Flow-mønster Guidet Fremstilling af High-density Barcode Antibody Microarray

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne protokol beskriver fremstillingen af ​​en storstilet, multiplex todimensional DNA eller antistof array, med mulige anvendelser i cellesignalering undersøgelser og biomarkør opdagelse.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Antistof mikroarrays er ofte blevet brugt i proteomiske undersøgelser i årtier for at undersøge tilstedeværelsen af målrettede proteiner, herunder protein biomarkører 1-3. Selvom dette felt i øjeblikket står over for store udfordringer fra andre high-throughput teknologier såsom massespektrometri (MS), er der stadig masser af plads til nytten af ​​antistof microarrays, især fordi disse enheder har råd til simple data fortolkning og nem grænseflade med andre analyser. I de senere år har integrationen af microarrays i microchip stilladser billede antistoffet microarray en ny mulighed for at trives 4-7. For eksempel har stregkoden microarray integreret i en enkeltcelle-mikrochip blevet anvendt i celle kommunikation studier 8,9. Denne teknologi har markante fordele i forhold til andre tilgængelige microarray teknologi. Den er udstyret med array elementer på 10-100 um, meget mindre end den typiske 150 um størrelse, der anvendes i konventionelle microarray elements. Opførelsen af ​​mindre array elementer opnås ved hjælp af systematiske flow-mønsterdannende tilgange, og det giver anledning til kompakte mikroarrays, der kan opdage encellede udskilte proteiner og intracellulære proteiner. En anden fordel er anvendelsen af ​​en enkel, instrument-fri setup. Dette er især vigtigt, fordi de fleste laboratorier og små virksomheder ikke kan være i stand til at få adgang til microarray core faciliteter. En sådan stregkode antistof microarrays funktionen forbedret assay gennemløb og kan bruges til at udføre meget multiplex assays af enkelte celler og samtidig opnå høj følsomhed og specificitet kan sammenlignes med konventionelle sandwich enzymbundet immunosorbent assay (ELISA 8). Denne teknologi har fundet talrige anvendelser i forbindelse med afsløring proteiner fra glioblastom 9-11, T-celler 12, og cirkulerende tumorceller 13. Alternativt stregkode DNA microarrays alene er blevet anvendt i den præcise placering af neuroner og astrocytter til mimicking in vivo samling af hjernevæv 14.

Denne protokol fokuserer kun på de eksperimentelle trin og opbygge-up blokke af todimensionale (2-D) stregkode antistof microarray som har potentielle anvendelser i detektion af biomarkører i fluide prøver og i enkelte celler. Teknologien er baseret på et adresserbart enkeltstrenget, endimensional (1-D) DNA microarray konstrueret ved anvendelse af ortogonale oligonukleotider, der er mønstrede rumligt på glassubstrater. Den 1-D mønster dannes, når der anvendes parallelle strømningskanaler i strømningen-mønsterdannelsestrinnet og et sådant mønster vises som adskilte bånd visuelt ligner 1-D Universal Product Code (UPC) stregkoder. Opførelsen af en 2-D (n x m) antistof array - minder om en 2-D Quick Response (QR) matrixkode - brug for mere komplekse mønsterruller strategier, men giver mulighed for immobilisering af antistoffer på en højere densitet 8,15. Fabrikationenkræver to DNA mønsterdannende trin, med det første mønster vinkelret på den anden. Skæringspunkterne af disse to mønstre udgør n x m elementer i arrayet. Ved strategisk at vælge sekvenserne af enkeltstrenget DNA (ssDNA) anvendes i flow-mønsterdannelse, er hvert element i et bestemt opstilling tildelt en bestemt adresse. Denne rumlige henvisning er nødvendig at skelne mellem fluorescenssignaler på microarray dias. SsDNA matrix omdannes til et antistof matrix gennem inkorporering af komplementære DNA-antistof-konjugater, der danner en platform kaldet DNA-kodede antistof bibliotek (DEAL 16).

Denne video protokol beskriver de vigtigste skridt i at skabe nxm antistof arrays, som omfatter forberedelse polydimethylsiloxan (PDMS) stregkode forme, flow-mønster ssDNA i to orienteringer, forbereder antistof-oligonukleotid DEAL konjugater, og konvertering af 3 x 3 DNA-array i en 3x 3 antistof array.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Forsigtig: Flere kemikalier, der anvendes i denne protokol er irritanter og er farlig i tilfælde af kontakt med huden. Consult sikkerhedsdatablade (MSDS) og slid egnede personlige værnemidler før du udfører denne protokol. Den Piranha anvendt i trin (1.1.1) er stærkt ætsende og skal fremstilles ved tilsætning af peroxid langsomt til syren under omrøring. Håndtere denne løsning med ekstrem forsigtighed i et stinkskab. Brug passende øjenbeskyttelse og syre-resistente handsker. Trimethylchlorsilan (TMCS) er en ætsende, brandfarligt kemikalie, der anvendes i et valgfrit trin efter (1.1.6). Håndtere dette kemikalie i et stinkskab.

Bemærk: Udfør stregkoden slide fabrikation og kritiske flow-mønsterdannende procedurer i et rent rum for at minimere forurening med partikler. Støv partikler kan blokere havne og mikrokanalerne af PDMS forme og forstyrre flow-mønster.

1. Konstruktion af One-dimensionall DNA Barcode Slide

  1. Forberedelse af SU-8 master for stregkode strømningsmønstre
    Bemærk: Tegningerne til de vinkelrette strømningsmønstre (figur 1A-B) er skabt ved hjælp af en computer-aided design (CAD) software. Disse mønstre gengives på en krom fotomaske. Gennemsigtige områder af masken svarer til funktionerne i SU-8 mester.
    1. Rens en siliciumskive (100 mm i diameter) grundigt i en blanding af 3 H 2 SO 4: 1 30% H2O 2 (Piranha-opløsning) opvarmes til 96 ° C. Vask wafer med deioniseret vand og isopropylalkohol, efterfulgt af tørring med en nitrogen blæsepistol.
    2. Hæld ca. 4 ml SU-8 2025 fotoresist på waferen. Brug en programmerbar centrifugering coater til ensartet sprede fotoresist på waferen i 10 sekunder ved 500 rpm, derefter 30 sekunder ved 3000 rpm. Dette skaber et fotoresistlag med en tykkelse på ~ 25 um. Gradvist tillader spinning at bremse før du stopper - det er på Maintain en jævn belægning på skivens overflade.
    3. Bage det coatede wafer på en varmeplade i 1 min ved 65 ° C, derefter i 5 minutter ved 95 ° C. Dette trin tillader belægningen størkne. Afkøl til stuetemperatur i 5 min.
    4. Placer chrommasken (figur 1C) på fotoresist lag. Udsætte maske funktioner til nær-UV-lys (350-400 nm, eksponering energi 150-160 mJ / cm2) i 20 sek.
      Bemærk: Designet på krom maske indeholder 20 kanaler, som hver er 20 um bred med 50 um banen. Kanalerne er snoede fra den ene ende af mønstret til den modsatte ende. Sammenfattende er 20 kanaler dækker et rektangulært område med en længde på ~ 40 mm og en bredde på ~ 20 mm. Hver kanal er flankeret af to cirkulære træk, som svarer til et indløb og et udløb. Indgange og udgange er indbyrdes udskiftelige.
    5. Bag den udsatte wafer på en varmeplade i 5 minutter ved 95 ° C. Afkøl til stuetemperatur, gradvist.
    6. Fordyb wafer i SU-8 udvikler med agitationi 5 minutter. Vask wafer med en lille portion frisk SU-8 udvikler, efterfulgt af isopropylalkohol. Tør skiven ved hjælp af en nitrogen blæsepistol. Hard-bage skiven på en 200 ° C varmeplade i 30 minutter, og tillade skiven at afkøle gradvist til stuetemperatur.
      Bemærk: Udvikling kan udføres i længere tid, hvis der observeres en hvid film efter vask i dette trin.
      Valgfrit: Silanize SU-8 herre ved at udsætte den for trimethylchlorsilan damp i en lukket petriskål i 10 minutter.
  2. Fremstilling af PDMS stregkode formen
    1. Kombiner 40,0 g silikoneelastomer base med 4,0 g hærder. Rør præpolymerblandingen kraftigt i 10 min. Degas i 20 minutter under vakuum.
      Bemærk: Som hovedregel skal du bruge en 10: 1 (base: hærder) masseforhold.
    2. Hæld præpolymeren i en petriskål indeholdende en siliciumskive med SU-8 føreren af ​​stregkoden mønster. Højden af ​​PDMS blandingen bør være omkring 7,5 mm eller derover. Afgasses blandingen i PetrJeg parabol for anden gang for at fjerne eventuelle resterende bobler, derefter bage blandingen i 1 time ved 75 ° C for at tillade PDMS at helbrede.
      Bemærk: Det er vigtigt at opretholde tilstrækkelig tykkelse af PDMS pladen på ~ 7,5 mm eller derover for at undgå at fylde ret meget spænding til PDMS-glas binding ved indføring af stifter / slange gennem huller i PDMS formen i trin (1.3.3.1)
    3. Ved hjælp af en skalpel, omhyggeligt skåret omkring området af PDMS plade, der indeholder stregkode formtrækkene og skræl pladen fra skiven.
    4. Trim kanterne af pladen for at opnå den ønskede form af PDMS stregkode formen. Punch 20 huller (1,0 mm diameter) gennem formen ved hjælp af en biopsitang med stemplet. Sikre, at hullerne flugter med de cirkulære elementer i stregkoden mønster. Disse huller tjener som indløb og udløb.
  3. Endimensional mønsterdannelse af poly-L-lysin (PLL)
    1. Fjerne støv på overfladen af ​​en poly-L-lysin coatede objektglas under anvendelse af en nitrogen blæsepistol. Attach PDMS formen til den rene objektglas. Sikre, at kanterne af formen og slæden er på linie.
    2. Bages i 1,5 timer ved 75 ° C for at styrke bindingen mellem PDMS formen og PLL-coatede objektglas. Mellemtiden forbereder 20 stykker af fleksibelt polyethylenrør (3- til 4-inch stykker, med en indvendig diameter på 0,5 mm og en ydre diameter på 1,5 mm).
      Bemærk: Antallet af stykker af slangen svarer til antallet af indløb i PDMS stregkode mug. Slangen tjener til at koble kanalerne på PDMS stregkode formen til en nitrogengastank udstyret med en trykregulator.
    3. Til den ene ende af hvert stykke slange, vedhæfte en rustfri stål hul stift (1 mm i diameter). Aspirer sterilfiltreret poly-L-lysin løsning gennem stiften, indtil mindst 1 cm af slangen er fyldt med løsningen.
      1. Fastgør stifterne (forbundet til opløsningen fyldt slange) til indløbene i PDMS stregkode formen (figur 1E). Fastgør den anden ende af rørene tilet tryk-regulerede nitrogentank set-up. Lad opløsningen strømme gennem formen ved hjælp af et trykområde på 0,5-1 psi i mindst 6 timer.
        Bemærk: Se trin (1.3.3) for alle flow-mønsterdannende procedurer.
  4. Endimensional mønsterdannelse af ssDNA 14
    Bemærk: phosphatbufret saltvand (PBS), der anvendes i efterfølgende trin fremstilles ud fra 137 mM NaCl, 10 mM Na 2 HPO 4, og 2 mM KH 2 PO 4. pH af pufferen er 7,4.
    1. Forbered 2 mM bis (sulfosuccinimidyl) suberat (BS3) i PBS. Forbered 300 uM opløsninger af A, B og C ssDNA (5'-amin modificeret, 80 nukleotider) i PBS eller ultrarent vand.
      Bemærk: Brug BS3 opløsning inden for ca. 30 min efter fremstilling, fordi N-hydroxysuccinimid ester let undergår hydrolyse.
    2. Kombiner 2,5 pi 300 pM A, B eller C ssDNA med 2,5 pi 2 mM bis (sulfosuccinimidyl) suberat i PBS til hver kanal. A, B, og C-DNA er udpeget til at kanal 1, 2 og 3, henholdsvis. Denne ordre er også anvendes på de resterende sæt af 3 kanaler (figur 2A).
    3. Udfør trin (1.3.3). Denne gang, opsug de 5 pi BS3 / DNA-opløsninger gennem rustfrit stål pins og ind i polyethylenrør, derefter koble PDMS formen til nitrogenkilden. Lad BS3 / DNA-opløsning til at strømme gennem stregkode støbeform til ca. 40 min eller indtil kanalerne er fyldt.
    4. Standse strømmen, når alle kanalerne er fyldt, derefter inkubere BS3 / DNA-opløsningen i stregkoden ved stuetemperatur i 2 timer. Lad ikke den løsning, at tørre op. Bag PDMS formen med vedhæftede stregkode slide i 1 time ved 75 ° C.
      Bemærk: For at lette indstilling i efterfølgende flow-mønsterdannende trin, kan kanterne af kanalen mønster på stregkoden slide skitseres. Dette gøres ved forsigtigt at skrabe glasoverfladen ved hjælp af en diamant scribe at generere justeringsmærkerne på bunden af ​​objektglasset. Tilpasningen i senere stadier af protokollen kan kontrolleres under et mikroskop.
    5. Fjern PDMS mug fra stregkoden dias. Vask slide forsigtigt med 0,01% SDS gang og tre gange med ultrarent vand.
      1. Tør stregkoden slide anvendelse af et mikroskop slide spinner. Opbevar stregkoden slide i et rent 50 ml centrifugerør til efterfølgende anvendelse.

2. Validering af One-dimensionelle mønster på Barcode Slide

Bemærk: Denne validering protokol kan også tilpasses til brug ved vurdering af kvaliteten af ​​de efterfølgende flow mønsterdannende trin.

  1. Blokering af dias
    1. Forbered 1% bovint serumalbumin (BSA) i PBS. Filtrer denne opløsning gennem et 0,45 um sprøjtefilter inden brug. Ved hjælp af en gel-loading tip, anvendes 50 pi 1% BSA-opløsning til den ene kant af stregkoden slide.
    2. Inkubér 1% BSA solution i 1 time ved stuetemperatur.
  2. Inkubation med Cyanin 3 (Cy3) -konjugeret komplementært DNA
    1. Forbered en cocktail af A ', B' og C 'oligonukleotider konjugeret til Cy3 i den ene ende. Sekvenserne af A ', B' og C 'er komplementære til de af A, B, og C. Arbejdsmiljøet koncentration af Cy3-DNA er 0,05 um i 0,1% BSA.
    2. Fjern BSA-opløsningen fra slide ved pipettering, derefter anvende 30 pi af DNA cocktail løsning på samme kant på objektglasset. Inkubér Cy3-DNA cocktail på objektglasset ved stuetemperatur i 1 time. Udfør denne inkubationstrin i mørke for at beskytte Cy3-delen fra fotoblegning.
  3. Analyse af fluorescensintensitet
    1. Pipetteres ud Cy3-DNA cocktail og vaskes objektglasset i 1% BSA, PBS, og endelig i fortyndet PBS (1 pkunst PBS med 50 dele ultrarent vand). Tør objektglasset under anvendelse af en spinner.
    2. Observere fluorescens (figur 2B) under anvendelse af et fluorescensmikroskop eller et mikroarray scanner. Når du bruger en microarray scanner, angive laser emission bølgelængde til 532 nm, pixelstørrelsen på 5 mikron, fotomultiplikatorrør (PMT) gevinst ved 450 og magt på 15%.

3. Fremstilling af 2-dimensional (3x3) DNA Array 14

  1. Fremstilling af PDMS stregkode formen
    1. Udfør proceduren (1.1) til at konstruere en anden SU-8 mester, men denne gang bruge en chrommasken med en strømningsmønster vinkelret på denne for det første design. Udfør proceduren (1.2) til at opføre en ny PDMS form med den vinkelrette mønster.
  2. To-dimensional flow mønsterdannelse af ssDNA
    1. For en 3 x 3 matrix, forberede 150 pM stamopløsninger af A'-i, B'-ii, C'-III, A'-iv, B'-v, C'-VI, A'-vii, B'-viii og C'-ix DNA i 3% BSA / PBS. Disse oligonukleotider tjener som "bridging" sekvenser (figur 2A). Kombiner oligonucleotidopløsninger (Solutions 1 til 3), således at koncentrationen arbejdstid er 50 uM for hver oligonukleotid. Brug guide tilvejebragt i tabel 1.
    2. Flow 3% BSA / PBS blokeringsopløsning i alle 20 kanaler i 1 time ved 0,5-1 psi.
    3. Flowløsninger 1, 2 og 3 i kanaler 1, 2 og 3, henholdsvis. Følg denne ordre for efterfølgende sæt af 3 kanaler. Flow er normalt afsluttet i omkring 40 min. Inkubér DNA-opløsninger ved stuetemperatur i 2 timer for at tillade DNA til at hybridisere.
    4. Flow 3% BSA / PBS blokeringsopløsning i alle 20 kanaler i 1 time ved 0,5-1 psi for at fjerne ikke-hybridiseret DNA. Træk PDMS slab, og vask det resulterende DNA microarray slide ved at dyppe objektglas i 3% BSA / PBS gang og PBS to gange, efterfulgt af fortyndet PBS (1 del PBS og 50 dele ultrarent vand). Dry dias ved hjælp af et objektglas spinner.
    5. Udfør et andet trin validering (figur 2C) svarende til den i § 2. Brug oligonukleotider i 'IX ", der er Cy3-konjugeret. Opbevar 3 x 3 matrix dias i en 50-ml centrifugerør til efterfølgende anvendelse.
      Bemærk: DNA microarray kan opbevares ved stuetemperatur i en ekssikkator i månedsvis.

4. Omdannelse af 3 x 3 DNA array i et antistof Array

  1. Fremstilling af antistof-oligonukleotid (DEAL) konjugater
    1. Fremstille opløsninger af 200 mM succinimidyl-4-formylbenzoat (S-4FB) og 40 mM succinimidyl-6-hydrazinonicotinamide (S-HYNIC) i vandfrit N, N-dimethylformamid (DMF).
    2. Forbered op til 7 separate opløsninger af capture-antistoffer (1 mg / ml) i PBS.
      Bemærk: Hvis antistof stamopløsninger indeholder natriumazid bakteriostat, udføre buffer udveksling med PBS ved hjælp af spin-afsaltning columns med 7 kDa molekylvægt cut-off (MWCO).
    3. Forbered separate 400 uM løsninger af i «, ii ', iii', iv ', v', vi ', og vii' DNA. Tildel hver indfangende antistof til en oligonukleotidsekvens. Kombiner 40 pi 400 pM DNA med 12,25 ul DMF i mikrocentrifugerør og spin ned for at blande grundigt.
      1. Til hver DNA / DMF-opløsning tilsættes 2,3 pi 200 mM S-4FB i DMF. For hver 100 ug opfangningsantistof, tilsættes 2,25 ul 40 mM S-HYNIC i DMF.
    4. Inkubér antistof / S-HYNIC og DNA / S-4FB løsninger til 4 timer ved stuetemperatur.
    5. Som forberedelse til antistof-DNA koblingsreaktion udarbejde nye centrifugering afsaltningssøjler (en for hver DNA-opløsning og én for hvert antistof) ved at vaske dem med citratbuffer ved pH 6.
    6. Efter 4 timers inkubation, udføre buffer bytte for hvert antistof / S-HYNIC og DNA / S-4FB løsning. Kombiner S-4FB-konjugeret VII« oligonukleotider med antistoffet-S-HYNIC konjugater. Inkubér blandingerne i 2 timer ved stuetemperatur.
    7. Inkubér reaktionen O / N ved 4 ° C.
  2. Oprensning af antistof-oligonukleotid (DEAL) konjugater
    Bemærk: at oprense antistof-oligonukleotidkonjugater, udføre hurtig protein-væskekromatografi (FPLC) på en standard FPLC-system udstyret med en Superose 6 10/300 GL kolonne.
    1. Indstil bølgelængde UV-detektor af FPLC-system til 280 nm. Brug isokratisk strømning af PBS (pH 7,4) ved 0,3 ml / min for at adskille antistof-oligonukleotidkonjugater fra overskydende S-4FB-DNA.
    2. Pool fraktionerne indeholdende konjugatet og koncentreres fraktionerne til et volumen på 150 pi under anvendelse af spin-filtre med en 10 kDa MWCO.
  3. To-dimensional mønsterdannelse af antistoffer
    1. Forbered en anden PDMS form med microchambers eller mikroorganismer brønde osing fremstillingsprocedurer i trin (1.2). PDMS formen kan indeholde mikroliter til nanoliter brønde til immunoassays.
      Bemærk: For generel biomarkør opdagelse i fluide prøver, er en PDMS støbeform med flere brønde parret med array dias. Funktionerne i PDMS formen er afhængige af systemet blive undersøgt. For eksempel kan påvisning af proteiner fra encellede eksperimenter udføres med en PDMS form indeholdende microchambers med 0,15-NL mængder.
    2. (Valgfrit) Udsæt PDMS formen til plasma rengøring (18 W) i 1,5 min for at gøre sin mønstret overflade hydrofil. Før plasmarensning, bruge tape til at blokere alle andre overflader, der vil blive direkte bundet til 3 x 3 matrix slide.
      Bemærk: Trin (4.3.2) er valgfri, men er normalt udføres, når PDMS Formen er beregnet til anvendelse i encellede eksperimenter.
    3. Mate PDMS formen med 3 x 3 matrix slide, derefter blokere objektglasset med 1% BSA i PBS. Der inkuberes i 1 time ved stuetemperatur. Meanwhile, udarbejde en cocktail (200 pi slutvolumen) af antistof-oligonukleotidkonjugater. Den arbejder koncentration af hvert konjugat er 10 ug / ml i 1% BSA / PBS.
    4. Tilsæt antistof-oligonukleotid cocktail, derefter inkuberes i 1 time ved 37 ° C for at tillade oligonukleotidet delen af konjugaterne til at hybridisere med specifikke pletter på 3 x 3 arrays, for derved at omdanne DNA-array til et antistof array.
    5. Gentag trin (3.2.4) til at rense og tørre dias. Den højeste følsomhed kan opnås, hvis antistoffet array anvendes straks. Langvarig opbevaring kan resultere i tab af følsomhed.
  4. Påvisning af proteiner
    1. Rekonstituer rekombinante proteiner eller forberede et filtreret celleprøve.
    2. Mate mikroarrayet med en specialdesignet chip, og blokere overfladen med 3% BSA i PBS i 1 time. Derefter fjerne BSA-opløsningen, og anvende prøver og inkuberes i 2 timer.
    3. Vaske prøverne ved hjælp af 3% BSA i PBS tre gange, end derefter tilføje detektionsantistoffer ved en koncentration fra produktdatabladet. Der inkuberes i 2 timer.
    4. Vaske detektionsantistoffer med 3% BSA i PBS tre gange, og derefter tilføje Cyanin 5 (Cy5) -streptavidin ved 1 ug / ml, efterfulgt af inkubering i 1 time.
    5. Gentag trin (3.2.4) til at rense og tørre dias til scanning.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Motiverne for de PDMS forme (figur 1A-1B), er opstillet ved hjælp af et CAD-program (AutoCAD). To designs vist har kanaler for strømning mønster, en vandret og en lodret. De venstre og højre dele af hvert design er symmetriske; en af ​​dem kunne være indløb eller udløb. Hver af 20 kanaler vikling fra den ene ende hele vejen til den anden ende. Hvert design er trykt på en krom fotomaske (figur 1C). Den færdige SU-8 Master på en wafer er vist i figur 1D. For at lette strømmen-mønsterdannelse af PLL eller DNA blev PDMS formen koblet til en nitrogengasstrøm set-up (figur 1E).

Der er tre flow-mønsterdannende trin anvendes i denne protokol. Det første skridt immobiliserer PLL på glassubstratet, mens de efterfølgende trin både indføre oligonucleotidopløsninger. I tabel 1 oligonucleotide sammensætninger af opløsninger 1-3 er givet. Den arbejder koncentration af hvert oligonukleotid er 50 uM, og den samlede mængde af hver opløsning er 39 pi. Disse opløsninger fremstilles ved at kombinere 13 pi af hvert oligonukleotid stamopløsning (150 uM).

De mønstrede DNA microarray enheder er gentagne og støder i hele objektglasset. For 3 x 3 mikroarrays, den maksimale tæthed er omkring 400.000 pletter på en glasplade. Side-by-side sammenligning med kommercielle DNA microarray afslører, at vores teknologi er omkring 5 gange mere følsom, når binding til Cy3 mærkede komplementære DNA. Den mønstrede DNA'er er relativt ensartet med ~ 5% variation på tværs af flere gentagelser. Disse funktioner lover den høje kvantificering evne af vores teknologi ved måling proteinindhold fra biologiske prøver. Desuden ortogonaliteten af ​​DNA'er i kombination med strømningskanalen design giver flexibility af mønsterdannelse i en række geometrier (figur 2D).

Efter omdannelse af DNA array i et antistof-array ved hybridisering med DNA-antistofkonjugater (figur 3B), er den resulterende antistof-panelet i multiplekset påvisning, hovedsagelig gennem sandwich-ELISA platform som vist i figur 3C. I sandwich-ELISA, biotinylerede detektion (sekundære) antistoffer binder til de indfangede proteiner og efterfølgende mærkning med fluorofor-konjugeret streptavidin giver mulighed for fluorescens-baseret detektion (figur 3C-E). Påvisning af proteiner shows <10% variation fra den ene ende til den anden ende af objektglas (figur 3D). Med 3 x 3 matrix, er vi i stand til at påvise op til 7 proteiner, mens tildele ét array element som reference (Cy3 mærket), og et andet element som negativ kontrol. For eksempel, i en enkelt-celle-forsøg udført fortumorundersøgelser, proteinerne interleukin-6 (IL-6), matrix metallopeptidase 9 (MMP9), hepatocytvækstfaktor (HGF), vaskulær endotel vækstfaktor (VEGF), interleukin-8 (IL-8), og makrofag migration inhibitorisk faktor (MIF) fra en enkelt celle kan påvises samtidigt (figur 3E).

Vi også kalibreres systemet ved hjælp af rekombinante proteiner i forskellige koncentrationer. I figur 3F, kalibreringskurver for rekombinante proteiner interferon-γ (IFN-y), tumornekrosefaktor α (TNF a), interleukin-13 (IL-13), tumornekrosefaktor β (TNF-p), granzym B, interleukin -4 (IL-4) og interleukin-8 (IL-8) er vist. Detektionsfølsomheden er meget lig den for konventionelle sandwich ELISA på brønde selv med højere indhold af DNA'er og eventuelt antistoffer på substratet.

Stregkoden Antibody microarray kan anvendes til at påvise biomarkører i fluide prøver såvel som i enkelte celler. Da encellede analyse er ikke i fokus i denne protokol, vi simpelthen eksemplificeret anvendelsen af 3 x 3 antistof microarray til detektion af cytokiner. Gennem antistof-overflademarkør interaktioner, differentieringsklynge- 8 (CD8) -positive celler blev fanget på en af microarray elementer (figur 3G, en PDMS chip på toppen), og resten af elementerne blev anvendt til at detektere udskilte cytokiner ( Figur 3H). Med denne celle capture metode, "cell arrays" kan dannes. Dette array capture teknik giver også mulighed for kontrol over antallet af celler udsættes for hver ELISA forsøg. Cellerne blev fysisk isoleret i microchambers så de detekterede proteiner vedrørte bestemte enkelte celler. I figur 3H, er det vist, at hver mikrokammer er udstyret med 16 microarray elementer for at sikre indkapsling afen komplet 3 x 3 microarray sæt.

Figur 1
Figur 1. Design og fremstilling af PDMS stregkode forme til flow-baserede DNA-mønster. Panel (A) viser de AutoCAD-tegninger til vandrette og lodrette endimensionale stregkode mønstre. Panel (B) viser de overlejrede horisontale og vertikale stregkode mønstre fra (A). Grønne kasser omslutter områder mønstrede med diskrete 3 x 3 arrays. (C) chrommaske til fremstilling SU-8 mester. (D) SU-8 Master fremstillet på en siliciumskive. (E) Opsætning til flow mønstret. Klik her for at se en større version af dette tal.

Figur 2 Figur 2. Konstruktion og validering af en 3 x 3 DNA-array. Dette tal er blevet ændret fra "kvantificering celle-celle Interaktion funktioner med Ansøgninger til glioblastoma multiforme kræftceller" af Wang, J. et al., 2012, Nano Lett 12 . Copyright 2012 af American Chemical Society. Tilpasset med tilladelse. (A) Ordning for de DNA flow-mønsterdannende trin. (B) Fluorescensintensitet profil 20 kanaler i et udvalgt område (spores ved en lodret linje) i 1D stregkode. Cy3-konjugerede oligonukleotider blev hybridiseret med DNA-opstillinger til validering. (C) Fluorescensintensitet profil arrays valideret med Cy3-konjugeret DNA efter endt anden DNA mønster trin. (D) Alternative fluorescerende mønstre fra forskellige flow-mønsterdannende strategier. Klik her for at se en større version af dette tal.

Figur 3
Figur 3. Anvendelser af 3 x 3 microarray. (A) Scheme til syntese af antistof-oligonukleotid DEAL konjugater. (B) Ordning for omdannelsen af DNA-array i et antistof-array gennem hybridisering med antistof-oligonukleotid konjugater. (C) Ordning for anvendelse af 3 x 3 microarray i en sandwich-ELISA platform. Dette tal er blevet ændret fra "kvantificering celle-celle Interaktion funktioner med Ansøgninger til glioblastoma multiforme kræftceller" af Wang, J. et al., 2012, Nano Lett 12. Copyright 2012 af American Chemical Society. Tilpasset med tilladelse. Panel (D) viser en fluorescens udlæsning genereret under en Cy5 kanal. Det svarer til en sandwich-ELISA eksperiment, der opdages 6 proteiner. Panel (E) er et zoomet-i profil af en 3 x 3 matrix udlæsning under Cy3 og Cy5-kanaler. Panel (F) viser sandwich-ELISA kalibreringskurver for rekombinante proteiner. Panel (G) viser en "celle array" dannet ved at opfange celler gennem binding med antistoffer på arrayet. Panel (H) viser resultatet afsløring overlejret med microchambers i en mikrochip. Klik her for at se en større version af dette tal.

1
Løsning Oligonucleotid Sammensætning
A'-i, B'-II, C'-III
2 A'-IV, B'-v, C'-vi
3 A'-VII, B'-VIII, C'-ix

Tabel 1. Sammensætning af løsninger 1-3 til DNA Flow mønstring.

Forankring sekvenser
EN ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA
B GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
C GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA
Bridging sekvenser
A'-I TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA
B'-ii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA
C'-III TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA
A'-iv TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT
B'-v TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG
C'-vi TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA
A'-vii TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG
B'-viii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG
C'-ix TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATT AAGTCTGCTTCGGC
Cy3-konjugerede oligonukleotider til validering
EN' TACGGACTTAGCTCCAGGAT
B ' TAGGCATGATTCAATGAGGC
C ' TAGCGATAGTAGACGAGTGC
jeg' TACTCTGACATCTCGACCAT
ii ' TAGATACTGCCACTTCACAT
iii ' TACCGTGAACCTTACCTGAT
iv ' AATGCTGGGGAAGGCTACTC
v ' CGCACCGCAGTTTGGTCAAT
VI « TCCGACGCAACAATAGGGCA
vii ' CCTGCTCGACAACTAGAAGA
viii ' CCGCGACCAGAATTAGATTA
ix ' GCCGAAGCAGACTTAATCAC
"Fo: holde-together.within-side =" 1 "> Tabel 2. Sekvenser, der anvendes i DNA-flow-mønster.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Strømningsmønster design er den første kritiske trin ved fremstilling af 2-D microarray. At generere to overlappende DNA mønstre på et glassubstrat, bør den kanal funktioner i det første design være vinkelret på de af den anden (figur 1A-B). De designs også overveje de nedstrøms anvendelser af microarray. I tilfælde af en enkelt celleanalyse, der mikroarray anvendes til at detektere proteiner fra enkelte celler indesluttet i microchambers derfor kanaldimensionerne de gøres forenelige med de microchambers der justeres med 2-D arrays. Hvert design er gjort på en fotomaske og standard fotolitografiske teknikker anvendes til at fremstille den kanal funktioner i SU-8 på en siliciumskive (Figur 1C-D). Dette fungerer som master for støbning PDMS. Når formen er blevet fremstillet, er det bundet til et PLL-coatede objektglas og derefter kombineret med en nitrogengasstrøm set-up (figur 1E). Det set-up vianvendelse er enkel og har den fordel, at let inkorporeres i et hvilket som helst laboratorium med et tryk-regulerede nitrogengas kilde. Vi anvender en samling af billige flere 3-vejs ventiler forbundet til en nitrogengas-tank. Luftstrømmen til mønsterdannelse skal opretholdes ved lave tryk (0,5-1 psi) for at undgå delaminering af objektglas fra formen. Utætheder i PDMS formen kan kompromittere integriteten af ​​mønstrene.

DNA flow mønsterdannende trin i denne protokol anvender ssDNA med nøje udvalgte ortogonale sekvenser (figur 2A). Forud for flow-mønsterdannelse, bør de unikke sekvenser på disse oligonukleotider testes for fravær af krydstale. En simpel test for cross-talk gøres ved at ændre valideringsprocedure vi indfører i vores protokol (trin 2). I stedet for anvendelse af en cocktail af Cy3-mærket komplementært DNA, er kun én type komplementær sekvens ad gangen for et udvalgt område af objektglasset, på hvilken flereDNA-sekvenser immobiliseres. I fravær af DNA krydstale bør kun én stribe (for 1-D DNA array) eller en plet (for 2-D DNA array) være af selvlysende under en Cy3 filter. Eksempler på grundigt valideret ortogonale sekvenser kan findes i tabellen af ​​materialer og udstyr. Den første DNA mønsterdannelsestrinnet indfører tre former for "anker" oligonukleotider. Disse 80-nt-sekvenser består af to 20-mer poly-A-regioner, der veksler med to unikke 20-mer sekvenser. 5'-amin modifikation af disse sekvenser anker er nødvendig for amin-til-amin tværbindende 17 med PLL medieret af BS3. Den anden DNA mønsterdannelsestrinnet kræver ikke en tværbinder. Dette trin introducerer "bridging" oligonukleotider, der delvist hybridiserer med anker-sekvenser. Hver 60-nt bridging sekvens består af en 20-mer komplementær til et anker-sekvens, en 20-mer poly-A-spacer, og en unik 20-mer sekvens. Validering af DNA arrays (Figure 2B-C) udføres efter hver DNA flow-mønstret skridt for at vurdere kvaliteten af de mønsterdannende trin og for at sikre, at ingen krydskontaminering 14. Dette udføres ved at indføre Cy3-konjugeret oligonucleotidprober, der hybridiserer med DNA-mønstre. Med de parametre, der er specificeret i trin (2.3.2) til analyse af fluorescensintensitet bør DNA mønstre udviser fluorescensintensiteter på mindst 40.000 au at maksimere følsomheden af ​​downstream immunoassays foretaget efter den microarray. Strategisk brug af forskellige Cy3-DNA sæt under valideringen giver anledning til alternative mønstre (figur 2D), hvilket viser fleksibiliteten af DNA mønster trin 8. Manglende opnåelse af ensartede mønstre kunne skyldes utætheder eller mekaniske forhindringer (såsom støvpartikler) stødt på i de flow-mønsterdannende trin.

Udarbejdelsen af ​​antistof-oligonukleotid DEAL konjugater er endnu et afgørende skridt i ther protokol. Valget af antistoffer er dikteret af det biologiske system, der undersøges. Oligonukleotiderne, der anvendes i konjugation bør have sekvenser komplementære til dem forankret på DNA array. Stamopløsninger af S-4FB og S-HYNIC indeksobligationer skal frisklavet og holdes væk fra fugt for at undgå hydrolyse. Inkubationstiderne anvendes i vores konjugering protokollen er lang nok til at indføre de ønskede funktionaliteter på antistofferne og DNA. Den endelige koblingsreaktion kun standses ved at fjerne de uomsatte S-4FB-konjugerede oligonukleotider via FPLC. Således bør FPLC rensning udføres umiddelbart efter endt konjugation. Ved udførelse FPLC med systemet beskrevet i vores protokol, lavere strømningshastigheder (0,2-0,25 ml / min) kan også anvendes til at forbedre opløsningen. Konjugaterne elueres som en bred top (elueringsvolumen på omkring 9-15 ml), der vises, før en smallere og højere DNA peak (17-20 ml elueringsvolumen). Vi anbefaler ikke at opbevare løsningeraf konjugater med overskydende S-4FB-DNA, fordi det kan føre til tab af antigenbindingssteder i antistoffet upon konjugation med overskydende funktionaliseret DNA. Den følsomhed, specificitet og reproducerbarhed sandwich ELISA hjælp DEAL konjugater er blevet påvist i tidligere undersøgelser. 8,9,11,12,16 at vurdere kvaliteten af antistof-DNA-konjugater, kan konjugaterne inkuberes på DNA-arrays til at generere antistof array, som efterfølgende anvendes i sandwich ELISA-forsøg til at generere kalibreringskurver for protein detektion (Figur 3F). For at generere disse kalibreringskurver kan rekombinante proteiner, der er fastsat i en konventionel sandwich ELISA kit anvendes. Brugen af ​​høj kvalitet konjugater bør give anledning til lineære intervaller og lavere detektionsgrænser kan sammenlignes med dem i sættet. Som et eksempel, de nedre grænser for INFy og TNFa til sandwich-ELISA på vores antistof array (figur 3F) er ~ 50-100 pg / ml, og er konst med det lineære afsløring vifte af ~ 15-1,000 pg / ml angivet i produktet datablad for den konventionelle sandwich-ELISA-kit. Dårligt signal udlæsning opnået i downstream sandwich ELISA-forsøg kunne tilskrives den lave kvalitet af DNA array, indblanding af overskydende DNA i konjugatet opløsninger, eller alternativt, ufuldstændigt konjugering af ssDNAs med antistoffer.

Store bekymringer for udførelse af sandwich-ELISA på antistoffet vifte omfatter krydstale mellem reagenser og om signalet afspejler de virkelige biologiske hændelser. De ortogonale DNA, vi bruger i denne protokol er blevet grundigt valideret til at have mindre end 0,1% krydstale. Derfor enhver krydstale observeret ved immunoassay fase er hovedsageligt fra antistofferne og ELISA-reagenser. Test for krydstale blandt antistoffer i arrayet skal udføres før udførelse af analyser på virkelige prøver. Når et antistof panel er konstrueret, bør en par sandwich ELISA kontroleksperimenter være performed med følgende betingelser: 1. Uden antigener, 2. Uden antistoffer afsløring og 3. antistoffer Detection og kun mærkningsreagenser. Hvis krydstale er observeret ved immunoassay stadium, bør antistof par og / eller ELISA-reagenser udskiftes. Det skal bemærkes, at anvendelsen af ​​kommercielt tilgængelige antistoffer fra konventionelle ELISA kits ikke garanterer anvendelighed til array-baserede sandwich-ELISA-teknik.

Fordelene ved denne teknologi omfatter billig produktion, miniature størrelse og fleksibilitet i design. Vores fabrikation protokol behøver ikke en microarray spotter, som måske ikke være tilgængelige for mange brugere af antistof arrays. Strømmen mønsterdannelse set-up let kan samles i simple laboratorier. Til laboratorier, der ikke er udstyret med instrumenter til fotolitografi kan CAD-design, vi leverer i vores protokol sendes til virksomheder, der tilbyder microfabrication tjenester. Reduktion konventionel microarray indden kompakte matrix fremstillet med vores protokol giver mulighed for kompatibilitet med mikrochips, der anvendes i encellede eksperimenter. Vores protokol har produktionen af ​​array som et ssDNA matrix, før omdannelse til et antistof array. Indledende mønsterdannelse med ssDNAs har en række fordele. Først ssDNAs er kemisk mere stabile i forhold til antistoffer, således ssDNA-mønstret objektglas kan opbevares i en ekssikkator i mindst 6 måneder uden væsentlig forringelse 8,16. For det andet tilbyder vores tilgang en slutbruger fleksibilitet til at vælge analyserne nødvendige, ved simpelthen at blande de selektive konjugater sammen i en løsning uden ændring af microarray; Tværtimod konventionelle protein / antistof arrays er præ-designet og fastgjort på et underlag, så ændringen i assays vil kræve mønsterdannelse / trykning af proteiner / antistoffer fra begyndelsen. Repræsentative undersøgelser illustrerer anvendelsen af ​​stregkoden antistof microarray i high-throughput detection af multiple signaling proteiner fra enkelte celler. Ved at variere strømningsmønsteret design og / eller oligonukleotidet mønsterruller anvendte opløsninger, kan udforskes et væld af array-layouts. Som et eksempel på denne anvendelse, kan funktionelle proteiner fra enkelte celler undersøges. Chippen til enkelt-celle analyse omfatter så mange som ~ 8.700 microchambers, hver på linie med en komplet 3 x 3 matrix antistof (figur 3H). En sådan opsætning tillader high-throughput detektion. Proteiner udskilt af celler dyrket i microchambers kan påvises ved dette array. Den alsidige microarray design giver også mulighed for multiplekset påvisning af proteiner fra serum, cellelysater og enkelte celler efter kombination mikroarray med andre generiske komponenter 8,15. Ud over protein afsløring, 3 x 3 matrix antistof er også nyttigt i at fange celler (figur 3G).

Den største ulempe ved denne fremgangsmåde er dens ekstra komplexity sammenlignet med fremstillingen af ​​konventionelle mikroarrays. Strategier for mønster og for array design skal omhyggeligt conceptualized, mens overvejer de specifikke anvendelser af den fabrikerede array. Denne tilgang kræver også en række kritiske trin, herunder valideringsprocedurer og prøver for krydstale. De 3 x 3 matrix konstrueret ved anvendelse af vores protokol er begrænset til detektering 7 proteiner ad gangen. Imidlertid kan denne grænse overgås ved at skabe større arrays. Protokollen featured her, er ikke begrænset til fremstillingen af 3 x 3 mikroarrays. Vi har været i stand til at fabrikere 5 x 5 mikroarrays og andre dimensioner af array elementer. I princippet kan andre n x m arrays fremstilles ved anvendelse af lignende teknikker, så længe de oligonukleotidsæt anvendes til at skabe den indledende DNA-mønstrede opstilling er ortogonale for at undgå krydstale mellem array elementer. Oprettelsen af ​​udvidede arrays opnås ved flow patterning n typer af ssDNA ankre for den første DNA mønsterdannelsestrinnet, efterfulgt af n x m bridging ssDNA sekvenser for det andet mønsterdannelsestrinnet. For eksempel, for at skabe en 5 x 5 matrix, kan anker-sekvenser A til E anvendes, mens brodannende sekvenser A'-I til E'-XXV anvendes. At automatisere strømmen mønster proces har en robotteknologi platform udviklet 18, selv om det kun har udnyttet en DNA-flow mønster trin. I princippet kan den samme platform udvides til det andet trin af vinkelret flow mønster, mens skift mellem to trin kan kræve manuel skrælning fra første PDMS formen efter det første mønster trin, efterfulgt af vask og tørring af dias (dette skridt ville tage omkring 10 min), før parring objektglasset med en anden PDMS formen for at lette vinkelret orienteret andet mønsterdannelsestrinnet.

Vi har diskuteret nærmere regler for fremstilling af en nxm vifte mønstredemed antistoffer ved høj tæthed, hvilket lover godt for fremtidige anvendelser i proteomiske undersøgelser og cellesignalering. Protokollen præsenteres her kan også tjene som en vejledning til konstruktion af mere omfattende DNA / antistof arrays til andre formål.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics