytaires détournent SL machines similaires dans P. falciparum à intégrer dans les gènes cibles. Des études récentes dans P. falciparum ont en effet indiqué la présence de 5 'des séquences de tête 21 d'épissage. Cette étude détaille les méthodes qui ont conduit à la découverte de l'homme-parasite miARN-ARNm transcrits de fusion, y compris à la fois transcriptomique et traductechniques de régulation supplémentaires. Les objectifs généraux de ces méthodes sont d'étudier les effets de petits ARN dans la régulation des gènes, les phénotypes et la traduction potentiel de P. transcriptions falciparum.

L'identification initiale des transcriptions chimères humains-parasite invoqué l'utilisation des techniques d'analyse d'ARN, comme PCR en temps réel, le séquençage du transcriptome et la bibliothèque capture HNE, qui comprenait à la fois totale et petits ARN, plutôt que d'utiliser des techniques qui ne isolés petits ARN. Isolement de l'ARN tous ensemble dans une grande piscine, plutôt que séparément, a permis l'identification de deux petits ARN humains translocation dans le parasite ainsi que la présence de ces petites séquences d'ARN en tant que partie d'une séquence plus grande. Ce alors requis une analyse de l'état de la traduction de ces ARNm de fusion afin de déterminer les conséquences fonctionnelles de ces fusions.

Bien que des efforts considérables sur la caractérisation du génome de l'un du parasited transcriptome ont ajouté à la compréhension de la biologie du parasite 22-25, loin on connaît moins la régulation de la traduction de l'ARNm du transcriptome à travers le cycle de vie de P. 26 falciparum. Cette compréhension limitée du protéome du parasite a entravé la fois la compréhension de la biologie du parasite et la capacité à identifier de nouvelles cibles pour la prochaine génération de thérapies anti-paludiques. Cet écart dans la compréhension de la biologie cellulaire du parasite a persisté principalement en raison de l'absence de techniques adéquates pour enquêter régulation de la traduction dans P. falciparum. Un récent document décrit l'utilisation de l'empreinte ribosomal de P. falciparum pour déterminer le statut de la traduction globale 21. Une mesure de potentiel bien établie de translation de la transcription est le nombre de ribosomes associés déterminés par polysomes profilage. Cependant, lorsque cette technique est appliquée à P. falciparum </ em>, il est incapable de récupérer la plupart des polysomes et capte principalement monosomes. Récemment, plusieurs groupes 27,28 ont optimisé P. techniques de polysome falciparum par lyse des érythrocytes et le parasite simultanément pour préserver les polysomes et de caractériser l'occupation ribosomique et le potentiel de translation de ces parasites du paludisme au cours de leur développement asexuée dans des cellules hôtes rouges 28.

Collectivement, ces méthodes montrent que la fusion observée des ARNm miRNA et parasite humain module traduction de ces ARNm de fusion, qui a été démontré en utilisant des méthodes précédemment rapportés 27 protéines du parasite, et est un déterminant majeur de la résistance du paludisme dans HbAS et HbSS érythrocytes 17. Ces procédés seraient utiles dans n'importe quel système cherche à identifier et à explorer fonctionnellement événements d'épissage d'ARN, si ces ARN de fusion sont dans un rayon P. falciparum ou d'autres systèmes eucaryotes.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: Isolement des ARN de petite taille à partir de P. Au cours de l'IDC falciparum

  1. Obtenir parasites du paludisme dans la culture asexuée 29.
    NOTE: La taille de culture nécessaire varie en fonction de l'application désirée; Cependant, une culture de 10 ml à 5.3% et 5% de parasitémie hématocrite fournit suffisamment d'ARN pour PCR en temps réel (RT-PCR). La technique a été initialement optimisé pour les cultures asynchrones, mais quand des moments précis durant le cycle de l'infection sont souhaitées, les parasites au stade annulaire peut être synchronisé par la synchronisation de sorbitol au plus tard 10-12 heures post-invasion. Synchronisation doit être répété après un cycle (environ 48 h) 29.
  2. Piscine à cellules infectées ensemble (~ 5 x 10 9 hématies à 3-5% de parasitémie) et remplissent PBS froid à la partie supérieure du tube et centrifuger à 800 g pendant 5 min sans frein pour sédimenter les globules rouges.
  3. Après centrifugation, éliminer le surnageant soigneusement à l'aide d'une pipette d'aspiration, jointà un vide, puisque le culot érythrocytaire est facile à déloger. Laver le culot une fois de plus avec 1x PBS froid.
  4. Remettre en suspension culot cellulaire dans le froid 0,15% de saponine (en 1x PBS) et le placer sur la glace pendant 30 min.
  5. Centrifuger les cellules à 1500 g pendant 12 min à 4 ° C, retirer surnageant (qui sera de couleur rouge foncé) et remettre le culot dans du PBS froid. Répétez cette étape une fois de plus.
    NOTE: Afin de veiller à ce que les microARN présents étaient le reflet de microARN au sein des parasites, et non la contamination érythrocytaire, un certain nombre de conditions d'isolement de parasites ont été testés: 1) saponine lyse, 2) saponine lyse combiné avec un traitement RNaseA des miARN cellulaires hôtes et 3 ) méthyl-bêta-cyclodextrine traitement pour éliminer le parasite de la érythrocytaire hôte. Tous les traitements ont donné des résultats similaires.
  6. Lyse le culot parasitaire isolé en utilisant les recommandations 600 pl de tampon de lyse. Ce volume de tampon de lyse est suffisante pour cultures jusqu'à ~ 30 ml à 2% d'hématocrite et 5% de parasitémie.
    NOTE: Pour les grandes cultures de parasites, ce volume peut être augmenté. Il est important d'assurer une lyse complète du culot parasitaire par tourbillonnement complète pendant au moins 1 min. En outre, pour faciliter l'extraction, les échantillons lysés peuvent être transférées à un tube de microcentrifugation de 1,7 ml.
  7. Ajouter 60 ul, ou 1/10 de volume de tampon de lyse utilisé dans l'étape 6, l'additif d'homogénat (acétate de sodium 2 M, pH 4).
  8. Donner des échantillons sur la glace pendant 10 min.
  9. Ajouter 600 ul, ou un volume égal à la quantité de tampon de lyse ajouté à l'étape 6, de phénol chloroforme acide à chaque échantillon et vortexer pendant 1 mn.
  10. Séparer les phases aqueuse et organique par centrifugation des échantillons à 10 000 xg pendant 5 min. Cette rotation est plus longue que celle suggérée par le kit pour assurer que tous hémoglobine / hémozoïne est dans la phase organique.
  11. Recueillir le (aqueuse) couche supérieure et de la transférer dans un nouveau tube. Répétez les étapes 9 et 10 si la phase aqueuse est blanc ou (plus probablement) de couleur brune, ce qui suggère procontamination protéine.
  12. Déterminer le volume du surnageant obtenu à la pipette, puis ajouter 1,25 volumes d'éthanol à 100% (~ 800 ul) et mélanger en inversant le tube de microcentrifugation de 1,7 ml 5 fois.
  13. Passer chaque échantillon à travers une cartouche de filtre de liaison à l'ARN disponible (différent de plusieurs qui sont disponibles dans le commerce), soit par centrifugation à 14.000 g pendant 1 min ou en utilisant un collecteur à vide.
  14. Laver la cartouche du filtre avec 700 pi de la miRNA Wash Buffer 1 en utilisant une microcentrifugeuse, tournant à 14 000 g pendant 1 min.
  15. Laver le filtre avec la cartouche de 500 ul de tampon de lavage par centrifugation deux fois 2/3 à 14 000 xg pendant 1 minute chacun.
  16. Eluer l'ARN avec 100 ul d'eau DEPC, qui a été préchauffé à 95 ° C, à deux lavages de 50 ul, 14 000 xg à centrifugation pendant 1 min chacun. Mesurer la concentration de l'ARN par absorbance UV à 260 nm.
    REMARQUE: Un gel de l'ARN (soit acrylamide TBE-urée ou de gel dénaturant formaldéhyde agarose) peut be utilisée pour évaluer la distribution des tailles des ARN isolés.
    REMARQUE: Cet ARN est adapté à l'analyse par puce à ADN, de l'ARN-séquençage, transfert de Northern et de dosage de protection de ribonucléase.

2: Quantification de l'ARN de petite taille à partir de P. Au cours de l'IDC falciparum

  1. Déterminer la concentration d'échantillons individuels isolés à l'étape 1 en utilisant spectrophotométrie UV à 260 nm.
  2. Générer des amorces de PCR en temps réel pour les espèces d'ARN souhaitées. Pour miARN seul, nous avons utilisé préfabriqués dosages miARN qPCR, tandis que pour les ARNm ou fusion miARN-ARNm nous avons conçu des amorces pour SYBR vert. Pour des ARN de fusion, l'amorce sens était la séquence de miARN elle-même (miR-451: AAACCGTTACCATTACTGAGTT), tandis que l'inverse était une amorce ~ 100 pb spécifique de gène en aval du miRNA dans la séquence d'ARNm (PKA-R: ATCGAACATGCTGTGAACAT).
  3. Assurez-ADNc à partir des échantillons d'ARN en utilisant soit une amorce en épingle à cheveux pour les miARN (utiliser 20-40 ng d'ARN) seul ou hexamères aléatoires pour l'ARNm et / ou miARN-ARNm espèces de fusion (en utilisant 1 pg d'ARN). Mélanger l'ARN et des amorces pendant 5 min à 65 ° C, puis laisser refroidir à température ambiante. Ensuite, ajouter la transcriptase inverse mélange (0,5 pi transcriptase inverse, un inhibiteur de la RNase 0,5 ul, 1 ul de dNTP de 2,5 mM chacun (), 4 pi de 5 x tampon, 0,1 M de 2 ul de DTT, 1 pi de H 2 O).
    1. Échantillons exécuté sur un thermocycleur capable de détecter soit SYBR sondes vertes ou TaqMan. SYBR vert PCR quantitative 30 pour des gènes spécifiques est exécuté en tant que 3-étape de PCR, 95 ° C pendant 15 s, le plus faible température de recuit primaire moins 5 ° C pendant 30 sec, et 68 ° C pendant 30 secondes, pendant 40 cycles, en utilisant un SYBR commerciale mix master vert. miRNA-PCR en temps réel a été exécutée comme une PCR en deux étapes, 95 ° C pendant 15 s et 60 ° C pendant 1 minute, pendant 40 cycles.
    2. Quantifier les tests utilisant la méthode ΔΔCt et de normaliser contre eux soit Rab GTPase (PF08_0110) ou 18S 31.

3: Présentationde petits ARN en parasites du paludisme

  1. Pellet 300 pi de globules rouges par transfection (250 pi de globules rouges, environ 1,5 x 10 9 cellules, sera finalement utilisé) dans les médias du paludisme complète par centrifugation à 800 g pendant 5 min à frein 1.
  2. Laver les erythrocytes deux fois avec du RPMI et remettre en suspension dans CYTOMIX intégral (mM KCl 120; 0,15 mM de CaCl2, 10 mM de K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM de HEPES, pH 7,6; 2 mM d'EGTA, pH 7,6; MgCl2 5 mM; pH a été ajusté avec du KOH) à 50% d'hématocrite après centrifugation à 800 xg pendant 5 min à 1 frein.
  3. Transférer les cellules à une cuvette d'électroporation de 0,2 cm.
  4. Ajouter 10 ug, ou approprié quantité, d'oligonucléotides synthétiques personnalisé aux cuvettes et remettre les cultures.
  5. Réglez le électroporateur à 310 V / 950 pF et délivrer une impulsion à chaque cuvette.
  6. Reprendre les 300 pi de globules rouges dans le cuvette dans préchauffé mal complètearia médias et de la plaque les plaques à 24 puits et incuber à 37 ° C dans un récipient hermétique avec un mélange de gaz de sang de la malaria (3% de O 2, 5% de CO 2).
  7. Après 4 heures, infecter les globules rouges transfectées avec trophozoïtes fin synchronisées à une parasitémie finale approximative de 1%.
  8. Ajouter globules rouges fraîchement transfectées tous les 4-6 jours pour les cultures infectées et déterminer la parasitémie% par FACS en utilisant YoYo-1 coloration, comme indiqué à la section 4.

4: Détermination des érythrocytes microARN Effet Sur Parasite Taux d'infection

  1. Prenez 100 pi de la culture remis en suspension par micropipette et le placer dans un tube de 1,7 ml à centrifuger. Laver deux fois avec 1 ml de 1 x PBS et centrifugation dans une microcentrifugeuse de table par centrifugation à 800 xg pendant 5 min.
  2. Remettre en suspension le culot dans 1 ml de glutaraldéhyde à 0,025%. Incuber les échantillons pendant 20 min à température ambiante.
    Note: Les échantillons peuvent être stockés ici pendant plusieurs semaines à 4 ° C. Ensuite, le culot infecté RBC par centrifugation à 800 g pendant 5 min. Laver deux fois avec 1 ml de PBS 1x.
  3. Remettre en suspension le culot dans 1 ml de 0,015% de saponine. Incuber à 4 ° C pendant 15 min. Pellet globules rouges infectés par centrifugation à 800 xg pendant 5 min. Laver deux fois avec 1 ml de PBS 1x. Repeat.4.3. Resuspendre les cellules dans 1 ml de 1 x PBS contenant 1 ul (1,000X) ADN tache.
  4. Déterminer les degrés de la parasitémie sur un cytomètre de flux, à 488 nm excitation et ~ 530 nm (FL-1) l'émission.
  5. Premièrement, porte le cytomètre de flux basé sur FSC et SSC se concentrer sur les globules rouges. Puis mesurer les degrés de la parasitémie (les globules rouges infectés) dans la RBC fermée par fluorescence dans le canal FL-1.
    NOTE: plus tard, les parasites au stade sont 10X plus fluorescente de parasites au stade antérieures, et ~ 100X-dessus de globules rouges non infectés. En outre, la collecte à basse vitesse tend à réduire le bruit. Enfin, cette approche a été comparé à 3 H-hypoxanthine constitution et Giemsa, à la fois comme précédemment rapporté 13, et toutes les techniques GAVe des résultats similaires.

5: biotine-tagging et élution de miARN-ARNm Fusion Produits

  1. Commander directement oligonucléotides synthétiques personnalisée d'ARN avec desthiobiotine (DB) liés de manière covalente à l'extrémité 5 '.
  2. Transfecter hématies non infectées avec desthiobiotine-conjugué (DB) miARN et non modifiée miARN (contrôle négatif), comme indiqué à l'étape 3.
  3. Infecter les globules rouges transfectées avec P. falciparum parasites à une parasitémie de départ de 0,5% (étape 1.1).
  4. Extraire l'ARN parasite 4 jours (96 h) plus tard comme décrit ci-dessus à l'étape 1.
  5. Incuber 10 ug d'ARN du parasite avec 50 ul emballés billes de streptavidine, ajouté au moyen d'une micropipette, et tourner sur un dispositif de rotation de tube de microcentrifugation pendant 1 heure à 4 ° C.
  6. Pellet les perles à 800 g pendant 30 sec et laver avec 20 mM de KCl et 1 / 1.000 RNase Inhibitor.
  7. Eluer ARN à partir des billes par compétition avec la biotine et 2 mM avec 200 pi de tampon d'élution de l'ARN capture (20 mM de KCl, 1.1, 000 RNase Inhibitor et 2 mM de biotine) à 4 ° C pendant une nuit avec rotation.
  8. Déterminer le degré d'enrichissement du indiqué P. transcriptions falciparum utilisant SYBR vert qRT-PCR, et l'enrichissement de microARN (contrôle positif) par TaqMan qPCR comme indiqué à l'étape 2.

6: Séparation polysome pour déterminer les ribosomique Occupation de P. falciparum

  1. Placer solution de saccharose à 5 ml de 15% (400 mM d'acétate de potassium, l'HEPES de potassium 25 mM, pH 7,2, acétate de magnésium 15 mM, 200 uM de cycloheximide, DTT 1 mM, PMSF 1 mM, 40 U / ml d'inhibiteur de RNase, et de 15% de saccharose ) dans un tube d'ultracentrifugation SW41 (14 x 89 mm).
  2. L'utilisation d'une seringue de 5 ml, ajouter une solution de saccharose à 5 ml de 50% (400 mM d'acétate de potassium, l'HEPES de potassium 25 mM, pH 7,2, acétate de magnésium 15 mM, 200 uM de cycloheximide, DTT 1 mM, PMSF 1 mM, 40 U / ml de RNase inhibiteur, et 50% de saccharose) sous le saccharose 15% en utilisant une aiguille d'acier de long, puis retirer l'aiguille.
  3. Après 2 h, incliner lentement le tube dos droit et de transférer le tube à la glace, la laisser refroidir pendant au moins 15 min avant le chargement des échantillons (étape 14).
  4. Recueillir la culture assez de stade sanguin infecté par le Plasmodium pour générer 100-500 ug d'ARN total, soit environ 100 ml d'une culture asynchrone à 3-5% de parasitémie. Ajouter 1/10 ème de ce volume de milieu de culture contenant 10x (2 mM) cycloheximide (CHX) et incuber à 37 ° C pendant 10 min.
    1. Cultures pellets par centrifugation à 500 g pendant 7 minutes avec la centrifugeuse (frein 1), puis laver deux fois avec la température ambiante 1x PBS contenant 200 uM CHX. Reprendre les cultures de parasites dans 1x PBS contenant 200 uM CHX et de les stocker sur la glace.
    Estimer le volume de la pastille RBC. Ajouter du tampon de lyse (400 mM d'acétate de potassium, l'HEPES de potassium 25 mM, pH 7,2, acétate de magnésium 15 mM, 200 uM CHX, DTT 1 mM, PMSF 1 mM, 40 U / ml d'inhibiteur de RNase, 1% (v / v) de IGEPAL CA -630, et 0,5% (p / v) DOC) au culot de globules rouges à un volume final de 4,25 ml. Incuber le lysat à 4 ° C pendant 10 min tout en tournant.
  5. Transférer le lysat pour microtubes, puis centrifuger les échantillons dans une microcentrifugeuse à 16.000 xg et 4 ° C pendant 10 min.
  6. Préparer des coussins de saccharose à la pipette 1,25 ml d'une solution de saccharose à coussin froid 0,5 M (400 mM d'acétate de potassium, l'HEPES de potassium 25 mM, pH 7,2, acétate de magnésium 15 mM, 200 uM de cycloheximide, DTT 1 mM, PMSF 1 mM, 40 U / ml de RNase Inhibitor, et 0,5 M de saccharose) dans un tube d'ultracentrifugation SW55 (13 x 51 mm).
  7. Superposer avec précaution 3,75 ml de surnageant de lysat (de l'étape 7) sur le dessus du coussin de saccharose à l'aide d'une petite seringue et (~ 27) d'aiguille de jauge. Store lysat restant (~ 500 pi) à -80 ° C pour extraire les niveaux d'ARN totaux, comme indiqué à l'article 1.
  8. Charger les échantillons dans un rotor d'ultracentrifugation, pré-réfrigérés à 4 ° C, qui peut contenir 13,2 ml tubes. Centrifuger les échantillons à 366 000 x g et 4 ° C pendant 146 min.
  9. En utilisant une pipette, transférer le surnageant dans un tube conique de 15 ml. Stocker le surnageant à -80 ° C pour l'isolement de l'ARN du libre (non liée par les ribosomes) ARN.
  10. Reprendre le culot ribosome dans 500 ul de tampon de remise en suspension ribosome (400 mM d'acétate de potassium, l'HEPES de potassium 25 mM, pH 7,2, acétate de magnésium 15 mM, 200 uM de cycloheximide, DTT 1 mM, PMSF 1 mM, et 40 U / ml d'inhibiteur de RNase) par aspiration pendant 5 minutes.
  11. Centrifuger les échantillons dans une microcentrifugeuse à 16 000 x g et 4   ° C pendant 10 min.
  12. Tout en gardant le gradient de l'étape n ° 4 sur la glace, retirez le Parafilm, puis la couche attentivement la suspension ribosome sur le dessus de l'USI de gradientng une petite seringue et (~ 27) de l'aiguille de la jauge.
  13. Chargez le tube dans une ultracentrifugeuse rotor pré-réfrigérée et centrifuger les gradients chargés à 200.000 xg et 4 ° C pendant 180 minutes. Lorsque la rotation est terminée, magasin centrifugé gradients à 4 ° C jusqu'au moment de charger sur la colonne de fractionnement.
  14. Charger un tube d'ultracentrifugation vide dans la colonne de fractionnement gradient (cela peut être un tube utilisé dans un essai précédent), puis laver avec de l'eau sans RNAse pendant 5 min à 100 x 10 vitesses.
  15. Lors du lavage à l'étape 6.16, régler la sensibilité du détecteur d'absorbance UV. Une bonne sensibilité de départ est de 0,2, mais ceci peut être ajusté en court le plus tard en fonction du signal A 254 (qui varie en fonction du nombre de parasites, etc.).
  16. Une fois la sensibilité du détecteur est réglé, le signal de référence à zéro tandis que l'eau coule à travers le détecteur.
  17. Après avoir lavé le collecteur de fraction, inverser l'écoulement de fluide jusqu'à ce que les lignes sont vides puis remove le tube d'ultracentrifugation vide.
  18. Exécutez solution de saccharose à 60% à travers la colonne de fractionnement jusqu'à ce qu'il quitte l'appareil de l'aiguille.
  19. Insérez le tube contenant le premier gradient au sommet de la chambre de chargement et serrer le joint, en prenant soin de ne pas trop serrer. Ensuite, percer le fond du tube avec l'aiguille.
  20. Réinitialiser la vitesse d'écoulement du fluide à 12,5 x 10 (contrôlé par le bouton de commande de vitesse d'écoulement sur le devant de la pompe), puis réglez le collecteur de fractions automatisé pour recueillir 18 fractions de la SEC (~ 330 pi / fraction) dans des microtubes.
  21. Démarrage avant écoulement de la solution de saccharose à 60%.
  22. Lorsque la première goutte de la solution de gradient tombe dans le tube à centrifuger, commencer immédiatement à la fois la collecte de fractions et l'enregistrement en direct du signal A 254.
  23. Une fois une forte baisse est observée dans le signal A 254, correspondant à l'interface entre les solutions de saccharose à 50% et 60%, à la fois arrêter l'écoulement du fluide et A 254
  24. Stocker les fractions de gradient à -80   ° C pour une utilisation ultérieure.
  25. Inverser l'écoulement de fluide à 100 x 10 vitesse jusqu'à ce que la solution de saccharose à 60% de vide sur le tube d'ultracentrifugeuse.
  26. Si il ya des gradients supplémentaires pour fractionner, retirer le tube d'ultracentrifugation vide de la chambre de chargement et redémarrez de l'étape 6.21. Si tous les échantillons sont terminées, laver l'appareil a été effectuée dans les étapes 6.16 et 6.19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Profilage de microARN humaine globale dans P. falciparum

Les techniques présentées ici ont été utilisés pour extraire les micro-ARN à partir de parasites dans une variété de conditions. Une chose à noter est que les extractions d'ARN pour les globules rouges non infectés ont été effectués comme indiqué dans le 32, qui a souvent servi de point pour les données de microARN présentés à la fois dans cet article et l'étude originale 29 référence. Ces études antérieures ont également démontré que les érythrocytes HbSS possédaient loin des niveaux plus élevés de certains miARN, miR-451 en particulier. Les techniques indiquées ci-dessus étaient suffisants pour démontrer les changements dans l'abondance des miARN dans du HBS (HBA) ou HbSS parasites infectant. Des échantillons d'ARN ont été extraits comme indiqué ci-dessus et normalisé contre l'ARNr 18S. Échantillons parasite de HbSS globules rouges, par exemple, ne montrent une augmentation significative des niveaux de plusieurs microARN, y compris miR-451 (Figure 1). L'absorption de miARN du erythr hôteocyte est également compatible avec des études antérieures 34,35.

Transfection des érythrocytes HbAA avec miR-451 a augmenté HBAA miR-451 à des niveaux similaires à érythrocytes HbSS (Figure 1). La cytométrie en flux a ensuite été utilisé pour mesurer l'infection parasitaire, afin d'évaluer l'effet de miARN translocation sur la croissance du parasite. Sur la base de cela, les érythrocytes HbAA transfectées avec miR-451, miR-223 et miR-181a, et aussi d'un oligo ADNsb, on a examiné les effets de microARN sur la croissance du parasite. La transfection de l'ADN sb ou miR-181 n'a eu aucun effet sur ​​la parasitémie (figure 2A - D) tandis que la transfection avec miR-451 parasitémie nettement réduite, ce qui pourrait être atténué que par une co- transfection antisens miR-451 oligo.

Blocage des microARN par transfection de la 2'-O-Me microARN antisens démontré un effet réciproque. Érythrocytes HbSS, avec naturellement plus élevés miR-451 niveaux, ont été transfectées avec miR-451 antisens ou des oligonucleotides 2'-O-méthyle (figure 3). L'inhibition de miR-451 a augmenté la croissance du parasite dans les deux érythrocytes HbSS (figure 3C - F). Parasite pourcentages ont été calculés à partir d'au moins 3 transfections indépendantes, moyenne et présenté comme un facteur de changement par rapport à la croissance HbSS (figure 3F).

Capture de miARN-ARNm ARN de fusion par un essai de capture biotine

Après transfection de 5'-desthiobiotine-miR-451 (5'Db-miR-451) et 5'Db-miR-181, comme indiqué dans la section 5 méthodes, il a été déterminé que la séquence miARN observé origine avec microARN humaine. analyse qRT-PCR a indiqué que la transfection de 5'Db-miR-451 conduit à l'enrichissement de la PKA-R transcrits de fusion (figure 4).

Séparation polysome pour déterminer l'occupation ribosomal de P. falciparum

tente "> Un type A 254 trace est représentée sur la figure 5A (avec confirmation nord du contenu ARNr dans la figure 5B), avec la densité de la fraction croissante de gauche à droite sur le graphique (c.-à-fractions plus légères vers la gauche). L'initiale A 254 est très élevé en raison de l'absorbance de l'hémoglobine dans les premières fractions, mais rapidement tombe à la valeur de référence. Le premier petit pic correspond à la petite sous-unité ribosomique (40S), suivie rapidement par le second pic, qui est légèrement plus grande et correspond à la grande sous-unité ribosomique (60S). Le troisième pic, ce qui est généralement le plus grand pour P. falciparum, correspond au pic de monosome (80S). En raison de sa hauteur, le 80S doit être utilisée comme guide pour régler la sensibilité du détecteur d'UV pour les exécutions ultérieures (étape 6.17). En outre, en raison de la taille du pic 80S, il est courant pour le signal 60S à brouiller comme une "épaule" dans le début du pic de monosome, si les deux années 60 et 80signaux sont grandes.

A la suite du pic de monosome sont les pics correspondant aux polysomes. Chaque pic successive représente une fraction représentant polysomes progressivement un plus grand nombre de ribosomes (2, 3, 4, etc.). Chaque pic de polysome est également plus petit que le précédent sommet, en diminuant en hauteur par 2-3 fois avec chaque numéro de polysome successive. Essais typiques vont permettre la résolution des composés de polysomes 5-7 ribosomes, bien que la résolution de polysomes jusqu'à un 9-mère a été observé dans certains essais avec une grande quantité de matière de départ. Polysomes d'ordre supérieur composent le reste de la trace, et ne peuvent pas être résolus dans ces conditions de gradient.

Figure 1
Figure 1: miR-451 sont élevés dans les érythrocytes HbSS intraparasitaires miR-451 niveaux, comme déterminé par PCR en temps réel et normalisé à l'encontre de l'ARNr 18S, de parasites isolés à partir de l'indication.types d'érythrocytes. Les valeurs sont la moyenne ± SE.

Figure 2
Figure 2: La surexpression de miR-451 dans les érythrocytes normale inhibe la croissance du parasite (A - C) parcelles de FACS représentatifs indiquant les taux d'infection, comme un pourcentage du total RBC, sont indiqués par m1, pour les types d'érythrocytes indiqués.. (D) les taux d'infection composites dérivés de FACS et normalisées contre la non transfectées HBAA globules rouges. Valeurs en AC du panneau sont FACS représentatifs parcelles tout en D est moyenne ± SE.

Figure 3
Figure 3:. L'inhibition de miR-451 dans les érythrocytes de drépanocytose élève la croissance du parasite (A - E) FACS représentatifs parcelles indiquant les taux d'infection, comme un pourcentage du total RBC, sont indiquées par M1, pour l'ER montrétypes ythrocyte. (F) les taux d'infection composites dérivés de FACS et tracées comme une valeur normalisée contre les non transfectées HBAA globules rouges. Les valeurs dans le panneau AE sont FACS représentatifs parcelles, F est moyenne ± SE.

Figure 4
Figure 4: La transfection de miR-451 enrichit pour PKA-R transcrits de fusion et montre que le miRNA fusionné est érythrocytaire origine enrichissement des desthiobiotine conjugué miARN-ARNm fusion transcriptions indiquées qui ont été capturés par la streptavidine.. Les valeurs ont été mesurées en utilisant une PCR en temps réel et tracés en valeur relative par rapport à des parasites non transfectées. Les valeurs sont la moyenne ± SE.

Figure 5
Figure 5:. Ribosomes parasitaires peuvent être isolées par gradient de saccharose (A - B) Exemple trace d'un profil de polysomes extrait de Plasmodium falciparum. (A) Trace d'un profil de polysome extrait de Plasmodium falciparum, avec les 40S, 60S, 80S et les pics polysome (avec #s indiquant le nombre de ribosomes associés) affichée. (B) de Northern blot de rARN 18S et 28S à travers les fractions ribosomales. Les valeurs sont la moyenne ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HbS est l'un des variants de l'hémoglobine les plus communs dans les zones d'endémie du paludisme, en grande partie parce qu'elle offre une protection contre le paludisme grave causée par P. falciparum. Les techniques nécessaires pour caractériser le rôle des microARN humaine dans la régulation des gènes de P. falciparum sont détaillées tout au long de ce manuscrit. En extrayant l'ARN total dans une manière à inclure tous les petits ARN, et en effectuant une procédure de lyse parasite relativement simple, ces ARN de fusion ont pu être identifiées par une variété de techniques indépendantes.

Ces mesures sont relativement simples, mais sont sensibles aux problèmes et à la contamination si pas suivi correctement. Au cours de l'extraction du parasite, il est essentiel d'effectuer la lyse de la saponine contaminant pour éliminer les érythrocytes de l'hôte. Ceci est particulièrement vrai lors de l'étape de lyse de la saponine l'isolement de l'ARN. Le composant de l'hôte miRNA globules rouges est de plusieurs ordres de grandeur grand que celle du parasite, due en partie à la plupart des globules rouges étant non infecté, il est donc essentiel d'éliminer autant que possible la contamination érythrocytaire. Il est également important de maintenir la culture du paludisme dans une étape saine et correcte (si un point spécifique dans le cycle de l'infection est nécessaire) afin d'obtenir un profil précis miARN. De même, lors de l'extraction phénol-chloroforme, il est extrêmement important pour vous assurer que les phases aqueuses sont claires et, sinon, répéter l'extraction phénol-chloroforme pour éviter toute contamination restante.

En outre, dans l'expérience de capture desthiobiotine, il est essentiel pour éluer avec un excès de biotine et d'utiliser le minimum de billes de streptavidine, de manière à assurer l'élution spécifique appropriée. L'élution des ARN liés par compétition avec de la biotine, plutôt que de dénaturation complète des perles elles-mêmes, a permis de réduire considérablement l'enrichissement de l'ARN de fond. Enfin, l'expérience desthiobiotine de capture a été mis en évidence uns un moyen important de démontrer comment ces miARN ont été capturés, mais plusieurs autres techniques ont également été utilisés dans les études antérieures pour démontrer ces ARN de fusion, tels que les transferts de Northern et des tests de protection de ribonucléase 29. De tels procédés d'utilisation des microARN transfectées pour récupérer les transcrits modifiés peuvent avoir une application plus large, tel que la purification de complexes protéiques associés qui peuvent médier le transport et le traitement des miARN transfectées.

Bien que différentes approches de l'ensemble du génome ont été utilisés pour étudier le protéome du paludisme et du transcriptome 22-25, il existe quelques méthodes à l'échelle mondiale examinent régulation de la traduction dans P. falciparum 21,26. Cette limitation méthodologique exclut l'analyse globale de la régulation de la traduction dans P. falciparum. Une des approches expérimentales les plus courantes pour étudier la régulation de la traduction est polysome profilage, qui évalue la traduction globaleal activité basée sur les ribosomes chargés sur les ARNm spécifiques d'intérêt. Détaillée dans ce manuscrit est une méthode de profilage de polysome optimisé pour une utilisation dans des parasites du paludisme qui lyse des érythrocytes infectés à la fois et le parasite à l'intérieur. Les méthodes précédentes ne récupèrent pas la majorité des polysomes et fait paraître comme si les parasites du paludisme ne disposent pas d'importantes populations de polysomes. L'utilisation d'un tampon de lyse avec une forte concentration d'acétate de potassium et de magnésium a permis de lyser les cellules et les parasites des globules rouges tout en solubilisant les ribosomes liés à la membrane pour permettre la capture de polysomes intactes.

Cette méthode rentable de purification ribosomique et le profilage aidera à combler l'écart dans les connaissances existantes entre le transcriptome du paludisme et du protéome et de permettre l'analyse du génome entier de l'état de translation de P. falciparum. Cette approche a été utilisée pour comparer l'état de la traduction du début et de la fin de l'étape bstade de lood parasites 28, qui ont coordonné étroitement l'expression des gènes. Les données sur la charge ribosomique de transcrits peuvent être facilement obtenus et analysés afin de déterminer la densité des ribosomes sur les ARNm spécifiques. En outre, lorsqu'il est combiné avec la synchronisation de sorbitol, les changements dans la densité ribosomique peuvent être utilisés pour établir la manière dont la traduction est régulée au cours du cycle de vie du parasite. Isolement des ribosomes en utilisant cette approche nécessite une grande quantité de culture, ce qui limite malheureusement les étapes du cycle de vie du paludisme dans laquelle elle peut être réalisée. La grande quantité de matériau d'entrée est également limiter son utilisation à la fois des souches de laboratoire in vitro de Plasmodium falciparum, et peut limiter son applicabilité à d'autres organismes infectieux. Toute personne utilisant cette procédure sera également en mesure de dépister les gènes qui montrent des profils de traduction inhabituels, dans les transcriptions particulières qui ne sont pas associés aux ribosomes, reflétant des modes alternatifs de régulation des gènes. Finalement,cette approche nous permettra d'évaluer comment les nouveaux agents antipaludiques affectent la traduction des protéines et d'identifier les mécanismes de résistance aux médicaments à base de la traduction. Ce pipeline a une grande utilité dans l'identification et la détermination de la régulation post-transcriptionnelle dans de nombreux systèmes expérimentaux.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics