Gründung der Krebszellkulturen von Human Konventionelle Osteosarkom Stem

Cancer Research
 

Summary

Das Vorhandensein von Krebsstammzellen (KSZ) in Knochensarkomen kürzlich ihrer Pathogenese in Verbindung gebracht worden. In diesem Artikel stellen wir die Isolierung des CSCS aus primären Zellkulturen aus humanen Biopsien herkömmlicher Osteosarkom (OS) mit der Fähigkeit des CSCS erhalten unter nichtadhärenten Bedingungen zu wachsen.

Cite this Article

Copy Citation | Download Citations

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die aktuellen Verbesserungen in der Therapie gegen Osteosarkom (OS) haben das Leben von Krebspatienten verlängert, aber die Überlebensrate von fünf Jahren bleibt schlecht, wenn Metastasen aufgetreten ist. Die Krebsstammzellen (CSC) Theorie besagt, dass es eine Untergruppe von Tumorzellen innerhalb des Tumors, die stielartigen Eigenschaften, einschließlich der Fähigkeit, den Tumor zu erhalten und multidrug-Chemotherapie zu widerstehen. Daher ist ein besseres Verständnis der OS Biologie und Pathogenese erforderlich, um die Entwicklung von gezielten Therapien voranzutreiben diese besondere Untergruppe zu beseitigen und die Morbidität und Mortalität bei Patienten zu reduzieren. CSCs Trenn-, Gründung Zellkulturen von CSCs, und das Studium ihrer Biologie sind wichtige Schritte, um unser Verständnis von OS Biologie und Pathogenese zu verbessern. Die Einrichtung von Menschen stamm OS-CSCs aus Biopsien von OS wurde mehrere Methoden möglich verwenden, einschließlich der Fähigkeit zu schaffen 3-dimensionalen Stammzellkulturen unter nonadherent Bedingungen. Unter diesen Bedingungen können die CSCS kugelförmige Schwimm Kolonien durch Tochterstammzellen gebildet zu schaffen; Diese Kolonien werden "Zellkugeln" bezeichnet. Hier beschreiben wir eine Methode, um CSC Kulturen aus primären Zellkulturen von herkömmlichen OS etablieren aus OS-Biopsien erhalten. Wir beschreiben eindeutig die verschiedenen Passagen erforderlich, um CSCs zu isolieren und zu charakterisieren.

Introduction

Sarkome sind eine heterogene Gruppe von seltenen malignen Tumoren Bindegewebe vorwiegend aus dem embryonalen Mesoderm 1 stammen. Die verschiedenen Typen sind Knochensarkomen und Weichteilsarkomen. Knochen-Sarkome, eine Gruppe von relativ selten Primärtumoren, bestehen aus mehreren Subtypen, einschließlich Osteosarkom (OS). OS, einem der am häufigsten Primärtumoren des Knochens, eine mesenchymale Malignität ist die umfangreiche klinische, histologische zeigt und molekulare Heterogenitäten 2, 3. Leider OS tritt vorwiegend bei Kindern und jungen Erwachsenen 4, 5 und repräsentiert 60% die gemeinsamen histologischen Subtypen von Knochensarkomen in der Kindheit 6, 7. OS betrifft in der Regel die Skelettbereiche, die durch schnelles Knochenwachstum gekennzeichnet sind (zB die Metaphyse der langen Röhrenknochen). Unter den histologisch verschiedenen Subtypen von OS, konventionellen OS, auch Mark oder Zentral OS genannt wird, hat einen hohen Grad der Bösartigkeit und eine Quote share von 80% 8. Diese 80% von 60% herkömmlichen Osteoblasten - OS besteht, 10% chondroblastische OS und 10% fibroblastic OS 6, 8-10. Andere OS-Subtypen gehören anaplastic, teleangiektatischen, Riesenzellreiche und kleine Zelle OS. Trotz der Fortschritte in kombinierten Operation und Chemotherapie in OS Management, bleibt das Ergebnis schlecht, mit einem langfristigen Überlebensrate von 65-70% bei Patienten ohne Metastasen 11, 12. Distant häufig Rezidive als pulmonale Metastasen auftreten , oder, weniger oft, als Metastasen zu den entfernten Knochen und lokale Rezidive 13. Metastasen sind oft resistent gegen herkömmliche Behandlungen. Dieser Widerstand ist der Grund , warum die 10-jährige krankheitsfreie Überleben bei 14 Diagnose etwa 30% bei Patienten mit metastasierten Erkrankung ist, 15.

Wie bei normalem Gewebe wird Krebsgewebe einer heterogenen Sammlung von Zelltypen zusammen. Zellen innerhalb des Tumors scheint zu verschiedenen Stadien der Entwicklung zu entsprechen. Innerhalb eines nOrmal Gewebe besteht mit der Fähigkeit, eine Subpopulation von Zellen zu selfrenew, also Vorläufern und reifen Zellen für Gewebshomöostase bereitstellt. In ähnlicher Weise wird Krebs einer ähnlichen heterogene Population von Zellen zusammengesetzt in verschiedenen Stadien der Entwicklung, mit unterschiedlichen Graden der Proliferation und tumorigene Potenzial. Eine Untergruppe dieser Krebszellen, bezeichnet als Krebsstammzellen (KSZ), ein Reservoir von selbsttragenden Zellen mit dem exklusiven Fähigkeit , das maligne Potential von Tumoren selfrenew und aufrechtzuerhalten bildet, wodurch die verschiedenen Zelllinien zu erzeugen, die die Tumormasse 16 bilden. In den 1990er Jahren, Studien über die akute myeloische Leukämie lieferte die erste zwingende Beweise für die Existenz von CSC Subpopulationen 17, 18. CSCs seit aus einer großen Anzahl von soliden Tumoren 19, um dadurch zu einem der am besten erforschten Themen in der Krebsforschung isoliert. CSCs können von normalen Stammzellen durch Mutationen in Genen entstehen in der Tat, dass die normale machenStammzellen Krebs 20-23. Mehrere Transformation Mutationen und Interaktionen mit der Mikroumgebung könnte auch zu einer gesunden Vorläufern und reifen Zellen dazu beitragen, die Selbsterneuerung Kapazität und Unsterblichkeit zu erwerben, die CSCs typisieren. Es gibt mehrere Hypothesen über diese Transformation. Gesunde Vorläufern, gesund reifen Zellen und Krebszellen, entdifferenzieren auf Stammzellen, einen stielartigen Phänotyp durch die Aktivierung Selbsterneuerung-assoziierten Gene zu erhalten 24-28. Trotz mehreren neueren Studien haben die Ursprünge von CSCs noch entdeckt werden.

Ein besonderes Merkmal von CSCs ist, dass ihre Fähigkeit, die Multi-Therapieansatz zu widerstehen, die der kombinierten Operation und Chemotherapie mit verschiedenen Medikamenten besteht. Jüngste Studien haben gezeigt, dass auch CSCs Resistenz erwerben können Chemotherapeutika zu zytotoxisch. Mögliche Erklärungen für diesen Widerstand umfassen die Überexpression von ATP-bindenden Kassette (ABC) Multidrug - Transporter (dhMDR1 und BCRP1) Überexpression von Chemotherapie - metabolisierenden Enzymen wie Aldehyd - Dehydrogenase 1 (ALDH1) und / oder Änderungen in Zellzykluskinetik 30-33. Die direkte Folge all dieser Konzepte, die bisher beschrieben worden sind, ist, dass eine Krebstherapie nur dann effizient sein würde, wenn der CSC-Subpopulation vollständig eliminiert wurden, während ein lokales Rezidiv oder Fernmetastasen auftreten könnte, wenn auch nur ein einziger CSC überlebt.

Die Entdeckung von CSCs in menschlichen Sarkomen 34, insbesondere OS 35 oder in irgendwelchen anderen Knochen und Weichgewebe Krebs, hat eine große klinische Bedeutung , weil es eine mögliche Erklärung bietet, warum viele Behandlungen scheinen wirksam zunächst zu sein, aber die Patienten später Rückfall. Deshalb ist die Hoffnung für die Zukunft Kampf gegen konventionelle OS neue und spezifische zielgerichtete Therapien zu finden basiert auf der Entwicklung innovativer Arzneimittel auf OS-CSCs dank der molekularen Charakterisierung dieser Unter gerichtetBevölkerung und dem Studium der CSC Biologie.

Im Jahr 1992, Reynolds und Kollegen, die untersuchten , ob eine Teilmenge von Stammzellen im erwachsenen Gehirn von Säugetieren vorhanden war, eine Methode entwickelt , Zellen zu isolieren Verdacht 36, stielartigen Zellen 37 zu sein. Diese Methode basiert auf der besonderen Fähigkeit der Diese Zellen kugelförmigen Kolonien zu bilden, wenn sie unter nicht-adhärenten Bedingungen gezüchtet. Ähnliche Techniken wurden von Gibbs und Kollegen im Jahr 2005 beschäftigt 38 eine Subpopulation von stielartigen Zellen in Knochen - Sarkome zu studieren. Zu isolieren und OS-KSZ aus primären Zellkulturen von verschiedenen Arten von herkömmlichen OS charakterisieren, haben wir uns entschlossen, diese Technik für die OS-Zelllinien anzupassen.

Hier beschreiben wir diese angepasst Verfahren der Kugelbildungstest, genannt "sarcosphere assay", die verwendet werden können OS-KSZ aus finite primären Zelllinien von humanen Biopsien herkömmlicher OS abgeleitet zu isolieren. Wir beschreiben auch alle Techniken uSed die stielartigen CSC Phänotyp der Zelllinien durch diesen Test isoliert zu validieren: 1) Bewertung der Expression von Genen, die pluripotenten embryonalen Stammzellen (ES-Zellen) und der CD133-Gens zu charakterisieren, die eine Markierung des CSCS ist; 2) Kolonie-bildenden Einheit (CFU) -Assay; 3) Bewertung der Fähigkeit dieser Zellen in Osteoblasten und Adipozyten unter geeigneten Differenzierungsbedingungen zu unterscheiden; 4) Untersuchung der Oberflächenmarker von mesenchymalen Stammzellen (MSCs) (dh CD44, CD105 und Stro-1) durch Immunfluoreszenzfärbung und Durchflusszytometrie - Analyse; 5) Bewertung der ALDH Aktivität dieser Zellen.

Protocol

Alle Experimente unter Verwendung von menschlichem Gewebe beschrieben hier wurde von der lokalen Ethikkommission (Rif. N. 141/12) zugelassen. Die Einwilligungserklärung für die Sammlung von Gewebeproben und für die Verwendung und Lagerung der Proben wurde von den Spendern bei AOUC erhalten.

1. Vorbereitung für die Kultur

  1. Bereiten Wachstumskulturmedium (GM) durch Zugabe von 10% Fetales Kälberserum (FBS), 100 IU / ml Penicillin und 100 ug / ml Streptomycin zu Coon modifiziertem Ham-F12-Medium. Filter und sterilisieren GM einen 0,22 & mgr; m-Filter. Shop GM bis zu 1 Monat bei 4 ° C.
  2. Bereiten Kollagenase-Medium (CM) durch Zugabe von 20% FBS, 100 IU / ml Penicillin, 100 ug / ml Streptomycin und 3 mg / ml Kollagenase Typ II zu Coon modifiziertem Ham-F12-Medium. Filter und sterilisieren CM unter Verwendung eines 0,22 & mgr; m-Filter. Shop CM bis zu 1 Monat bei -20 ° C.
  3. Bereiten Medium für Zell Gefrieren (FM) durch Zugabe von 40% FBS, 100 IU / ml Penicillin, 100 ug / ml Streptomycin und 60,5% Dimethylsulfoxid (DMSO) zu Coon modifizierten Ham-F12-Medium. Filter sterilisieren und FM einen 0,22 um-Filter. Speichern von UKW bis zu 1 Monat bei 4 ° C.
  4. Bereiten Medium für CFU-Assay (CFUM) durch Zugabe von 20% FBS, 100 IU / ml Penicillin und 100 ug / ml Streptomycin zu Coon modifiziertem Ham-F12-Medium. Filter und zu sterilisieren CFUM ein 0,22 um-Filter. Shop CFUM bis zu 1 Monat bei 4 ° C.
  5. Bereiten Trypsin durch Auflösen von 400 mg Trypsin, EDTA 200 mg und 1000 mg D (+) - Glucose wasserfrei in 1000 ml Dulbeccos phosphatgepufferter Salzlösung (DPBS) ohne Ca 2+ und Mg 2+.
    HINWEIS: Teilen frisch Trypsin-EDTA in 50 ml Aliquoten in 25 cm 2 -Kolben unter Verwendung eines 0,22 um - Filter und gefrier bei -20 ° C für bis zu 3 Monate. Speicher aufgetaut sterilfiltriert Aliquots bei 4 ° C ohne Aktivitätsverlust.
  6. Bereiten Stammzellwachstumsmedium (SCGM) durch Zugabe von 10% FBS, 100 IU / ml Penicillin, 100 ug / ml streptomycin und 10 ng / ml bFGF (25 ug / ml Lager) zu den Coon modifizierten Ham-F12-Medium. Filter SCGM unter Verwendung eines 0,22 um-Filter und speichern SCGM bis zu 2 Wochen bei 4 ° C.
  7. Bereiten 2% Methylcellulose (MC) durch MC Auflösen in ultrareinem H 2 O bei 4 ° C für 3 d. Wenn MC vollständig gelöst ist, Autoklaven sie und lagern bei 4 ° C.
    HINWEIS: Nach dem MC sterilisiert wird, es wird fest. Um bringen MC in einen flüssigen Zustand, bei 4 ° C.
  8. Bereiten Sie sarcosphere Wachstumsmedium (SGM). Bereiten Sie dieses Medium frisch (nicht mehr als 2 Wochen vor dem Gebrauch) durch Zugabe von 100 IU / ml Penicillin, 100 ug / ml Human-bFGF (25 ug / ml Brühe), 20 nM Progesteron (10 & mgr; M Lager), 100 & mgr; M Putrescin, 30 nM Natriumselenit (30 & mgr; M Lager), 25 ug / ml Transferrin (25 mg / ml Brühe), 20 ug / ml Insulin (20 mg / ml Brühe) und 10 ng / ml humanem EGF (10 ug / ml Lager) zu 2X Coon modifizierte Ham-F12-Medium. Filter und sterilisieren SGM mit einem 0,22 um filter. Speicher für bis zu 2 Wochen bei 4 ° C.
  9. Bereiten Sie osteogenen Medium (OM) durch Zugabe von 10% FBS (südamerikanischer Herkunft), 100 IU / ml Penicillin, 100 ug / ml Streptomycin, 10 nM Dexamethason (100 uM Lager), 0,2 mM Natrium-L-Ascorbyl-2-phosphat (1 M Lager), 10 mM β-Glycerophosphat (5 mg / ml Brühe) und 1 & mgr; g / ml Calcein (200 ug / ml Lager) zu Coon modifizierten Ham-F12-Medium. Filter sterilisieren und OM einen 0,22 um-Filter. Lagerung bei 4 ° C.
    HINWEIS: Shop Dexamethason Stammlösungen unter flüssigem Stickstoff ihre Aktivität aufrecht zu erhalten. alle 2 Wochen frisch zubereiten OM die Aktivität von Dexamethason zu halten, um das Differenzierungspotential des Mediums aufrechtzuerhalten.
  10. Bereiten Erythrozyten Lysepuffer (ELB) durch Auflösen von 1,66 mg NH 4 Cl, 0,2 mg K 2 HPO 4 und 0,007 mg EDTA in 200 ml destilliertem Wasser (dH 2 O). Filter und sterilisieren ELB einen 0,22 & mgr; m-Filter. Lagerung bei 4 °C.
  11. Bereiten Sie adipogenetische Medium (AM) durch Zugabe von 10% FBS (Südamerika Herkunft), 100 IU / ml Penicillin, 100 ug / ml Streptomycin, 1 & mgr; M Dexamethason (1 mM Lager), 1 uM Rinderinsulin (10 mM Stamm), 0,5 mM Isobutylmethylxanthin (IBMX) (500 mmol Lager) und 100 & mgr; M Indomethacin (200 mM) zu Coon modifizierten Ham-F12-Medium. Filter und sterilisieren AM eines 0,22 & mgr; m-Filter. Lagerung bei 4 ° C.
    HINWEIS: Shop Dexamethason Stammlösungen unter flüssigem Stickstoff ihre Aktivität aufrecht zu erhalten. Vorbereitung alle 2 Wochen frisch AM die Aktivität von Dexamethason zu halten, um das Differenzierungspotential des Mediums aufrechtzuerhalten.
  12. Bereiten 2% Rinderserumalbumin (BSA) in DPBS (BSA / DPBS). Man löst 10 g BSA in 500 ml DPBS und bereiten die Stammlösung durch Aliquotierung 50 ml Stammlösung in 50 ml konischen Röhrchen. Lagerung bei -20 ° C.
  13. Eine Lösung aus 4% Paraformaldehyd (PFA) in DPBS (PFA / DPBS). In einem chemical Haube, Paraformaldehyd in DPBS verdünnt und die Stammlösung durch Aliquotierung 50 ml Stammlösung in 50 ml konische Röhrchen herzustellen. Lagerung bei 4 ° C.

2. Festlegung Primary OS Zellkulturen und OS Finite-Zelllinien (OSA)

HINWEIS: Primary OS Zellkulturen aus frischen Proben von herkömmlichen OS - Biopsien wurden hergestellt , bei dem gesammelten "Unità Ortopedia Oncologica e ricostruttiva", AOUC Careggi in Florenz. Alle Biopsien, welche durch Nadel - Aspiration oder chirurgische Resektion eines kleinen Teils des Tumors (1A, B) erhalten wurden, wurden sofort in Kulturmedium mit 100 IU / ml Penicillin und 100 ug / ml Streptomycin (pH 7,4) , ergänzt platziert und zum Labor transportiert, wo sie verarbeitet wurden. Alle beschriebenen Manipulationen wurden unter aseptischen Bedingungen durchgeführt eine laminare Strömung Haube mit.

  1. Isolierung von OS - Zellen
    1. Legen Sie die Biopsie in ein100 mm Petrischale mit einem kleinen Volumen von GM. Mit einer sterilen Lanzette und Perry Pinzetten, zerkleinern die Proben OS Gewebe durch sie in Stücke möglichst klein Schneiden (0,5-1 mm) (2A, B).
    2. Decken die Gewebefragmente mit 10 ml CM für den enzymatischen Verdau (2B) und Inkubation für 3 h in einem 37 ° C, 5% CO 2 -Inkubator. Entfernen Sie vorsichtig die Suspension von Fragmenten mit einer Pipette und übertragen sie auf eine 15 ml konischen Röhrchen für die sofortige Zentrifugation (400 × g für 5 min), um die Fragmente zu pelletieren.
      HINWEIS: Nach der Zentrifugation wenn die Biopsien reich an Erythrozyten sind, eine rote Ablagerung von Erythrozyten zusammengesetzt ist , über die Fragmente zu sehen. Daher muss vor der mechanischen Dispersion fortfahren, behandeln die Probe mit Puffer Erythrozytenlysepuffer. Überstand verwerfen durch Absaugen und 5 ml ELB.
    3. Suspend-Pellet-Fragmente für 1 min und Zentrifugieren Sie die Suspension bei 400 × g für 2Minute Entfernen Sie den Überstand durch Absaugen. 20-mal - unter Verwendung einer 10 ml serologische Pipette (Öffnungsgröße, 1,5 mm Innen-Ø) 10 5 ml GM und mechanisch die Fragmente zerstreuen.
    4. Zentrifugieren Sie die Suspension bei 400 xg für 5 min. Entfernen Sie den Überstand durch Absaugen, zu suspendieren das Zellpellet mit 10 ml GM und dann übertragen Sie die resultierende Zellsuspension in eine 100 mm Petrischale. Inkubieren Sie die Petrischale in einem 37 ° C, 5% CO 2 Inkubator und ersetzen Sie die GM mit frischem Komplett GM alle 3 d.
      HINWEIS: Oft Proben OS Gewebe durch Nadel - Aspiration gewonnen sind sehr klein und enthalten Knochenfragmente, die nicht durch enzymatischen Verdau mit Kollagenase verdaut. Daher wird, nachdem der Überstand entfernt wurde, versuchen, Zellen aus Knochengewebe zu trennen, indem Pelletbruchstücke mit einer Pipette Maischen.
  2. Subkultur
    HINWEIS:
    Um eine OSA etablieren, wenn die Zellen annähernd Zusammenfluß erreichen, entfernen Sie sie aus their Kulturgefäß, zu verdünnen, und legen Sie in eine frische Platte weiteres Wachstum zu ermöglichen. Diese Subkultur Verfahren wird unter Verwendung des enzymatischen Verfahrens genannt Trypsinisierung erreicht.
    1. Entfernen Sie das Medium durch Absaugen. Um die Zellschicht trennen, fügen Sie 2 - 3 ml Trypsin bei RT (max 18 bis 20 ° C), leicht schütteln einmal, und entfernen Sie das Trypsin sofort durch Absaugen. Zweimal wiederholen. Inkubieren der Zellen bei 37 ° C für 3 bis 4 min, bis sie beginnen sich zu lösen.
      HINWEIS: Gut Trypsinierung kann durch den erfahrenen Anwender als kleine Löcher zu sehen in der leicht opake einschichtige bilden , wenn das Gericht gegen das Licht gehalten wird. Diese Dissoziation kann auch ein umgekehrtes Mikroskop überwacht werden; Dieser Ansatz ist für Anfänger zu empfehlen.
    2. Stoppen Sie die Trypsin-Reaktion von 10 ml GM Zugabe und gut waschen, die Schale mit einer Pipette, um alle Zellen zu lösen. 1 ml der Suspension in einen neuen 100 mm Petrischale und füge 9 ml GM (1/10 Spaltung der Zellen).
      HINWEIS:
  3. Kryokonservierung von OS Primärkulturen und OSA
    HINWEIS: Frieren Sie eine konfluente 100 mm Petrischale in 4-5 Kryovials. Der Prozess der Kryokonservierung muß schnell ausgeführt werden, da DMSO, die während des Einfrierens Zellmembranen schützt, um Zellen bei nicht-Gefriertemperaturen toxisch ist.
    1. Distanzieren Zellkulturen aus der Monoschicht durch Trypsinisierung (siehe Abschnitt 2.2), Pellet-Zellen durch Zentrifugation bei 400 × g für 5 Minuten, entfernen Sie den Überstand durch Absaugen, und dann das Zellpellet in FM schnell auszusetzen.
    2. Aliquot 1 ml dieser Suspension pro kryogenen Fläschchen. Ab sofort stellen die gefüllten Fläschchen in einer Gefriertruhe mit einem Mantel aus 2-Propanol und Speicher immediadig bei -80 ° CO / N. Transfer Kryoröhrchen in flüssigen Stickstoff am folgenden Tag für die Langzeitlagerung.
  4. Defrost OS - Zelllinien und Primärkulturen
    1. Defrost OS-Zelllinien aus Flüssigstickstofflagerung, Auftauen Kryoröhrchen schnell, indem sie in einem Labor Wasserbad bei 37 ° C platziert. Übertragen Sie die Inhalte der Kryoröhrchen in einen 15 ml konischen Röhrchen und fügen etwa 10 ml GM (siehe Abschnitt 2.3 zu entfernen, DMSO). Entfernen Sie den Überstand durch Absaugen und setzt die Zellpellet in 10 ml GM. Platte die Zellsuspension in einer 100 mm Petrischale und Inkubation in einem 37 ° C, 5% CO 2 -Inkubator.

3. Sarcosphere Assay zur Isolierung von OS-CSCs

Hinweis: Dieses Experiment wird auf OSA durchgeführt. Die Dauer dieses Experimentes ist mit der Kapazität der Zellen im Zusammenhang mit dieser Sphäre Kolonien (sarcospheres) zu bilden, und der Bereich der Zeit 7, 14, 21 und 28 d.

  1. Estabrichtung von sarcosphere Assay
    1. Bereiten Sie die Haemocytometers Kammer und alle Reagenzien im Voraus.
    2. Entfernen Sie das Medium durch Absaugen und distanzieren die Zellen von der einschichtigen durch Trypsinisierung (siehe Abschnitt 2.2). Mischen Sie die Zellsuspension gründlich, Pipettieren zu zerstreuen alle Klumpen und sammeln 10 & mgr; l mit einer 20 & mgr; l-Pipettenspitze.
    3. Übertragen Sie die 10 & mgr; l Zellsuspension sofort in die Haemocytometers Kammer Kante, vertreiben die Aufhängung, und lassen Sie ihn unter dem Deckglas durch Kapillarwirkung gezogen werden.
    4. Beachten Sie die Haemocytometers Kammer unter Phasenkontrast. Wählen Sie ein 10X-Objektiv und konzentrieren sich auf die Gitterlinien in der Kammer. Zählen Sie die liegenden Zellen in dieser 1 mm 2 Fläche die Unterteilungen verwenden (auch durch drei parallele Linien gebunden) und einzelne Gitterlinien als Hilfsmittel zum Zählen.
    5. Messen der Konzentration und gilt die folgende Gleichung: 1 ml = n * 10 4 / z (n: die gesamte Anzahl von Zellen in all die gezählteQuadrate von 1 mm 2; z: die Anzahl der gezählten Quadrate 1 mm 2). Berechnen des Volumens der Zellsuspension notwendig, eine Gesamtmenge von 240.000 Zellen in 40.000 Zellen für jede Vertiefung in der 6-Well ultraniedrigen Befestigungsplatte geteilt zu plattieren.
      HINWEIS: Stellen Sie sicher , dass die richtige Anzahl von Zellen an der Platte durch die Zellen in ein extra gut Plattierung. Daher werden die Gesamtmenge an Zellen plattiert 280.000 Zellen.
    6. Bereiten Sie 35 ml SGM durch Zugabe von 50% von 2% MC (SGM-MC) in einem 25 cm 2 Kolben. Bereiten Sie das Gesamtvolumen der SGM Berücksichtigung 5 ml Extra, um ein extra gut an der Platte.
    7. Die berechnete Volumen der Zellsuspension auf die SGM-MC in dem Kolben hergestellt und vorsichtig mischen unter Verwendung einer Pipette keine Klumpen zu dispergieren. Platte, die die Zellen in einer 6-Well-Ultra-Low-Befestigungsplatte und verwenden Sie ein inverses Mikroskop zu beobachten, wie die Zellen erscheinen nach plattiert werden.
    8. Inkubieren der Zellen in einem 37 ° C, 5% CO 2 -Inkubator. Alle 3 d, fügen frESH Aliquots von bFGF und EGF zu jeder Vertiefung, die Konzentration der Wachstumsfaktoren zu aktualisieren. Fügen Sie 2 & mgr; l bFGF und EGF 5 & mgr; l sowohl zu halten, bei der Endkonzentration von 10 ng / ml in jede Vertiefung.
  2. Isolierung von sarcospheres
    HINWEIS: Überwachen Sie die guten Fortschritte des sarcosphere Test bei 7, 14, 21 und 28 d , um zu entscheiden , wenn es notwendig ist , die sarcospheres zu isolieren , die gebildet wird .
    1. Bereiten Sie alle Reagenzien und Geräte in der Laminar - Flow - Haube (3A, B). Zubauen der Filtrationseinheit durch ein Netzfilter von 25 mm Durchmesser und einem 40 & mgr; m mesh in einen Membranfilterhalter platzieren; Sterilisieren durch Autoklavieren (4A-E).
    2. Für jeden gut, übertragen das Medium, das die sarcospheres auf eine Spritze mit einer sterilen Membranfilterhalter mit einer sterilen Pipette mit einem 1000 ul Spitze enthält. Nach dem vollständigen Entfernen des Mediums die sarcospheres, waschen Sie die gut durch Zusatz enthält,ing 5 ml GM um sicherzustellen, dass alle Bereiche mit einer Spritze zu übertragen. Verwenden Sie das Mikroskop, um zu bestätigen, ob alle sarcospheres wiederhergestellt wurden. Wenn nicht, gehen Sie durch diesen Schritt zu wiederholen.
    3. Filtern der Suspension mit einem Membranfilterhalter nur durch die Schwerkraft, ohne Druck, um zu verhindern, dass die Kugeln zu beschädigen und zu vermeiden, dass sarcospheres durch den Filter kreuzt, wodurch der Verlust von Kugeln zu vermeiden. Entfernen Sie Luftblasen durch vorsichtiges einer sterilen Pasteur-Glaspipette.
      HINWEIS: Manchmal ist die Filtration durch die Anwesenheit einer Luftblase in der Membranfilterhalter blockiert.
    4. Waschen Sie die Filtereinheit von 10 ml GM Zugabe zu der Spritze und lässt sie ohne Druck filtern, um sicher sein, die einzelnen Zellen zu beseitigen. Nehmen Sie die Filtereinheit aus der Spritze auseinander und steckte es in eine Petrischale.
    5. Entfernen Sie den Netzfilter aus der Membranfilterhalter mit Perry Pinzette und waschen Sie es sanft mit der Pinzette in einem 60 mm SchüttelnPetrischale die sarcospheres aus dem Gewirr der Membran zu lösen. Dann legen Sie die Membran in einem gut und bestätigen durch mikroskopische Beobachtung, dass es keine mehr Kugeln verheddert in der Membran sind. Wenn Kugeln noch in der Membran verheddert sind, mit einem weiteren Wasch gehen Sie wie in Schritt 3.2.4 beschrieben.
    6. Beachten Sie die Freigabe sarcospheres mit einem Mikroskop. Inkubieren der freigesetzten sarcospheres in einem 37 ° C, 5% CO 2 -Inkubator. Wiederholen Sie alle Schritte für jede Vertiefung einer 6-Well-Ultra-Low-Befestigungsplatte.

4. OS-CSC-Linien

HINWEIS: OS-CSCs werden aus den sarcospheres erhalten , welche hafteten Expansion zeigen , indem wieder einzuführen und Rekultivierung , diese Zellen in einer Monoschicht , nachdem sie in kleinen 60 - mm - Petrischalen plattiert werden nicht mehr unter Ultra-Low - Befestigung Bedingungen.

  1. OS-CSC Kulturen
    1. Damit das weitere Wachstum, Subkultur-Zellen, wenn sie etwa 90% Konfluenz in einer 60 erreichenmm Petrischale. Wiederholen Sie Schritt 2.2.1 OS-CSC Kulturen zu etablieren.
    2. Stoppen Sie Trypsinierung durch Zugabe von 4 ml SCGM und gut waschen die Schale, mit einer Pipette, um alle Zellen zu lösen. Übertragen Sie die Zellsuspension auf eine neue 100 mm-Petrischale und 6 ml SCGM. Wenn OS-CSCs erreichen 90% Konfluenz, Subkultur um 2,2 Abschnitt zu wiederholen.
      HINWEIS: Für in vitro - Analyse der Stammzellartigen Phänotyp isoliert OS-KSZ zu charakterisieren, können Zellen in verschiedenen Arten von Platten plattiert werden.
    3. Bewahren Sie die etablierten OS-CSC Linien durch Kryokonservierung (Wiederholung aller Schritte von Abschnitt 2.3). Tauen Sie das kryokonservierten OS-CSCs durch alle Schritte des Abschnitts 2.4 zu wiederholen.

5. In - vitro - A nalyse zu Charakterisieren OS-CSCs:

  1. Herstellung von Zellen für die Immunofluoreszenz
    HINWEIS: Die Zellen werden in Paraformaldehyd fixiert , wenn sie den richtigen Grad der Einmündung in jede Vertiefung einer 24-Well - pla erreichente. Der Grad der Konfluenz wird auf die Art von Experimenten verwandt.
    1. Platte OS-KSZ in einer 24-Well-Platte, die die Oberfläche mesenchymalen Stammzellen (MSC) Marker durch Immunofluoreszenz zu studieren. Fix Zellen in jeder Vertiefung, wenn sie 50 erreichen - 60% Konfluenz. Entfernen Sie die SCGM durch Absaugen und waschen zweimal in DPBS 24-Well-Platte.
    2. Unter einer chemischen Haube, 500 & mgr; l 4% PFA / DPBS in jede Kammer. 10 min bei RT inkubiert. Entfernen Sie die PFA / DPBS und wasche 3x mit Reinstwasser dH 2 O. Lassen Sie die 24-Well-Platte in der Abzugshaube zu trocknen.
  2. Immunofluoreszenz für MSC - Marker
    HINWEIS: Immunfluoreszenzfärbung des OS-CSCs fixiert in 4% PFA / DPBS können die MSC-ähnlichen Phänotyp von OS-CSCs unter Verwendung von Antikörpern gegen CD44, Stro-1 und CD105 gerichtet zu untersuchen , verwendet werden. Das folgende Verfahren wird routinemäßig von den Autoren verwendet.
    1. In einer chemischen Haube, Permeabilisierung Zellen, die 0,2 durch Zugabe von 500 & mgr; l in 4% PFA / DPBS wurden behoben% Triton X-100 / DPBS in jede Vertiefung. Inkubieren der Zellen bei 37 ° C für 30 min. Vorsichtig waschen Sie die Zellen mit DPBS 3x. Hinzufügen von 300 & mgr; l RNase 1/1000 mit 2% BSA verdünnt / DPBS zu den Zellen und inkubiere bei 37 ° C für 30 min.
    2. Vorsichtig waschen Sie die Zellen mit 2% BSA / DPBS 3x. Beflecken die Zellen für MSC-Marker. Fügen Sie den primären Antikörper nur an den gewählten Vertiefungen als positive Kontrollen für jeden Antikörper.
      1. In 300 & mgr; l anti-CD105 1/10 verdünnt mit 2% BSA / DPBS, 300 & mgr; l anti-CD44 1/10 mit 2% BSA verdünnt / DPBS, 300 & mgr; l anti-Stro-1 1/10 mit 2% BSA verdünnt / DPBS und nur 200 & mgr; l 2% BSA / DPBS zu den gewählten Vertiefungen als negative Kontrollen für jeden Antikörper.
      2. Inkubieren der Zellen in einer feuchten Umgebung bei 4 ° CO / N. Waschen Sie die Vertiefungen mit DPBS 3x und dann zweimal mit 2% BSA / DPBS.
    3. Reveal primäre Antikörper durch spezifische Sekundärantikörper hinzugefügt wird.
      1. Hinzufügen von 300 & mgr; l anti-Kaninchen-IgG (Esel-Anti-Kaninchen-IgG [H + L]), verdünnt 1/100mit 2% BSA / DPBS in jede Vertiefung als positive und negative Kontrolle für CD44 und CD105 ausgewählt. Hinzufügen von 300 & mgr; l FITC-anti-Maus-Ig (FITC-Kaninchen-anti-Maus-IgG [H + L]), verdünnt 1/100 mit 2% BSA / DPBS in jede Vertiefung gewählt als positive und negative Kontrolle für Stro-1. Inkubiere Zellen im Dunkeln bei RT für 60 min. Waschen Sie die Vertiefungen mit DPBS 6x.
    4. Stain MSC Marker-positiven Zellen für Zytoskelett-Aktin durch Zugabe von 300 & mgr; l phalloidin 1/100 verdünnt mit 2% BSA / DPBS in jede Vertiefung gefärbt MSC Marker Immunofluoreszenz.
    5. Inkubieren der Zellen für 40 min bei RT. Waschen Sie die Vertiefungen mit DPBS 3x und dann waschen Sie sie zweimal mit Reinstwasser dH 2 O. Fahren Sie mit dem Gegenfärbelösung der Kerne nach dem Immunfluoreszenzanfärbung oben beschrieben. Bereiten Sie Propidiumiodid - Lösung 10 -5 M in DPBS (Lager 1,5 x 10 -3 M) in einem Abzug.
      1. Mit 200 & mgr; l Propidiumjodid-Lösung in jede Vertiefung gefärbt, wie oben beschrieben. Inkubieren Sie die Zelles für 2 - 3 min bei RT. Waschen Sie die Vertiefungen zweimal mit Reinstwasser dH 2 O.
        HINWEIS: Wiederholen Sie alle Schritte der Abschnitte 5,1-5,2 auf der Zelllinie HCT8, eine primäre kontinuierliche differenzierten Darmkrebs - Zelllinie , die als negative Kontrolle verwendet wird.
  3. Osteogenen Differenzierungstest
    HINWEIS:
    Die osteogene Differenzierung dauert 20 d.
    1. Platte OS-KSZ in 24-Well - Platten bei einer Zelldichte von 1 x 10 4 Zellen / cm 2 in SCCGM. Lassen Sie die Zellen in SCGM zu wachsen, bis sie 80 erreichen - 90% Konfluenz in jeder Vertiefung.
    2. Starten Sie die osteogene Differenzierung durch die SCGM zu OM ändern. Lassen Sie die Zellen in OM, zu wachsen und zu aktualisieren Medium alle 3 - 4 D. Stoppt den osteogenen Differenzierungsassay bei 10 d die Anwesenheit von alkalischer Phosphatase (ALP) zu bewerten.
    3. Fix-Zellen in 4% PFA / DPBS (siehe Abschnitt 5.1). Bewerten Sie die Osteoblasten-Phänotyp durch cytochemischer Färbung für ALP und für HAmit Alizarin Red S-Färbung.
    4. ALP cytochemischer Färbung
      HINWEIS: Bereiten Sie die Farbstoffmischung in einer chemischen Haube unmittelbar vor der Färbung beginnen.
      1. Man löst 40 mg Fast Blue BB oder Fast Red Violet LB Salz in 50 ml Tris-HCl, pH 9 (Lösung A). Man löst 5 mg Naphthol-AS-MX Phosphat-Natriumsalz in 1 ml DMSO (Lösung B). In Lösung B vollständig zu Lösung A und gut mischen, zu erhalten Lösung C. Wash Zellen zweimal mit DPBS.
      2. In 500 & mgr; l - 1 ml Lösung C in jede Vertiefung und Inkubation bei 37 ° C und 5% CO 2. Überwachen Sie den Verlauf der Färbung alle 10 Minuten, indem die Zellen unter dem Mikroskop zu beobachten.
      3. Stoppen Sie die Färbung bei ALP-positiven Zellen intensiv (blau mit dem Fast Blue BB Salz oder rot mit Fast Red Violet LB Salz) farbig werden, die in der Regel innerhalb von 30 Minuten erfolgt. Jeweils 3x die Zellen mit Reinstwasser dH 2 O alle Rückstände der Lösung C. Wenn ein Niederschlag von den Fleck zu entfernen is vorhanden, waschen schnell, sobald die Zellen mit absolutem Ethanol.
      4. Fahren Sie mit dem Gegenfärbelösung der Kerne nach der ALP-Färbung als 5.2.5 und 5.2.5.1 in den Schritten beschrieben.
    5. Alizarin Red S cytochemischer Färbung
      HINWEIS: Bereiten Sie die Farbstoffmischung vor dem Start des Experiments.
      1. Bereiten Sie die 2% Alizarin Red S (2 g Alizarin Red S in 100 ml ultrareines H 2 O). In 2,5% NH 3 auf 2% Alizarin Red S 6,0 pH - Wert zu erreichen. Speicher 2% Alizarin Red S-Lösung bei 4 ° C. Waschen Sie die Zellen einmal mit DPBS.
      2. In Alizarin Red S zu den Zellen für nur ein paar Sekunden.
      3. Waschen der Vertiefungen mit Reinstwasser dH 2 O der Grad der Färbung zu steuern; wenn die HA-Ablagerungen nicht intensiv gefärbt sind, wiederholen Sie Schritt 5.3.5.2. Stoppen Sie die Färbung, wenn HA intensiv werden Ablagerungen rot gefärbt, die in der Regel innerhalb von wenigen Minuten auftritt. Waschen Sie die Vertiefungen mit Reinstwasser dH 2 O.
    6. adipogenetische Differenzierung
      HINWEIS: Assay Dauer hängt von der OS-CSC - Linien. 30 d - Der Test kann 14 dauern.
      1. Platte OS-KSZ in 24-Well - Platten bei einer Zelldichte von 1 x 10 4 Zellen / cm 2 in SCGM. Lassen Sie die Zellen in SCGM zu wachsen, bis sie 80 erreichen - 90% Konfluenz in jeder Vertiefung. Initiieren adipogenetische Differenzierung durch die SCGM Wechsel zu AM. Lassen Sie die Zellen in AM zu wachsen und die Uhr zweimal pro Woche zu aktualisieren.
      2. Stoppen Sie den adipogenetische Differenzierungstest wenn Lipidvesikel sichtbar sind. Bewerten Sie die adipogenetische Phänotyp von Oil Red-O-Färbung und durch Hämatoxylin Gegenfärbung für Kerne.
      3. Hämatoxylin Gegenfärbelösung für Kerne
        HINWEIS: Bereiten Sie die Farbstoffmischung vor dem Start des Experiments.
        1. Bereiten Sie die 5% Hämatoxylin - Lösung, genannt Emallume Carazzi 39. Lagern Sie die Lösung bei 4 ° C. In Emallume Carazzi für nur 2 min. Waschen Sie Brunnen mit ultrapure dH 2 O.
    7. CFU - Assay
      HINWEIS: Dieses Experiment muss in dreifacher Ausführung durchgeführt werden.
      1. Platte OS-CSCs in 100 mm Petrischalen mit einer Zelldichte von 450 Zellen / cm 2 in CFUM. Inkubieren der Zellen in einem 37 ° C, 5% CO 2 Inkubator für 4 Wochen. Aktualisieren CFUM zweimal pro Woche.
      2. Stain die KBE mit Toluidinblau. Zählen Sie die farbigen Kolonien ein umgekehrtes Mikroskop. Berechnen CFU Effizienz nach der folgenden Formel: (Anzahl der gebildeten Kolonien / Anzahl der Zellen beimpft) * 100.
    8. ALDH Aktivitätsanalyse
      HINWEIS: Die ALDH - Aktivität wurde unter Verwendung eines ALDH Aktivität Colorimetric Assay Kit auf den beiden Leitungen OS-CSC ausgewertet und auf einer finite - Fibroblasten - Linie, die als negative Kontrolle verwendet wurde. Dieses Kit quantifiziert die ALDH enzymatische Aktivität durch Absorption bei 450 nm zu lesen. Alle Tests wurden in dreifacher Ausführung durchgeführt.
      1. Distanzieren Zellkulturen aus der Monoschicht durch Trypsinisierung (siehe Abschnitt 2.2). Pelletisieren Zellen durch Zentrifugation bei 400 xg für 5 min. Folgen Protokoll des Herstellers.
    9. Die durchflusszytometrische Analyse:
      HINWEIS: Einzelzellsuspensionen für eine optimale Färbung von Proben für die Durchflusszytometrie erforderlich sind. Eine Einzelzellsuspension müssen bereit sein, für jeden Antikörper getestet werden. Distanzieren Zellkulturen aus der Monoschicht durch Trypsinisierung (siehe Abschnitt 2.2).
      1. Platzieren der Zellsuspension in einem konischen Röhrchen, führen eine Zellzahl unter Verwendung des Bürker Zählkammer Zentrifugen Zellen bei 400 x g und Resuspendieren in einem geeigneten Volumen an Trennpuffer um eine Zellsuspension zu einer endgültigen Zellkonzentration von 1 x 10 5 Zellen / ml.
      2. Zentrifugieren Sie die Zellsuspension für 5 min bei 4 ° C. Überstand verwerfen und waschen Sie das Pellet mit Trennpuffer. Zweimal wiederholen Sie diesen Schritt.
      3. Stain Zellen für MSC Marker (dh CD44, CD105 und Stro-1) 40.
      4. Analysieren positiv gefärbten Zellsuspensionen in einem Durchflusszytometer. Analysieren Sie die markierten Proben innerhalb 1 d. Inkubieren dieser Proben bei 4 ° C bis zur Analyse.
    10. RT-PCR
      1. Extraktion und Isolierung von RNA
        1. 1 ml Lysereagenz zu den zellulären gefrorenen gepackten Proben von OS-CSCs und lysieren die Zellen direkt in das Rohr durch Pipettieren des Pellets nach oben und unten mehrmals.
        2. Zentrifugation der Proben bei 12000 x g für 1 min bei 4 ° C. Entfernen Sie vorsichtig den Überstand. Den Überstand in ein neues Röhrchen, 200 & mgr; l Chloroform, und die Kappe sicher das Rohr. Das Röhrchen wird kräftig für 15 Sekunden und Inkubation der Probe für 5 min bei RT.
        3. Zentrifugiere die Proben bei 12.000 xg für 15 min bei 4 ° C. Das Gemisch trennt sich in drei verschiedenen Phasen. Die RNA ist ausschließlich in der farblosen oberen wäßrigen Phase.
        4. Als particularly vorsichtig, nehmen Sie nur die wässrige Phase und übertragen diese Phase in ein neues Röhrchen mit der RNA-Isolierung, um fortzufahren. Fügen 500 ul Isopropanol zu dem Rohr der wässrigen Phase enthält. Das Röhrchen wird vorsichtig von Hand. Inkubieren Sie die Probe bei RT für 10 min. Zentrifugieren Sie die Probe bei 12.000 × g für 10 min bei 4 ° C.
          HINWEIS: Nachdem die Probe zentrifugiert wird, ist es möglich , die RNA zu sehen, die auf der Seite ein gelartiges Pellet bildet und auf dem Boden des Röhrchens.
        5. Entfernen Sie den Überstand aus dem Rohr, wobei darauf geachtet, das Pellet der RNA auf dem Boden zu verlassen. 1 ml 75% Ethanol in das Röhrchen. Vortex das Rohr mit der Hand für ein paar Sekunden und zentrifugiert dann die Röhrchen bei 7500 xg für 5 min bei 4 ° C.
        6. Entsorgen Sie das Ethanol und Luft trocknen die RNA-Pellet. Wenn die Pellets trocken ist, resuspendieren RNA-Pellet in RNase-freiem Wasser (10 bis 50 & mgr; l) durch die Lösung Pipettieren mehrmals auf und ab.
        7. Bestimmen Sie die Ausbeute und Reinheit der RNA durch messährend der Absorption bei 260 nm und 280 nm unter Verwendung eines Spektrophotometers. Bewerten Sie die Integrität der Gesamt-RNA auf Standard-1% Agarose-Gel. Lagern Sie die RNA bei -80 ° C.
      2. Reverse - Polymerase - Kettenreaktion
        1. Synthetisieren des ersten Stranges cDNA von 500 ng RNA-Proben eines Reverse Transkription-Kit. Thaw RNA-Proben auf Eis und tauen die notwendigen Lösungen im Kit bei RT enthalten. Gehen Sie cDNAs Protokoll folgende Hersteller zu synthetisieren.
      3. Semi-quantitative reverse Transkriptase-Polymerasekettenreaktion (RT-PCR)
        1. Führen alle PCRs unter Verwendung von 1 & mgr; l cDNA für jede Probe als Matrize in einem endgültigen Reaktionsvolumen von 24 & mgr; l. Verwenden Sie die Primersequenzen in Tabelle 1 aufgeführten für die Amplifikation von Nanog Okt 3/4, SOX2 und CD133 - Genen.
        2. Trenne die RT-PCR-Produkte durch 1,8% Agarose-Gelelektrophorese und Ethidiumbromid-Färbung mit. Fotografie unter UV illumination.

Representative Results

OS Proben durch Nadel - Aspiration oder chirurgische Resektion eines kleinen Teils des Tumors erhalten (1A, B) erlauben die Isolierung von nur einer OSA wenn genau behandelt, wie in dem Protokoll Abschnitt (2A, B) beschrieben. Leider ist die Anzahl von Zellen aus den Biopsien isoliert niedrig, mit einem Leistungsbereich von 30 bis 50%. Der Ausgang hängt von der Art und der Abmessung der Biopsien (5A, B). Diese Zellen müssen genau behandelt werden. Folglich etwa einem Monat ist notwendig für die primären Kulturen Konfluenz in einer 100 mm Petrischale zu erreichen. Nach dieser Zeit werden OSA aus zwei OS Proben markiert OSA5 und OSA6 (6A, B) erhalten. Dann ist es notwendig, die primäre Zelllinie zu subkultivieren eine ausreichende Anzahl an Zellen zu erhalten, die Charakterisierung Analyse durchzuführen, und die Zelle lin zu Kryokonservierunges. Am 3. Durchgang der Subkultur, wenn beide OSA primären Zelllinien Konfluenz erreichen, werden sie in 6-Well - Ultra-Low - Befestigungsplatten für den sarcosphere Assay plattiert. Diese Art der Platte verwendet wird, weil es uns erlaubt, Zellen in einem suspendierten Zustand zu halten, die Stammzellen aus dem Aufsatz-vermittelte Differenzierung zu verhindern, die adhärenten Zellen durch Teilung und schließlich zur Bindung an das Substrat zu reduzieren, zu verhindern. Daher ermöglicht die Verwendung uns eine stress Bedingung für die Krebszellen zu erzeugen, die für die Auswahl des CSCS notwendig ist. Bei 24 Stunden nach Beginn des Assays erscheinen Zellen voneinander (Figur 7) isoliert. Nach 7 d des Verlaufs der Assay - Überwachung wurden kleine kugelförmige Kolonien begannen zu bilden , und sichtbar sind (Figur 8). Bei 28 d, mehrere große kugelförmigen Kolonien , die in jeder Vertiefung gebildet haben kann beobachtet werden (9A, B). Nachdem die sarcospheres have für 28 d kultiviert wurde, können diese großen kugelförmigen Kolonien isoliert werden. Abbildung 10 zeigt die Schritte für sarcospheres von 6-Well - Ultra-Low - Befestigungsplatten zu isolieren und sie unter adhärenten Bedingungen Rekultivierung. 11 zeigt die schwebenden sphärischen Kolonien nach der Isolierung. Die große kugelförmige Kolonien plattiert in normalen Befestigungsplatten zeigen adhärenten Expansion nach der Isolierung (12A, B). Zellen, die von den einzelnen sarcospheres erweitern sind wahrscheinlich Krebszellen mit einer Stammzell-ähnlichen Phänotyp. Daher nach der Isolierung OS-CSCs wurden wahrscheinlich erhalten. Diese Zellen werden genannt OSA5-KSZ und OSA6-KSZ (13A, B).

An diesem Punkt ist es notwendig, sich mit der Charakterisierung der Stammzellen-Phänotyp für die beiden OS-CSC Linien erhalten fortzufahren, wie oben beschrieben. Die Analysen für die Charakterisierung der Stammzellen-ähnlichen Phänotyp were durchgeführt von Subkultur auf dem 4. Durchgang , nachdem die sarcospheres für jede Zeile OS-CSC isoliert. Die beiden Zelllinien, OSA5-CSCs und OSA6-CSCs, zeigten eine starke Positivität für die Oberflächen MSC Marker (CD105 und CD44) (14A, B und 15A, B), während sie moderate Positivität für die Oberfläche MSC Marker zeigte Stromatolithen 1 (16A, B). Unsere Beobachtungen wurden durch negative Ergebnisse , die mit dem kommerziellen und differenzierten Darmkrebs - Zelllinie HCT8 (14C, 15C, 16C) bestätigt. Eine völlige Fehlen von spezifischen und unspezifischen Färbung für diese Oberflächenmarker in der HCT8 Zelllinie wurde beobachtet.

Um die MSC-Phänotyp der beiden OS-CSCs zu bewerten, haben wir auch durchgeführt Durchflusszytometrie-Analysen. Sowohl die OS-CSC Linien ausgedrückt ein hohes Maß an CD44 und CD105. Jedoch der Zellen in beiden Zelllinien, nur 1,14%, ausgedrückt Stro-1. Daher ist diese reSult bestätigte die moderate Anwesenheit von Stro-1, wie durch Immunfluoreszenzfärbung nachgewiesen. Im Gegensatz dazu exprimierten 99,62% des OSA5-KSZ CD44 und 87.38% dieser Zellen exprimiert CD105; 99,88% des OSA6-KSZ exprimierten CD44 in und 95.79% dieser Zellen CD105 exprimiert. Zusätzlich sind beide Zellinien CD45-.

Wir untersuchten die Expression von 3 ESC-Marker (Nanog, 3/4 Oktober, Sox2) und des CD133-Gen, einem anderen CSCs Marker, mittels RT-PCR. Wir haben festgestellt , dass alle diese Gene in beiden OS-CSC Linien (Abbildung 17) ausgedrückt wurden. Die adipogenetische und osteogenen Differenzierungsassays zeigten die Fähigkeit der beiden isolierten OSA-CSC Linien in Osteoblasten (18A - D und 19A - D) zu differenzieren und zu Adipozyten (20A - D).

Weiterhin ist die CFU a ssay (Abbildung 21) zeigte eine gute Rate von klonogenen Effizienz, mit 13% für OSA5-CSCs und 14% für OSA6-CSC. Mehrere neuere Studien haben gezeigt, dass hohe Niveaus von ALDH-Aktivität von verschiedenen Krebsarten charakteristisch sind. Dieser Parameter könnte als Krebsstammzellmarker verwendet werden und ist mit einer schlechten Prognose korreliert. Die ALDH - Aktivitätstest zeigte , dass beide OS-CSC Linien hohe ALDH - Aktivität (22) aufweisen, während ALDH - Aktivität wurde an der unteren quantifizierbare Grenze in der Fibroblastenlinie beobachtet , die als negative Kontrolle in diesem Assay verwendet wurde.

Abbildung 1
Abbildung 1. Beispiele für OS Biopsie - Proben. (A). Biopsy Probe durch Nadelaspiration erhalten. (B). durch chirurgische Resektion von einem Teil der Tumorbiopsieprobe erhalten.884 / 53884fig1large.jpg "target =" _ blank "> Bitte hier klicken, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Mechanische Disaggregation eines OS - Probe. (A) Fragmentation einer Probe mit Perry Pinzette und eine Lanzette. (B) Fragmente in CM suspendiert (durch den Pfeil). Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. Ausrüstung und Verbrauchsmaterial benötigt , um Sarcospheres isolieren. (A). Die gesamte Ausrüstung, die für Zellisolierung. 1. Eine sterile Spritze mit einer sterilen Membranfilterhalter; 2. Zwei verschiedene Medien: GM einnd SCGM; 3. Eine sterile Pipette Glas Pasteur. (B) Detail der Spritze auf einem Träger montiert, mit der Membranfilterhalter. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4. Filtrationseinheit. Mehrere Komponenten benötigt , um die Filtereinheit (A) zu montieren (der Netzfilter ist durch den Pfeil angedeutet). Phasenkontrastbeobachtung der 40 & mgr; m Maschen (mesh einer durch den Pfeil angedeutet ist) des Netzfilter (B). Original-Vergrößerung: 10x. Die Filtrationseinheit zusammengebaut (C - D). Filtrationseinheit sterilisiert (E). Bitte klicken Sie hier um eine größere zu sehen version dieser Figur.

Abbildung 5
Abbildung 5. primären Zellkulturen konventioneller OS. Die Phasenkontrast - Beobachtung von primären Zellkulturen aus hochwertigem OS. In (A) sind mehrere helle Knochenfragmente sichtbar, während in (B), mehrere kleine , runde und schwebenden Erythrozyten vorhanden sind. Original-Vergrößerung: 10x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

Figur 6
Abbildung 6. Herkömmliche Osteosarkom Finite - Zelllinien (OSA). (A) OSA5 und (B) OSA6. Observation in Phasenkontrast.Original-Vergrößerung: 10x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

7
Abbildung 7. Sarcosphere Assay von OSA5 und OSA6. Nach 24 h ab Beginn des Assays wurden die Zellen schwebend und voneinander isoliert (Zellen sind durch Pfeile angedeutet). Beobachtung im Phasenkontrast. Originalvergrößerung. 20X Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

Abbildung 8
Abbildung 8. Sarcosphere Assay von OSA5 und OSA6 bei 7 D. 7 d in den Test, mehrere kleine spherical Kolonien von Einzelzellen umgeben beobachtet werden. Die sarcospheres (einige dieser sarcospheres durch Pfeile gekennzeichnet sind) in dem Medium erscheinen schwimmend oder leicht nach unten in den Boden des Bohrlochs angesiedelt. Beobachtung im Phasenkontrast. Original-Vergrößerung: 20x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

9
Abbildung 9. Sarcosphere Assay von OSA5 und OSA6 bei 28 D. Nach 28 d, mehrere große Bernstein sarcospheres sind in jeder Vertiefung der Platten für jede OSA - Zelllinie, OSA5 (A) und OSA6 (B) beobachtet. Bar Größe: 100 & mgr; m. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen. </ P>

10
Abbildung 10. Passages für die Isolierung von Sarcospheres Die Schritte zur Isolierung von sarcospheres von 6-Well - Ultra-Low - Befestigungsplatten und deren Rekultivierung unter adhärenten Bedingungen gezeigt werden (A) das Gerät alle benötigten für die Isolierung..: 1. Ein 6-Well-Ultra-Low-Platte mit gebildeten sarcospheres in jeder Vertiefung, 2. Spritze mit dem Netto-Filterhalter, 3. Pipette, 4. 1000 ul sterile Spitzen, 5. 2 sterile Perry Pinzette, 6. 2 verschiedene Kulturmedien 7. sterilen Pasteur-Pipette 8. Petrischalen. (B) Sammlung von sarcospheres. Das Medium in jeder Vertiefung enthalten ist, gesammelt, um eine Pipette mit einem sterilen 1000 ul Spitze mit. (C) Sammeln der Suspension in der Spritze. Die gesammelte Suspension wird auf die Spritze überführt die natürliche Filtration Prozess zum Starten des mitMembranfilterhalter. (D) Natürliche Filtration. (E) Auseinanderbauen der Membranfilterhalter aus der Spritze. Nachdem alle die Suspension filtriert wird, wird der Nettofilterhalter auseinandergenommen und in eine Petrischale gegeben; (F) Auseinanderbauen der Membranfilterhalter. Sarcospheres sind in den Poren des Netzfilters in der Netzfilterhalter enthalten sind, so müssen sie die Perry Pinzette befreit werden. (G, H) Die Entfernung von sarcospheres aus dem Membranfilter. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

11
Abbildung 11. Sarcosphere Isolation. Isolierte sarcospheres schweben in dem Medium , in dem 60 mm Petrischale. Beobachtung in der Phasenkontrast.Original-Vergrößerung: 40x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

12
Abbildung 12. Sarcosphere Nach der Isolierung. Sarcospheres von OSA5 (A) und OSA6 (B) Zelllinien zu Beginn der adhärenten Expansion folgende Auswilderungs und Rekultivierung in einer Monoschicht unter adhärenten Bedingungen bei 48 h nach der Isolierung. Beobachtung in der Phasenkontrast. Original-Vergrößerung: 20x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

13 Abbildung 13. Sarcospheres bei 7 D nach der Isolierung. Sarcospheres von OSA5 (A) und OSA6 (B) Zelllinien zeigte anhaftende Expansion folgende Auswilderungs und in einer Monoschicht unter adhärenten Bedingungen bei 7 d nach der Isolierung Rekultivierung. Beobachtung in der Phasenkontrast. Original-Vergrößerung: 20x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

14
Abbildung 14. Immunfluoreszenzanfärbung für CD105. Immunfluoreszenzfärbung für CD105 in den OSA-CSC Linien OSA5-CSCs (A) und OSA6-CSCs (B) und in der kontinuierlichen Zelllinie HCT8 (C), die als negative Kontrolle verwendet wurde. LSCM in herkömmlichen Farb: Grün für CD105 und rot für Zytoskelett. Original-Vergrößerung: 10x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

Abbildung 15
Abbildung 15. Immunfluoreszenzanfärbung für CD44. Immunfluoreszenzfärbung für CD44 in den OSA-CSC Linien OSA5-CSCs (A) und OSA6-CSCs (B) und in der kontinuierlichen Zelllinie HCT8 (C), die als negative Kontrolle verwendet wurde. LSCM in herkömmlichen Farben: grün für CD44 und rot für Zytoskelett. Original-Vergrößerung: 10x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.


Abbildung 16. Immunofluoreszenz - Färbung von Stro1. Immunfluoreszenzfärbung für Stro-1 in den OSA-CSC Linien OSA5-KSZ (A) und OSA6-KSZ (B) und in der kontinuierlichen Zellinie HCT8 (C), die als eine negative verwendet wurde steuern. LSCM in herkömmlichen Farben: grün für Stro-1 und Rot für Zytoskelett. Original-Vergrößerung: 10x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

17
Abbildung 17. Expression von Kern ESC Marker und der CD133 Gene. RT-PCR , welche die Expression von Nanog, Oktober 3/4, Sox2 und CD133 in OSA5-CSCs (A) und in OSA6-CSCs ( Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

18
Abbildung 18. osteogenen Differenzierungs Assay -. Verwendung von Fast Blue BB ALP osteogene Differenzierung bei 0 d (A, B) und nach 10 d (C, D) der Induktion , wie durch zytochemische Färbung für ALP bestimmt. In blau, ALP + Zellen; in rot, counterstained der Kern mit Propidiumiodid. Composite-Beobachtung in Hell- und in Fluoreszenz. Original-Vergrößerung: 20x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

19 Abbildung 19. osteogene Differenzierung Assay -. HA osteogene Differenzierung bei 0 d (A, B) und nach 20 d (C, D) der Induktion wie Hydroxylapatit (HA) durch cytochemischer Färbung bestimmt mit Alizarin Red S. Die Zellen werden kontrastiert in blau / grau, und die körnige Ablagerungen von HA sind rot gefärbt. Beobachtung im Phasenkontrast. Original-Vergrößerung: 40x. Bar Größe:. 100 & mgr; m Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

Abbildung 20
Abbildung 20. adipogenen Differenzierungstest. Adipogenen Differenzierung bei 0 d (A, B) und nach 14 d (C, D) der Induktion , wie durch cytoch bestimmtemical Färbung mit Oil Red O. In rot, die lipidic Vesikel (die größeren Bläschen durch die schwarz / rote Pfeile angedeutet sind, die kleineren Bläschen durch die weißen / schwarzen Pfeile angegeben sind); in blau / violett, die Kerne von Hämatoxylin gegengefärbt. Beobachtung im Hellfeld. Original-Vergrößerung: 40x. Bar Größe:. 100 uM Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

21
Abbildung 21. CFU - Assay. CFU - Assay von OSA-CSC Linien mit Toluidinblau gefärbt. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Abbildung 22 /> Abbildung 22. ALDH - Aktivitätstest. Die farbmetrische ALDH - Test nachgewiesen hohe ALDH - Aktivität in den beiden OS-CSC - Linien, OSA5-CSCs und OSA6-CSCs, während der Test das Fehlen dieser Aktivität in der endlichen differenzierte Zelllinie nachgewiesen von Fibroblasten, FIB. Die Fehlerbalken: SD. **: P <0,001 vs FIB; *:. P <0,01 vs FIB Bitte klicken Sie hier eine größere Version dieser Figur zu sehen.

2 "> CCCAGCTGTGTGTACTCAAT GGTTCAGGATGTTGGAGAGTT
Gen Oligonucleotides Sequence (5¹-3¹) Amplicongröße (bp) Tₐ (° C)
Nanog Forward-Primer Reverse-Primer 87 60
Oktober 02.03 Forward-Primer Reverse-Primer GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 60
Sox2 Forward-Primer Reverse-Primer TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC 125 55
CD133 Forward-Primer Reverse-Primer CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC 127 56
bp, Basenpaare von Amplicongröße; Tₐ, GlühenTemperatur

Tabelle 1. Detaillierte Liste der Primer - Sequenzen für Nanog Okt 3/4, Sox2 und CD133 mit dem Amplicongröße und die Temper - Temperatur

Discussion

KSZ haben mehrere Eigenschaften, die die Identifizierung dieses bestimmten zellulären Untergruppe in der Tumormasse ermöglichen. Auf der Basis dieser Merkmale, wie zum Beispiel eine erworbene Resistenz gegen Chemotherapie Mittel für die Überexpression des ATP-Bindungs - Cassette - multidrug - Efflux - Transporter 28, 32, 33, oder für die Aufregulation der Expression von Entgiftungsenzyme wie ALDH 32, die für die Expression zytotoxisch eines bestimmten Oberflächenmarker, wie beispielsweise CD133, CD44, CD34, CD90 und andere , 30, 34, 35, 41, verschiedene Methoden zu isolieren CSCs wurden 42-44 entwickelt. Eine dieser Techniken ist die Sphäre Bildungstest, der auf der Kapazität des CSCS beruht unter nicht-haftenden Bedingungen zu wachsen.

Die Fähigkeit von Gewebestammzellen und KSZ Kugeln zu bilden wurde zuerst in Studien zur Identifizierung von neuralen Stammzellen von Reynolds et al. 37. Anschließend Gibbs et al. 38 used diese Studien zu isolieren CSCs von soliden Tumoren, insbesondere von Knochensarkomen zu beginnen. Wir haben beschlossen , von Gibbs et al illustriert die Kugelbildung Assay - Verfahren zu verwenden. CSCs von OSA - Zelllinien von herkömmlichen OS - Biopsien erhalten zu isolieren. Wir angepasst ist, die ursprüngliche Methode die Ergebnisse dieses Assays zu verbessern und die Reproduzierbarkeit für andere Krebszelllinien zu erleichtern. Mit Bezug auf die Errichtung der Kugel Bildungstest, überprüften wir, dass Plattierung 40.000 Zellen / Vertiefung eine gute Praxis ist für Zellen in Isolation zu Beginn des Tests beibehalten wird. Dieser Trick ist sehr wichtig, die Möglichkeit, dass die kugelförmigen Kolonien von zellulären Aggregation entstehen zu vermeiden und nicht von der besonderen und exklusiven Kapazität eines einzelnen CSC unter nicht-haftenden Bedingungen zu wachsen und eine sphärische Kolonie bilden. Diese Fähigkeit ist ein besonders kritischer Punkt dieses Assays.

Wir bestätigt, dass auch eine gute Rate der Kugelbildung zu erhaltenIst es ausreichend, Aliquots von Wachstumsfaktoren alle 3 d und nicht jeden Tag zu aktualisieren, wie in der ursprünglichen Methode beschrieben. In dieser Studie haben wir auch und ausführlich beschrieben eine gute Methode, um die kugelförmigen Kolonien zu isolieren, wenn sie unter nicht-haftenden Bedingungen kultiviert, gebildet. Dieser Schritt ist in diesem Assay kritisch, weil es sehr wichtig ist, um zu versuchen, so viele der Kugeln wie möglich zu isolieren, ohne sie zu beschädigen in jeder Vertiefung gebildet sind. Es ist auch wichtig, dass nur die Kugeln und nicht die einzelnen Zellen zu isolieren, die in Suspension für die Dauer des Assays bleiben konnte. Um diese kritischen Punkte zu überwinden, haben wir eine besondere Isolationsmethode entwickelt, die, wie oben gezeigt, gute Ergebnisse für CSC Isolation gab. Offensichtlich gibt es die Möglichkeit, dass nicht alle Bereiche, die wiedergewonnen werden gebildet, aber die Verlustquote sehr gering ist. Tatsächlich haben wir auch die Möglichkeit, einen Filter mit 40 um Poren zu verwenden Sphären zu isolieren, nachdem sie groß werden (Formed etwa 100 bis 200 Zellen).

Diese Trennung stoppt Kugelbildung, sondern erlaubt es, die einzelnen Zellen, ein Teil der Methylrest ist, und die kleinsten Kugeln gefiltert werden. Diese Eliminierung wird durch gründliche Filtration durchgeführt, wie in dem Protokoll beschrieben.

Darüber hinaus ermöglicht die Auswahl der größten kugelförmigen Kolonien durch die 40 & mgr; m mesh mit dem daraus folgenden Verlust der kleinsten kugelförmigen Kolonien eine CSCS mit der höchsten Kapazität auszuwählen kugelförmigen Kolonien zu bilden und mit größerer stemness. Alle diese Modifikationen wurden durchgeführt, den Test zu verbessern und CSCs helfen Forscher untersuchen die kritischste Schritt der ursprünglichen Methode der Kugelbildungstest zu verstehen und zu reproduzieren.

Unter den Studien in vitro - Methoden in Bezug zur Isolierung von CSCs, diese Studie zu zeigen sollen , wie diese angepasst Kugel Bildungstest eine gute Methode zur Isolierung von CSCs könnte ausOSA-Zelllinien. Die Anpassungen der ursprünglichen Methode und der detaillierten Isolationstechnik beschrieben ihre Wirksamkeit zu verbessern. In kurzer Zeit kann eine gute Anzahl KSZ erhalten und für verschiedene Experimente verwendet werden. Daher ist es möglich, die stielartigen Phänotypen und insbesondere schnell bestätigen, das doppelten stielartigen Phänotyp zu untersuchen, die OS-KSZ charakterisiert. So könnte dieser modifizierte Test eine gute Technik für CSCs zu isolieren und ihre Biologie zu studieren. In der Zukunft, wobei dieses Verfahren mit zusätzlichen Anpassungen, auch verwendet werden können CSCs von anderen finite Krebszelllinien von Biopsien von seltenen soliden Tumoren erhalten, zu isolieren.

Die Möglichkeit des CSCS aus seltenen soliden Tumoren, wie beispielsweise OS Isolierung ermöglicht nicht nur die Verbesserung der Studien über diese bestimmte Krebs, sondern erstreckt sich auch auf Untersuchungen von verschiedenen Arten von Krebs bessere Verfahren für ihre Isolierung zu entwickeln und auf zukünftige Studien der Biologie diese wichtige zelluläre Teilmenge. Daher ist, wie wirin dieser Studie gemacht haben, ist es wichtig, die Methoden der CSC Isolation durch das Studium der CSC Biologie, mit dem Endziel der Suche nach molekularen Ziele und die Entwicklung einer sehr spezifischen Anti-Krebs-Therapie gegen diese besondere zelluläre Teilmenge, die wahrscheinlich verantwortlich ist zu verbessern die Aufrechterhaltung des Primärtumors, die Entwicklung ihrer Wiederkehr, und der Ursprung von Metastasen in verschiedenen Organen. Die Studie von CSC Biologie ist auch wichtig für die Suche nach Therapien, die bei der Heilung von Krebs prägnanten sein könnte, wie OS, für die die Überlebensrate nach neoadjuvanter Behandlung bleibt sehr schlecht.

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics