Isolation des fractions de sous-nucléaire réplication virale Compartiment enrichies d'adénovirus-infectés cellules humaines normales

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Les adénovirus contiennent un génome d'ADN double brin qui se réplique dans le noyau de la cellule infectée. Quand l'ADN viral entre dans le noyau, il se localise à proximité de corps nucléaires PML 1. Après l'expression du gène précoce virale, l'architecture nucléaire est considérablement réorganisé, induire la formation de micro-environnements virales, appelées compartiments de la réplication virale (RC) 2. Depuis adénovirus (Ad) RC sont des sites où la réplication du génome viral et l'expression des gènes tardifs viraux ont lieu, ils fournissent un environnement pour le recrutement de tous les facteurs viraux et cellulaires nécessaires qui participent à ces processus. Fait intéressant, une variété de protéines cellulaires responsables de la réponse antivirale cellulaire, tels que la réponse aux dommages de l'ADN, la réponse immunitaire innée et la suppression tumorale sont co-voulu ces sites virales 2. Hubs réglementaires Ainsi, Ad RC peut être considérée comme favorisant la réplication virale efficace tout en régulant de façon concomitante de laréponse antivirale cellulaire, ce qui indique que ces structures jouent un rôle clé pour la compréhension des interactions cellulaires hôte-virus. Néanmoins, les mécanismes moléculaires de la formation RC, leur composition et les activités connexes sont mal comprises.

Adénoviral RC, RC ainsi que d'autres virus à ADN qui se répliquent dans le noyau ne sont pas associées à des membranes, par opposition à 3 RC cytoplasmique. De plus, ces structures induites par des virus sont susceptibles d'être entièrement composée de protéines et d'acides nucléiques. RC formé dans les cellules infectées par des virus à ARN (généralement appelé usines virales) ont été isolés, profitant de leur localisation cytoplasmique et le statut lié à la membrane, ce qui a facilité leur morphologique détaillée, la caractérisation fonctionnelle et biochimique 4.

À notre connaissance, RC virale nucléaire n'a pas été isolé, peut-être en raison de la complexité de l'architecture nucléaire et l'absence de m intranucléaireembranes qui faciliteraient leur isolement. Leur étude a misé plutôt sur la microscopie par immunofluorescence, FISH et microscopie électronique en transmission. Cependant, malgré les complications inhérentes à isoler les structures subnucléaires, d'autres domaines nucléaires tels que nucléoles et corps de Cajal ont été isolés avant 5,6. Depuis nucléoles et RC sont toutes deux composées de protéines et acides nucléiques, et ont un diamètre compris entre 0,5 - 5 um, nous avons supposé que RC doit aussi se prêter à l'isolement. Par conséquent, afin de caractériser plus précisément la composition moléculaire et les fonctions associées à RC, nous avons établi une nouvelle méthode pour isoler des fractions subnucléaires enrichis en RC. À cette fin, nous avons préparé des fractions de sous-nucléaire en utilisant des gradients de vitesse et des coussins de saccharose similaires aux procédures utilisées pour isoler nucléoles 7 ou d'autres domaines nucléaires 6 et établi un système exempt de cellules qui permet l'étude de la composition moléculaire et activités associésRC. Cette technique devrait donc progresser la compréhension des interactions cellulaires virus-hôte et représente un outil puissant qui devrait également faciliter l'analyse détaillée du RC d'autres virus qui se répliquent dans le noyau et induire la formation de compartiments de réplication de dimensions similaires à celles formées dans adénovirus -cellules infectées, comme les virus de l'herpès, papillomavirus, ou polyomavirus.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF Culture cellulaire et Ad-infection

  1. Propager le virus wt Ad5 dans des monocouches de cellules HEK-293 et que les unités formant titre fluorescentes (FFU) sur les cellules HFF 8 comme décrit précédemment.
  2. Cultiver des fibroblastes humains (HFF prépuce) dans 10 ml de DMEM / 10% de sérum bovin fœtal (FBS) dans des plats de culture de 100 mm stériles à 37 ° C et 5% de CO2 dans un incubateur humidifié. Déterminer le nombre de cellules en utilisant une chambre de Neubauer en comptant les cellules dans les quatre ensembles de 16 carrés. Le nombre de cellules par ml est obtenue en calculant le nombre moyen de cellules dans les quatre séries de 16 carrés et en multipliant ce nombre par 10 4. Pour chaque post-infection de temps inclus dans l'étape 1.3, utilisez 1 x 10 7 cellules HFF.
  3. Mock-infecter ou infecter les cellules HFF avec l'adénovirus de type 5 (Ad5) de type sauvage (WT) (H5pg4100 8) dans des boîtes de culture de tissu de 100 mm en utilisant 1 ml de Ad5 dans DMEM par plat à une MOI de 30 focus Unité Formant ou FFU , par cellule. Incuber pendant 2 h en Ahumidified incubateur de culture cellulaire à 37 ° C et 5% de CO 2, à bascule avec soin les plats toutes les 15 minutes afin d'assurer une répartition homogène de l'inoculum de virus sur les cellules. Après ce temps, sortez le moyen et ajoutez DMEM frais complété avec 10% de FBS et incuber pendant 16, 24 ou 36 heures dans un incubateur humidifié de culture de cellules à 37 ° C et 5% de CO 2. Passez à l'étape 2.1.

2. Préparation des fractions de sous-nucléaire Enrichi en adénovirus RC

  1. Récolte Ad5-infecté ou cellules HFF pseudo-infectées avec un racloir de cellules et de recueillir les cellules dans des tubes de centrifugeuse stériles. Déterminer le nombre de cellules comme dans l'étape 1.2. Utilisez 1 x 10 7 cellules pour chaque post-infection de temps spécifiée dans l'étape 1.3.
  2. Centrifuger les cellules à 220 xg, 4 ° C pendant 5 min.
  3. Remettre en suspension le culot cellulaire dans du PBS glacé (NaCl 137 mM, KCl 2,7 mM, 10 mM de Na 2 HPO 4 et 1,8 mM de KH 2 PO 4). Laver culot cellulaires 3 fois à l'aide de 5 ml de PBS glacé par lavage. A cet effet, centrifuger les cellules à 220 xg, 4 ° C pendant 5 min, décanter et jeter le surnageant (SN), et remettre le culot cellulaire par pipetage doux.
  4. Pour interrompre la membrane plasmique, remettre en suspension le culot cellulaire dans 700 ul de tampon hypotonique glacé (10 mM de HEPES pH 7,9, 10 mM de KCl, MgCl 1,5 mM de 2, 0,5 mM de DTT, 20 μ g / ml fluorure de phénylméthylsulfonyle (PMSF) un mélange de la cystéine, la sérine, les inhibiteurs de thréonine et aspartyl protéase comprenant 10 μ g / ml inhibiteur de trypsine pancréatique bovine, 10 μ g / ml de pepstatine A et 10 μ g / ml N-acétyl-L-leucyl-L-leucyl-L -argininal) et laisser les cellules gonflent sur la glace pendant 3 heures.
  5. Lyse des cellules en utilisant un homogénéisateur avec une ample Un pilon type de téflon. Effectuez 80 dounce coups et des échantillons de surveiller chaque 20 coups par microscopie à champ clair pour assurer que toutes les cellules ont été lysées, mais que les noyaux ont not été endommagé ou rompu.
  6. Centrifuger l'homogénat de cellules à 300 g, 4 ° C pendant 5 min. Rangez la SN que la fraction cytoplasmique à -20 ºC dans un tube de centrifugeuse.
  7. Pour éliminer les débris cellulaires à partir de noyaux, remettre en suspension le culot dans 750 μ l de solution 1 (S1) (0,25 M de saccharose, 10 mM de MgCl2 à 20 pg / ml PMSF, un mélange de cystéine, la sérine, les inhibiteurs de thréonine et aspartyl proteases, y compris 10 μ g inhibiteur / ml pancréatique bovine par la trypsine, 10 μ g / ml de pepstatine A et 10 μ g / ml N-acétyl-L-leucyl-L-leucyl-L-argininal) et la couche sur un volume égal de solution 2 (S2) (0,35 M de saccharose, mM MgCl 0,5 2, 20 μ g / ml de PMSF, un mélange de cystéine, la sérine, les inhibiteurs de thréonine et aspartyl proteases, y compris 10 μ g / ml inhibiteur de trypsine pancréatique bovine, 10 μ g / ml de pepstatine A et 10 μ g / ml N-acétyl-L-leucyl-L-leucyl-L-argininal). Centrifuge à 1400 xg, 4 ° C pendant 5 min.
  8. Jeter le SN utilisant une micropipette. Éviter de perturber le culot.
  9. Remettre en suspension le culot contenant des noyaux isolés dans 750 μ l de S2.
  10. Pour isoler des fractions subnucléaires enrichis par l'adénovirus RC (RCF), remises en suspension Soniquer noyaux avec un bain à ultrasons, utilisant deux impulsions 5 min, ou jusqu'à ce que tous les noyaux sont lysées comme observé par microscopie à champ clair. Utilisez de la glace dans le bain à ultrasons que nécessaire pour conserver les échantillons à ou inférieure à 4 ° C.
  11. Couche les noyaux traités aux ultrasons sur un volume égal de solution 3 (S3) (0,88 M de saccharose, 0,5 mM de MgCl2) et centrifuger à 3000 xg, 4 ° C pendant 10 min. Stocker le 1,5 ml surnageant comme la fraction nucléoplasmique (NPL) à -70 ºC. Reprendre le culot dans 700 μ l de S2 et magasin comme RCF à -70 ºC.

3. Les analyses Western Blot de RCF

REMARQUE: Pour l'analyse Western Blot de NPL et RCF fractions set côté 640 ul de NPL et 300 μ l pour RCF du volume total obtenu à l'étape 2.11.

  1. Mélanger 15 μ l de chaque fraction dans subnucléaire 2x tampon de Laemmli (SDS 4%, 20% de glycerol, 10% 2-mercaptoethanol, 0,004% de bleu de bromophénol, 0,125 M de Tris HCl pH 6,8) et à 95 ° C bouillir pendant 5 min. Charger les échantillons dans une électrophorèse sur gel de dodécyl-sulfate-polyacrylamide de sodium à 10% (SDS-PAGE) et gel dénaturant les protéines séparées pendant 1,5 heure, à 20 milliampères (mA).
  2. Transfert protéines par électrotransfert pendant 1,5 heure à 400 mA sur polyvinylidène (PVDF) membranes.
  3. Bloquer membrane pendant 2 heures à la température ambiante en utilisant du lait en poudre écrémé 3% dans PBS.
  4. Incuber O / N à 4 ° C avec un anticorps primaire contre ADN viral liaison aux protéines E2A (B6-8 9) à une dilution de 1: 500 dans le lait sec PBS / 0,3% sans matières grasses.
  5. Membrane Laver 3 fois avec du PBS / 0,1% de Tween 20 pendant 10 minutes.
  6. Incuber la membrane avec un anticorps de souris anti IgG secondairetibody couplé à la peroxydase de raifort (HRP) à une dilution de 1: 10000 dans du PBS pendant 2 heures à température ambiante.
  7. Laver la membrane 3 fois avec du PBS / 0,1% de Tween 20 pendant 10 minutes.
  8. Développer la membrane en utilisant chimioluminescence amplifiée et les films X-ray.

4. ADN viral Détection RCF

REMARQUE: Pour l'isolement de l'ADN des deux fractions NPL et RCF, utiliser 210 μ l pour Npl et 100 μ l pour RCF du volume total obtenu à l'étape 2.11.

  1. Incuber sous-fractions nucléaires pendant 1 heure à 55 ° C avec 1 mg / ml de protéinase K et 0,5% de Tween 20.
  2. Inactiver la proteinase K en faisant incuber les échantillons pendant 10 min à 95 ° C.
  3. Centrifuger les échantillons à 20 000 x g, à température ambiante pendant 2 min.
  4. Recueillir le SN. Précipiter l'ADN avec 1/10 de volume de 3M acétate de sodium et un volume d'isopropanol, O / N à 4 ° C.
  5. Centrifuger les échantillons à 20 000 x g, à température ambiante pendant 10 min.
  6. Jeter le u SNchanter une micropipette. Laver le culot avec de l'éthanol 70% et centrifuger à 20 000 xg, 4 ° C pendant 5 min.
  7. Remettre en suspension l'ADN dans 10 μ l de 10 mM Tris-HCl pH 7,4
  8. Quantifier l'ADN en utilisant un spectrophotomètre en mesurant la densité optique (DO) à 260 nm.
  9. Pour amplifier l'ADN viral, en utilisant 100 ng d'ADN de chaque fraction subnucléaire dans une réaction de PCR standard en utilisant l'ADN polymerase Taq dans 25 μ l de volume de réaction avec des amorces qui permettent l'amplification d'une région à l'intérieur de l'unité de transcription tardif majeur, du nucléotide 7273 de nucléotide 7353 (81 pb) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Utiliser les conditions suivantes du cycle: la dénaturation initiale pendant 3 min à 95 ° C, suivi par 20 cycles d'amplification (1 min à 95 ° C, recuit pendant 1 min à 62 ° C et l'extension de 30 secondes à 72 ° C) et une étape d'extension finale pour 3 min à 72 ° C.
  10. Exécutez le produit de PCR dans 2% des gels d'agarose, à 90 V. Stain avec éthidiumbromure à 0,5 μ g / ml concentration finale et visualiser l'ADN pour corroborer l'enrichissement de l'ADN viral dans le RCF. Manipulez le bromure d'éthidium avec une extrême prudence et assurez-vous toujours de porter des gants, que ce composé est un agent mutagène puissant. Eliminer le bromure d'éthidium selon les directives institutionnelles.

5. tardifs viraux ARNm Détection RCF

REMARQUE: Pour l'isolement de l'ARN à partir des deux fractions NPL et RCF, utiliser 640 μ l pour Npl et 300 μ l pour RCF du volume total obtenu à l'étape 2.11.

  1. Isoler l'ARN à partir des fractions en utilisant subnucléaires Trizol selon les instructions du fabricant. Reprendre l'ARN dans 50 μ l de DEPC (diethilpyrocarbonate) imprégnées d'eau.
  2. Quantifier l'ARN en utilisant un spectrophotomètre pour mesurer la DO à 260 nm (on obtient environ 3 μ g). Stocker l'ARN dans 50 ng / ul aliquotes à -70 ºC.
  3. Vérifiez ARN purifiél'absence de contamination de l'ADN en effectuant une réaction de PCR de contrôle en l'absence de transcriptase inverse (RT), en utilisant 5 ng d'ARN total et les conditions de cycle décrites à l'étape 4.9.
    1. Si la contamination de l'ADN est absent ne amplicon doit être produite. En cas de contamination de l'ADN est présent, les échantillons incuber avec 10 U de DNase I, 10 U d'inhibiteur de RNase, 0,1 M de Tris-HCl pH 8,3, 0,5 M de KCl et 15 mM de MgCl2 pendant 30 minutes à 37 ° C. Passez à ré-isoler l'ARN comme dans l'étape 5.1.
  4. Pour analyser l'ARNm viral associé aux FCR, amplifier 100 ng d'ARN à partir de chaque fraction subnucléaire par RT-PCR en utilisant des amorces conçues pour détecter l'ARNm tardif adénoviral de différentes familles de gènes (tableau 1).
    1. Pour la transcription inverse (RT), en utilisant 100 ng d'ARN, à partir de chaque fraction subnucléaire dans une réaction RT standard en utilisant M-MuLV RT enzyme dans 20 μ l de volume de réaction pendant 1 h à 42 ° C et 10 min à 70 ° C.
    2. Pour l'amplification, utilisez 1μ l de l'ADNc dans des réactions de PCR, comme à l'étape 4.9. Utiliser les conditions suivantes du cycle: la dénaturation initiale pendant 3 min à 95 ° C, suivi par 25 cycles d'amplification (1 min à 95 ° C, recuit pendant 1 min à la température indiquée dans le tableau 1 et l'extension de 30 secondes à 72 ° C) et une étape d'extension finale pendant 3 min à 72 ° C.
  5. Exécutez les produits de RT-PCR dans 2% des gels d'agarose, à 90 gels V. tache avec du bromure d'éthidium à 0,5 μ g / ml concentration finale et de visualiser à corroborer association virale fin de l'ARNm du RCF. Manipulez le bromure d'éthidium comme indiqué dans l'étape 4.10.

6. immunofluorescence Visualisation de RCF

REMARQUE: Carry-out cette procédure sous une hotte à flux laminaire pour éviter la contamination des échantillons avec les particules de poussière, et de filtrer toutes les solutions avant utilisation.

  1. Spot 5 ul de la fraction RCF obtenu à l'étape 2.10 désastreusecte sur une lame revêtue de silane.
  2. Laissez la tache sécher pendant environ 5 min à température ambiante.
  3. Réhydrater par lentement et indirectement pipetage 500 μ l de PBS dans une goutte à côté de la place RCF et laisser couler en inclinant la diapositive. Égoutter l'excès de PBS sur le côté.
  4. Bloc en recouvrant l'échantillon avec 500 μ l de PBS / 5% de sérum albumine bovine (BSA) pendant 2 h à température ambiante.
  5. Laver la lame 3 fois par doucement et indirectement pipetage 500 μ l de PBS sur l'échantillon. Inclinez la glissière pour évacuer l'excès de PBS.
  6. Incuber l'échantillon avec un anticorps primaire contre E2A liaison à l'ADN viral de protéine (B6-8 9) à une dilution de 1: 500 dans du PBS pendant 2 heures à température ambiante. Couvrir l'échantillon tacheté de 20 μ l de la solution d'anticorps et incuber dans une chambre humide pour éviter le séchage.
  7. Laver l'échantillon 3 fois avec du PBS / 0,02% de Tween 20 et indirectement par doucement pipetant 500 μ l de PBS sur l'échantillon. Inclinez la glissière pour évacuer l'exsolution de lavage de processus.
  8. Incuber les échantillons avec un anticorps secondaire anti- IgG de souris couplé à un fluorophore qui est excitée à 488 nm à une dilution de 1: 2000 dans du PBS, pendant 1 heure à 4 ° C. Couvrir l'échantillon tacheté de 20 μ l de la solution d'anticorps et incuber dans une chambre humide pour éviter le séchage.
  9. Laver l'échantillon 3 fois avec du PBS / 0,02% de Tween 20 et indirectement par doucement pipetant 500 μ l de PBS sur l'échantillon. Inclinez la glissière pour évacuer la solution de lavage en excès.
  10. Couvrir l'échantillon repéré sur la diapositive avec une lamelle en utilisant 2 μ L PBS / 10% du glycérol comme milieu de montage. Sceller avec du vernis à ongles transparent et al magasin -20 ºC.
  11. Analyser les échantillons en utilisant un microscope à fluorescence, avec un objectif 63x et un 1.4 Ouverture numérique (NA) à une longueur d'onde de 488 nm.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Étant donné que les compartiments de replication virale (RC) sont des structures virales induites subnucléaires composées de protéines et acides nucléiques, similaire à d'autres domaines nucléaires, ils se sont avérés être prête à l'isolement par des gradients de vitesse sur la base des caractéristiques biochimiques. Les étapes critiques dans le protocole de fractionnement sont illustrés dans la Figure 1. A chaque étape les échantillons doivent être surveillés par microscopie en champ clair d'assurer l'intégrité des différentes fractions sub-cellulaires. Par exemple, lorsque le gonflement des cellules, le temps d'incubation dans le tampon hypotonique doit être normalisé afin de gonfler le cytoplasme en évitant d'endommager les noyaux. Après homogénéisation des cellules, des noyaux intacts, exempte de composants cytoplasmiques, notamment les membranes du réticulum endoplasmique, doivent être obtenus. En outre, le temps de traitement aux ultrasons doit être normalisée afin de rompre la membrane nucléaire de toutes les cellules sans perturber RC.

Après l'obtention des fractions de sous-nucléaire, cléles contrôles doivent être inclus pour déterminer l'association et à l'enrichissement de marqueurs de bonne foi de RC dans le RCF. Adénoviral RC sont couramment visualisé dans les cellules infectées par immunofluorescence en utilisant des anticorps dirigés contre la protéine virale E2A-72K (DBP). DBP est une protéine virale qui participe directement à la réplication du génome viral; par conséquent, la présence de DBP dans des particules enrichie en le RCF démontre l'association directe de cette protéine virale avec les particules isolées, comme représenté sur la Figure 1. En outre, la détection de DBP dans RCF par transfert de Western confirme l'association de cette protéine au isolé RC. Dans la figure 2, il est montré que par moments tardifs après l'infection (36 HPI), DBP est enrichi dans le RCF par rapport à la fraction nucléoplasmique (NPL), démontrant que le RC obtenu avec cette procédure à différents moments après l'infection refléter les attend temporelle modèle de DBP association RC. Un composant viral essentiel de RC est le Itse de l'ADN viralLF. Dans les expériences tel que celui représenté sur la figure 3, nous démontrons que des quantités croissantes d'viral associé d'ADN avec RCF que le cycle de réplication du virus progresse, ce qui indique que, comme pour le DBP, le motif temporel de la replication de l'ADN dans ces fractions peut également être étudiée.

En plus de contenir des protéines virales et le génome viral, RC sont également des sites d'expression des gènes viraux tard. Dans la figure 4, nous présentons des résultats représentatifs d'expériences visant à mesurer par RT-PCR au niveau de diverses espèces de la fin de l'ARNm viral et leur ségrégation entre RCF et Npl à 36 HPI. ARNm tardifs viraux sont synthétisés en RC et leur traitement postranscriptional initie à ces sites; plus tard, ces ARNm viraux dissocient de RC, sont libérés à l'nucléoplasme, et sont ensuite exportés vers le cytoplasme. La piscine total de ARNm mature fin virale (ML ARNm) a été mesurée en utilisant des amorces qui amplifient une jonction exon du leader tripartite, unséquence qui constitue l'extrémité 5 'de l'ARNm tardif adenoviral tout (figure 4A). Jonctions exon dans l'ARNm transcrits matures spécifiques de la L2, L4 et L5 familles ont également été mesurées. Il a été établi que la phase tardive du cycle de réplication virale progresse, des quantités croissantes de l'ARNm viraux fin sont exportés vers le cytoplasme; cependant, en fin de temps de production des espèces d'ARNm L5 augmente en outre en comparaison avec les autres familles fin d'ARNm. Dans les résultats représentatifs semées dans la figure 4 une différence d'environ 2,5 fois en ML ARNm est observée dans Npl rapport à RCF, comme prévu. Il est intéressant lorsque l'on compare l'ARNm provenant de familles spécifiques, à la fois L2 et L4 ARNm semblent être distribué à des niveaux similaires entre les deux fractions subnucléaires (Figure 4B et C, respectivement), alors que par contre, la L5 ARNm a montré une augmentation de presque deux fois plus Npl par rapport à RCF. Ces résultats suggèrent un modèle de différentiel dans le sy nthesis et la libération des différentes espèces virales fin d'ARNm de adénoviral RC (comme cela a été suggéré avant le 10). De manière significative, ces résultats démontrent également que des mesures précises des différentes étapes de la biogenèse de l'ARNm viral peuvent être effectuées en utilisant isolé RC avec cette nouvelle procédure.

Figure 1
Figure 1. fond clair microscopique des différentes étapes lors de la procédure de fractionnement. Pendant l'isolement de RC, les échantillons doivent être surveillés par un microscope optique pour assurer l'intégrité des fractions sous-cellulaires. La figure montre les étapes utilisées dans la procédure d'obtention de RCF, le gonflement des cellules HFF, à la séparation des noyaux et l'isolement de RCF travers coussins de saccharose. 40x micrographies: bar d'échelle de 50 μ m; 63x micrographies: bar d'échelle de 5 μ m; DBP est représenté en vert.tps: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "target =" _ blank "> S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. Western Blot contre DBP. Les échantillons sont analysés par SDS-PAGE et traitées pour western blot contre la DBP, un marqueur de bonne foi de RC virale. Pour déterminer l'enrichissement de la protéine RCF, il est utile de comparer la présence et l'abondance relative de DBP dans les deux RCF et Npl à différents moments après l'infection. Dans les cellules HFF 16 HPI représente un temps tôt au cours du cycle de réplication adénoviral; 24 hpi marque la transition à la phase tardive de l'infection en tant que synthèse d'ADN viral commence; 36 HPI représente un post-infection de temps de retard. La masse moléculaire attendu de DBP est montré. S'il vous plaît click ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. Test PCR pour détecter l'ADN viral (vDNA) dans l'ADN RCF. Été purifié à partir RCF et Npl à 24 et 36 HPI. L'ADN viral a été amplifié par PCR en utilisant des amorces spécifiques du génome viral. Le graphique montre l'enrichissement de l'ADN viral dans RCF à 36 HPI. S'il vous plaît cliquez ici pour voir une version plus grande de cette figure.

Figure 4
.. Figure 4. Analyse de l'ARNm viral tardif ARN a été isolé à partir de RCF et NPL et analysé par RT-PCR pour détecter l'ARNm viral tardif spécifique (A) ARNm tardif viral total (ML: Major Late), (B) à partir de l'ARNm de la LFamille 2; (C) à partir de l'ARNm de la famille L4; (D) à partir de l'ARNm de la famille L5. Les valeurs représentent la moyenne ± écart-type des échantillons en triple. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Nom Séquence de l'amorce avant (5'-3 ') Séquence de l'amorce inverse (5'-3 ') Température de recuit
ML ARNm GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ºC
L2 ARNm GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ºC
L4 ARNm CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ºC
L5 ARNm GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ºC

. Tableau 1. amorces utilisées pour Viral Late ARNm Amplification ML ARNm: ces amorces permettent l'amplification d'une région au sein du leader tripartite, la séquence 5 'qui est commun à tous les ARNm fin virale; Amorces L2 ARNm permettent l'amplification d'une région spécifique au sein du pV ARNm; L4 amorces permettent l'amplification d'ARNm d'une région spécifique à l'intérieur de l'ARNm de 100 K; L5 ARNm permet l'amplification d'une région à l'intérieur de l'ARNm de la fibre. Les températures de séquence et de recuit pour chaque primer sont représentés.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics