סינתזה ואפיון של prodrug אספירין-fumarate המעכבת תאי גזע סרטניים פעילות השד NFκB

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

דלקת היא סימן היכר סרטן העומד בבסיס שכיחות סרטן וקידום, והתקדמות בסופו של דבר גרור. לפיכך, הוספת תרופה אנטי דלקתית אל גדודי סרטן תקניים לשפר את תוצאת מטופל. תרופה כזו אחת, אספירין (חומצה אצטילסליצילית, אס"א), נחקרה עבור מניעה כימית סרטן ופעילות אנטי-סרטנית. מלבד עיכוב ציר 2-פרוסטגלנדין cyclooxygenase, פעילות אנטי-סרטנית של אס"א גם יוחסו הפקטור הגרעיני ĸB (NFĸB) עיכוב. בגלל שימוש אס"א ממושך עלול לגרום לרעילויות במערכת עיכול, אסטרטגית prodrug יושמה בהצלחה. בשנת prodrug זה לעצב את חומצה קרבוקסילית של אס"א מוסווה ו pharmacophores נוספים משולבים.

פרוטוקול זה מתאר כיצד אנחנו מסונתזים prodrug fumarate האספירין, GTCpFE, ומאופיינת העיכוב של מסלול NFĸB בתאי סרטן שד ההנחתה של סרטן הגבעולי נאהעניבות, פנוטיפ NFĸB התלוי חשוב. GTCpFE ביעילות מעכבת את מסלול NFĸB בשורות תאי סרטן השד ואילו אס"א חסר כל פעילות מעכבת, המציין כי הוספת fumarate למבנה אס"א תורם באופן משמעותי את פעילותה. בנוסף, GTCpFE מראה פעילות תאי גזע נגד סרטן משמעותי על ידי חסימת היווצרות mammosphere ו משפשפים את הסרט CD44 הקשורים תא גזע סרטניים + CD24 - immunophenotype. תוצאות אלו להקים אסטרטגיה מעשית לפיתוח תרופות אנטי-דלקתיות משופרות עבור מניעה כימית וטיפול בסרטן.

Introduction

דלקת היא סימן ההיכר העומד בבסיס מגוון רחב של אספקטים tumorigenesis, כגון שכיחות וקידום, והתקדמות בסופו של דבר גרורות 1. בשנת סרטן השד, זה נתמך גם על ידי תצפיות אפידמיולוגיים מראים כי שימוש קבוע של אספירין תרופה קלאסית סטרואידיות נוגדות דלקת לא סטרואידיות (אצטיל חומצה סליצילית, אס"א) קשורה עם ירידה בשני שכיחות סרטן השד, והסיכון של גרורות והישנות 2,3. אס"א פועל בעיקר על ידי עיכוב cyclooxygenase-2 פעילות, אשר שהוגברה לעתים קרובות בסרטן השד 4,5. עם זאת, ההשפעות האנטי-סרטניות של אס"א יכול להיות גם מתווכת על ידי דיכוי κB הפקטור הגרעיני סוטה (NFκB) איתות 6-8. זה חשוב כי מסלול NFκB deregulated מקדם הישרדות תאי גידול, התפשטות, הגירה, פלישה, אנגיוגנזה, והתנגדות לטיפול 9-11. הפעלת מסלול NFκB הנה עניין מהותי הרכבה תגובה חיסונית. לכן, עבור טיפול נגד סרטן שבו עיכוב NFκB ממושך נדרש, יש לקחת בחשבון את תופעות לוואי מזיקות מעורבות לטווח ארוך דיכוי מערכת חיסוני. לפיכך, אס"א עשוי לשמש נקודת התחלה טובה עבור אופטימיזציה טיפולית.

מגבלה אחת עבור יישום אס"א בטיפול בסרטן היא במינונים הגבוהים הנדרשים cyclooxygenase 2 ועיכוב NFκB, אשר משויכים רעיל במערכת עיכול, כגון כיבים בקיבת דימום 12,13. עם זאת, המרת אס"א לתוך prodrug אסתר כמו, עשוי להפחית רעילות במערכת העיכול של אס"א. כדי לשפר עוד יותר את העוצמה ואת / או להוסיף פונקציונליות, אלמנטים מבניים נוספים או pharmacophores עזר יכול גם להיות משולב בתוך עיצוב prodrug אסתר. Pharmacophore אחד כזה הוסיף כדי לשפר אונות אס"א נגד מסלול NFκB הוא fumarate, אשר בעבר הראינו להיות חשוב עבור עיכוב מסלול NFκB 14,15.

"jove_content"> אנחנו מסונתז prodrug אספירין-fumarate 15, GTCpFE, ואת שיערו כי מולקולה היברידית כזה יהיה בטוח עדיין חזקה נגד מסלול NFκB. בדקנו פעילות אנטי-NFκB שלה בתאי סרטן השד ועל יכולתה לחסום תאי גזע של סרטן השד (CSCS) 15, אשר מסתמכים על NFκB איתות עבור 16-21 הישרדות וצמיחה. אנו מוצאים כי העוצמה של GTCpFE נגד מסלול NFκB הוא השתפר באופן משמעותי על אס"א 15. בנוסף, בלוקים GTCpFE היווצרות mammosphere ו פוחתת CD44 סמן משטח CSC + CD24 - immunophenotype, המציין כי GTCpFE מסוגל בביעור CSCS 15. תוצאות אלו להקים את prodrug האספירין-fumarate כסוכן אנטי דלקתי יעיל כי גם יכול למקד CSCS שד. במונחים של טיפול בסרטן השד, GTCpFE יכול להיות פוטנציאל לטפל מחלה אגרסיבית וקטלנית.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. סינתזה של אספירין-fumarate prodrug GTCpFE

  1. באמצעות מזרק הבוכנה פלסטיק, למדוד 0.81 מ"ל (20 mmol) של מתנול ומערבבים אותו במים (10 מ"ל) בבקבוק תחתית עגולה. מצננים את התערובת המתקבלת ל -0 מעלות צלזיוס על ידי הצבת את הבקבוקון באמבט קרח מים. הוספת אלכוהול: 4-hydroxybenzyl (2.48 מ"ג, 20 מילימול) ומערבבים לתערובת התגובה עד הפתרון הוא ברור.
  2. הכן פתרון של כלוריד O -acetylsalicyloyl (3.77 מ"ג, 19 מילימול) טולואן נטול מים (10 מ"ל) על ידי שקילת את הכמות הרצויה של כלוריד O -acetylsalicyloyl והמסה אותו ממס בבקבוק נפרד. באמצעות מזרק בוכנת פלסטיק, להוסיף את הפתרון הזה לתערובת המוכנה בשלב 1.1, ולהשאיר את תגובת הערבוב ב- C ° 0.
  3. צג התגובה באמצעות כרומטוגרפיה בשכבה דקה (TLC). צלחות TLC צריכות סיליקה כשלב נייח.
    1. הכן שלב נייד שהורכב אתיל יצטט 20:80 (AcOEt) / הקסאן. בתא TLC(או מיכל קטן) להוסיף 5 מ"ל של שלב הנייד כדי לכסות את החלק התחתון של החדר.
      הערה: כמות שלב נייד תלויה בתא שנבחר. תמיד להוסיף מספיק כדי לכסות את החלק התחתון, אבל ברגע TLC ממוקם בתוך, הקו הממס לא צריך לעלות את הגובה שבו התרכובות הם הבחינו.
    2. לקחת דגימה של התגובה עם מזרק (0.2 מ"ל), ומניחים אותו בתוך בקבוקון קטן, לדלל אותו עם אתיל אצטט (2-3 טיפות). עם צופה TLC, בזהירות לקחת דגימה של תערובת התגובה המדוללת להבחין בו TLC.
      הערה: כתמים צריך להיות מ"מ 1-2 ואת זה צריך להיעשות על 1/4 אינץ התחתון של הצלחת TLC.
    3. באותו TLC, ניתן לבחור מיקום של פתרון של כלוריד O-acetylsalicyloyl (0.2 מ"ג 0.5 מ"ל של אתיל אצטט) לצורך השוואה. לאחר כתמים יבשים, למקם אותו בתא ולתת לו לרוץ עד לחזית ממס כמעט הגיע לראש של TLC.
    4. קח את TLC החוצה, ולתת לו להתייבש ולדמיין אותו תחת מנורת UV. reaction תושלם כאשר במקום כלוריד O -acetylsalicyloyl נעלם מתערובת התגובה.
    5. כאשר התגובה הושלמה, הסר את אמבט מים-קרח, ולאפשר את התגובה ומערבבים בטמפרטורת החדר למשך 20 שעות.
  4. סנן את המשקע באמצעות משפך בוכנר עם דיסק fritted של נקבוביות בינוניות. מניח את המוצק בתוך בקבוקון נצנץ, ולהשאיר את המתחם ב vacuo לילה ייבוש בטמפרטורת חדר. השתמש pentoxide זרחן (P 2 O 5) כמו יבוש.
  5. יבש בבקבוק תחתי עגול על ידי צבת אותו בתנור על 80 מעלות צלזיוס במשך ימים לפחות לפני הגדרת התגובה הזו. לחלופין, לאטום את הבקבוק עם מחץ ו לנקב אותה במחט מחוברת למערכת משאבת ואקום. סובב את משאבת הוואקום על ולייבש את הבקבוק באמצעות אקדח חום. אפשר לקרר, וחזור על שלב זה פי 2 יותר.
  6. לנפח בלון באמצעות גז ארגון, ולחבר אותו מזרק פלסטיק (h בוכנה אשרכמו הוסר) עם מחט. כבה את משאבת הוואקום ולהסיר את המחט הקשורה אליו כי הוכנסה הבקבוק התחתי העגול עכשיו יבשים. הכנס את המחט מחוברת לבלון הארגון דרך מחצה איטום הבקבוק התחתי העגול.
    1. להוסיף אסתר 4-hydroxymethylphenol של חומצה 2-acetyloxybenzoic (100 מ"ג, 0.349 mmol), 4-dimethylaminopyridine (4 מ"ג, 0.033 mmol) ו triethylamine (53 מ"ג, 0.523 mmol) בבקבוק נפרד, ואז התפוגג אותם tetrahydrofuran נטול מים (5 מ"ל). עם מזרק פלסטיק מחובר מחט, להוסיף את הפתרון הזה אל הבקבוק התחתי העגול האטום. מצננים את התערובת עד 0 ° C על ידי הנחת הבקבוק באמבט מי קרח.
  7. לתערובת הקודמת, להוסיף פתרון של כלוריד אתיל fumaroyl (68 מ"ג, 0.419 mmol) ב tetrahydrofuran נטול מים (5 מ"ל), נפתח חכם על פני תקופה של 10 דקות. מערבבים את הפתרון שהתקבל ב- C 0-5 מעלות במשך 2-4 שעות.
  8. חלץ את תערובת התגובה עם אתיל אצטט (100 מ"ל) מלח (50 מ"ל). <br /> הערה: בריין הוא פתרון רווי של נתרן כלורי (NaCl). כדי להכין אותו, למקם 200 מ"ל מים במיכל זכוכית נקי ואז להתחיל להוסיף NaCl (תוך ערבוב) עד שהוא אינו מתמוסס יותר.
    1. לאחר חילוץ, להסיר את השלב המימי וחזור על השלב האחרון עוד פעמים.
    2. ייבש את התערובת על ידי הוספת נתרן גופרתי לשלב האורגני, עד המוצק אינו גוש מעלה כאשר הזכוכית הוא בחש. שימוש אחר משפך בוכנר עם דיסק fritted, לסנן את התערובת בבקבוק תחתי עגול להסיר את נתרן גופרתי, ונמוג ליובש באמצעות מאייד סיבובי עם הטמפרטורה נקבעת על 40 מעלות צלזיוס.
  9. באמצעות TLC, לקבוע בשלב נייד ראוי להשתמש ב כרומטוגרפיה בעמודה.
    הערה: לצורך ניסוי זה שיפוע של 20:80 AcOEt / הקסאן היה בשימוש.
  10. הכין עמודה עם ג'ל סיליקה ואת שלב הממס המתאים. לאחר במתחם נוסף, להוסיף שכבה של נתרן גופרתי (או חול) ל- PRotect בעמודה כמו הממס מתווספת.
    1. בעוד טור פועל, לפקח על eluate ידי TLC. ספוט כל מבחנה אחרת כפי שהם נאספים מהעמודה. כאשר מוצר העניין elutes, מערבב את כל הדגימות המכילות מוצר טהור לתוך בקבוק תחתי עגול גדול, ולייבש אותם באמצעות מאייד סיבובי עם הטמפרטורה באמבטיה נקבעה על 40 מעלות צלזיוס.
      הערה: מוצר אמור להופיע בתור לבן מוצק.
  11. כדי לאשר את המבנה של GTCpFE, לאסוף פרוטון ופחמן (1 H ו- 13 C, בהתאמה) תהודה מגנטית גרעינית (NMR) ספקטרה לפי הוראות היצרן.
    הערה: במחקר זה 400 MHz FT NMR ספקטרומטר שימש לאיסוף 1 H ו- 13 ספקטרום C. לרוץ לפחות 25 סריקות בטמפרטורת החדר כדי להשיג רזולוציה מספיק נתונים. פסגות NMR שנצפו היו הבאה, 1 H NMR (CDCl 3): δ 1.29 (t, 3 ח ', י 3 = 7.0 הרץ, CH 3); 2.31 (ים, 3 H, CH 3); 4.26 (q, 2 H, 3J = 7.0 הרץ, COOCH 2); 5.25 (ים, 2 H, Och 2); 6.89 (ים, 2 H, HC = CH); 7.19 (מ ', 3 ח', Ar); 7.42 (מ ', 3 ח', Ar); 7.65 (מ ', 1 H, Ar); 8.22 (dd, 1 H, 3J = 7.8, 4J = 1.2 הרץ, Ar). 13 C תמ"ג (CDCl 3) δ: 169.70, 164.86, 164.75, 162.89, 151.28, 150.69, 134.76, 134.32, 133.26, 133.16, 132.25, 129.81, 126.26, 124.11, 122.47, 122.04, 66.40, 61.43, 21.05, 14.15.
  12. בנוסף, לאסוף ספקטרום המוני ברזולוציה גבוהה באמצעות ספקטרומטריית מסת כרומטוגרפיה נוזלית בשילוב עם מלכודת יונים וטכנולוגית טיסת הזמן של (LCMS-IT-TOF) עבור מדידות מסה מדויקות לפי הוראות יצרן.
    הערה: במחקר זה (M + NH 4 +) מחושב: 430.1496; נצפה: 430.1477.

2. GTCPFE מעכב את פעילות NFĸB בתאי סרטן השד

  1. Cell תנאי תרבות
    1. לשמור על שורות תאי סרטן שד אנושיים, MCF-7 ו מד"א- MB-231 לפי מבוי סתום תאים סטנדרטייםטכניקות ture ולהרבות חממה humidified על 37 מעלות צלזיוס עם 5% CO 2.
      1. הכן המדיום הסלולרי MCF-7 מ מכון הזיכרון רוזוול פארק (RPMI) 1640 בינוני עם פנול אדום בתוספת 10% בסרום שור העובר (FBS), 1% חומצות אמינו לא חיונית, 2 מ"מ L- גלוטמין, אנטיביוטיקה 1%, סטרפטומיצין פניצילין , ו -6 ng / ml אינסולין. הכן המדיום הסלולרי מד"א- MB-231 מ בינוני Essential Minimum משופר (IMEM) השלימו עם FBS 5%, 1% חומצות אמינו לא חיונית, 2 מ"מ L- גלוטמין ו -1% אנטיביוטיקה, סטרפטומיצין פניצילין.
  2. NFκB-RE Assay כתב בלוציפראז
    1. Trypsinize סרטן השד MCF-7 תאים באמצעות טריפסין 0.25% במשך 5 דקות ב 37 מעלות צלזיוס, לספור ידנית באמצעות hemocytometer זרע 24 גם צלחות ב 90,000 תאים לכל צפיפות היטב.
    2. למחרת, שיתוף transfect תאים עם פלסמיד דנ"א של אלמנט תגובה NFκB (NFκB-RE) לבנות בלוציפראז, 1 מיקרוגרם / טוב, אלאונג עם מבנה בלוציפראז promoterless Renilla, 0.2 מיקרוגרם / היטב. בצע transfections לכל קבוצת טיפול בשלושה עותקים.
      1. פעמיים שטפו תאים עם PBS, ו דגירה עם תערובות של DNA פלסמיד 1 μl לכל גם מגיב transfection (למשל lipofectamine) תקשורת חופשית בסרום. לאחר 6 שעות, לשנות את בינוני עד 1 מ"ל של מדיום רגיל (ללא אנטיביוטיקה מסוג פניצילין וסטרפטומיצין).
    3. לאחר 16 שעות, להוסיף 1 μl של רכב או פתרונות מניות שונים של GTCpFE או תרופות אס"א היטב כל אחד. ממסי פתרונות מניות תרופה (100, 50, 20, 10 ו 1 מ"מ) ב sulfoxide דימתיל בריכוז 1,000x. לאחר הוספת התרופות, דגירת תאים עבור שעה 2 ב 37 מעלות צלזיוס.
    4. להפעלת מסלול NFκB, מוסיפים את ציטוקינים פרו-דלקתיים TNFα (10 מיקרוגרם / מ"ל ​​פתרון המניות) לבאר כל ריכוז סופי של 10 ng / ml ו דגירה של 4 שעות. כלול שליטה TNFα לבד. לשאוב את המדיום ולאחסן התאים ב -80 מעלות צלזיוס.
    5. מדוד בלוציפראז באמצעות מערכת assay כתב בלוציפראז פי הוראות היצרן.
      הערה: בעת שימוש במערכת assay בלוציפראז (מערכת assay למשל Dual בלוציפראז) בפעם הראשונה, להכין פתרון של מגיב assay בלוציפראז על ידי מחדש השעייתו ב 10 מ"ל של חיץ ואחסונו ב -80 מעלות צלזיוס aliquots 1 מ"ל.
      1. הכן חיץ תמוגה 1x ידי דילול חיץ מניות 5x עם מים. Lyse תאים בכל שימוש גם 100 μl חיץ 1x תמוגה. דגירת הצלחות על שייקר מסלולית במשך 15 דקות, במהירות בינונית.
      2. לייבל אחד 1.5 מ"ל צינור לדגימה. מגיב assay בלוציפראז להפשיר לטמפרטורת החדר (50 μl לדגימה יהיה צורך) ולשמור בנייר כסף. הכן מגיב מרווה 1x בבקבוקון זכוכית, 01:49 דילול במאגר מערבולת זה (50 μl לדגימה יהיה צורך).
      3. הוסף 10 μl של lysate לתא צינור microcentrifuge שכותרתו. לאחר מכן להוסיף 50 μl של מגיב assay בלוציפראז ובעדינות מערבולת. מייד לאחר מכן, במקום הצינור בבעל ולמדוד את ההארה באמצעות התכנית בלוציפראז הכפולה של luminometer. בחר ולחץ על הבא: Glo הכפול → פרוטוקולי הפעלת Promega → אישור.
      4. הוסף 50 μl של מגיב המרווה אל מבחנת מערבולת בעדינות. מדוד את ההארה. חזור על שלבים אלה עבור כל דגימה.
      5. ניתוח נתונים באמצעות גיליון אלקטרוני על ידי נרמול NFκB-RE הבקרה הפנימית Renilla (NFκB-רי / Renilla). השוואת נתונים מעכב לשליטה רק TNFα (TNFα רק מוגדר ב 100%).
  3. שעתוק הגנים NFκB-Target
    1. MCF-7 זרע תאים 6 צלחות גם ב 250,000 תאים לכל היטב נפח בינוני 2 מ"ל מוכן כמתואר בסעיף 2.1.
    2. למחרת, להוסיף 2 μl של מניות שונות GTCpFE 1,000x (100, 50, 20, 10 ו 1 מ"מ) עבור 2 שעות לפני הוספת מ"ל / 10ng TNFα עוד 2 שעות. הפעל כל טיפולבשלושה עותקים. כלול רכב ובקרות לבד TNFα.
    3. לבודד RNA באמצעות שיטת החילוץ פנול, כלורופורם thiocyanate guanidinium פי הוראות היצרן 22. קביעת ריכוז RNA (ב diethylpyrocarbonate (DEPC) מים -treated) וטוהר RNA באמצעות ספקטרופוטומטר. שמור דגימות רנ"א על ​​קרח או בחנות ב -80 ° C. השתמש בעצות מחסום RNase ללא רק בעת טיפול RNA.
    4. הפוך לתמלל 0.5 מיקרוגרם RNA סך באמצעות ערכה זמינה מסחרי של transcriptase הפוכה וירוס לוקמיה בעכברי Moloney (M-MLV).
      הערה: הערכה כוללת 5x חיץ dithiothreitol (DTT), יחד עם תערובת dNTP, תערובת hexamers אקראי.
      1. הוסף 0.5 מיקרוגרם של RNA ל -200 יחידות של M-MLV, 0.5 מ"מ dNTPs, 100 ננוגרם של hexamers אקראי, 10 מ"מ DTT, 1x חיץ ומים DEPC לנפח התגובה 10 μl הסופי. לבצע את התגובה transcriptase הפוכה באמצעות Cycler PCR עבור 50 דקות ב 37 מעלות צלזיוס, ולאחר מכן 15 דקות ב 70 &# 176; C לחום-לנטרל את האנזים.
    5. לדלל את המוצר cDNA וכתוצאה מכך עד 100 μl עם מים מזוקקים פעמיים ולהשתמש 2 μl לכל תגובת שרשרת פולימראז כמותיים עוקבות (PCR) התגובה.
      1. מערבבים קדימה לאחור תחל עבור הגן של עניין ברמה של 1.25 ריכוז מיקרומטר אחד. להכין תערובת הורים עם 2 μl כפולים מים מזוקקים, 1 μl של 1.25 מיקרומטר תערובת פריימר 5 μl של 2x של הצבע כדי לאפשר זיהוי של הדנ"א הדו-גדילית. טען את 2 μl של cDNA ו -8 μl של תמהיל מאסטר לתוך צלחות PCR 96-היטב.
    6. ביצוע PCR כמותי באמצעות מערכת ה- PCR בזמן אמת (40 מחזורים, 95-60 ° C) על פי הוראות היצרן ולנתח את הנתונים באופן ידני.
      הערה: כל פריימרים PCR בשימוש אומתו שדווח בעבר 23.
    7. לחשב עודף לקפל ביטוי גנים באמצעות גיליון אלקטרוני באמצעות שיטת ΔΔCt, עם ריבוזומלי חלבון 36MRNA B4 משמש בבקרה הפנימית 23.

3. GTCpFE מעכב תאי גזע סרטן השד במבחנה

  1. Assay גיבוש Mammosphere
    1. הכן mammosphere (MS) בינוני על ידי משלים בינוני הנשר שונה של Dulbecco: מזין תערובת F-12 (DMEM / F12) פנול אדום בינוני ללא עם תאית מתיל 1%. אפשר לפזר על ידי רעד עדין הלילה ב 4 מעלות צלזיוס. סנן לעקר הבינוני להשלים עם B27 1x, 1% פניצילין סטרפטומיצין, 5 מיקרוגרם / מ"ל ​​אינסולין, 1 מיקרוגרם / מ"ל ​​הידרוקורטיזון, ו 20 ng / ml גורם הגדילה באפידרמיס רקומביננטי אנושי.
    2. כן תאים בודדים של שורת תאי מד"א- MB-231 על ידי טריפסין עיכול (טריפסין 0.25% במשך 5 דקות ב 37 מעלות צלזיוס) של תרבויות monolayer ולסנן דרך מסננות רשת. באופן ידני לספור יחיד תאים ניתקים צלחת צלחות מצורפות אולטרה-נמוכות 96-גם בצפיפות של 400 תאים / היטב. למחרת, להוסיף ריכוזים שונים של GTCpFE (למשל, ריכוזי GTCpFE סופיים: 1, 10, 20, 50 מיקרומטר) לנפח סופי של 100 μl. התנהגות כל טיפול בשלושה עותקים.
    3. לאחר 7 ימים של תרבות בחממה, לרכוש תמונות באמצעות תוכנת הדמיה באמצעות מיקרוסקופ הפוכה. באופן ידני לספור את מספר MS> 75 מיקרומטר קוטר. השווה את הטיפול התרופתי לשליטה ברכב.
      הערה: הקוטר של MS> 75 מיקרומטר נקבע באמצעות תוכנת ההדמיה.
  2. CD44 + CD24 - CSC immunophenotype
    1. Trypsinize תאים מד"א- MB-231 עם טריפסין 0.25% במשך 5 דקות ב 37 מעלות צלזיוס. הרוזן באמצעות hemocytometer זרע 10 מנות ס"מ ב 3 מיליון תאים לכל צלחת ב 10 מ"ל בינוני כמפורט בסעיף 2.1. הוסף רכב (sulfoxide דימתיל 10 μl) או GTCpFE (10 μl של 50 מניות מ"מ) לתאים למשך 72 שעות.
    2. עבור קבוצות הטיפול ברכב או GTCpFE, תאים trypsinize (כמו בשלב 3.2.1) ולהפיץ 1 מיליון תאים ב 'מבחן & #39; או צינורות קלקר 5 מ"ל 'בקרה' המכיל 2 מ"ל של תמיסת מלח מאוזן של 1x האנק (HBSS) חיץ בתוספת 2% FBS.
    3. כדי להכתים עבור CD44 סמני פני שטח CD24, תאי ספין למטה ולהוסיף 20 μl של כל נוגדן מצומדות HBSS + 2% FBS כדי לבדוק את צינורות עבור נפח הכולל 100 μl הסופי (1: 5 דילול). הוספת 100 μl של HBSS + 2% FBS לשלוט צינורות. כלול נוגדן מצומדות CD44-APC נוגדני CD24-PE שולטים כתם יחיד או בקרות immunoisotype IgG.
    4. דגירת תאים בחושך על 4 מעלות צלזיוס למשך 30 דקות. ספין למטה התאים למשך 5 דקות ב 400 XG ולגבש מחדש ב 200 μl חיץ HBSS עם 2% FBS. שמור את התאים על הקרח בחושך.
    5. בצע מיון תא מופעל קרינה (FACS) של תאי חיים באמצעות מכשיר מנתח FACS פי הוראות היצרן. אסוף לפחות 50,000 אירועים עבור כל צינור. טיפולים לרוץ בשלושה עותקים.
      הערה: Gating מבוסס על בקרות מאף מכתים (Control צינור), immunoisotypes IgG, ואת CD44-APC וכתמים יחיד CD24-PE.
    6. ניתוח נתונים באמצעות תוכנת cytometry הזרימה זמינה.
      הערה: אחוז תאים שטופלו GTCpFE עם CD44 + CD24 - immunophenotype מוערך ולעומת שליטה ברכב.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

באיור 1, את המבנה הכימי של prodrug אספירין-fumarate, GTCpFE, ופעילות הדיכוי שלו על ציטוקינים המושרה מסלול NFĸB בתאי סרטן השד מסומנים. GTCpFE מעכב שתי נקודות הקצה NFĸB, NFĸB-RE פעילות בלוציפראז (איור 1B) וביטוי של גני מטרה NFĸB, כגון אינטר הדבקה מולקולה 1 (ICAM1), chemokine CC מוטיב ליגנד 2 (CCL2), ואת הגידול נמק פקטור (TNF) (איור 1C) בתאי סרטן השד MCF-7. מחושב ריכוז מעכבות ב -50% (50 IC) ערך על שתי נקודות הקצה הוא ~ 20 מיקרומטר. ערך 50 IC מחושב באמצעות תוכנת גרפים. לשם השוואה אס"א עצם אפילו ב 200 מיקרומטר (10x IC 50 של GTCpFE) מראה שום פעילות מעכבת (האיור 1B, קו כחול) בתאי סרטן השד. זה מצביע על כך את האסטרטגיה prodrug של הוספת pharmacophore fumarate כדי אס"א significantly משפר את הפעילות האנטי-NFĸB שלה.

כדי למדוד את הפעילות האנטי-CSC, השתמשנו בשני מבחנים: את mammosphere (MS) assay היווצרות ואוכלוסיית תאים המבטאים את CD44 + CD24 - immunophenotype, סמן משטח CSC בתום לב ב סרטן השד 24. GTCpFE מעכב היווצרות טרשת נפוצה של תאי סרטן השד מד"א- MB-231 באופן תלוי מינון שניתן לראות בתרשים 2A. בדומה עיכוב מסלול NFĸB בתרבויות חסידות, ערך 50 IC עבור היווצרות mammosphere הוא ~ 20 מיקרומטר. עקביות זו צפויה, בהתחשב בכך CSCS להסתמך על NFĸB איתות להישרדות התפשטות 16-21. בנוסף, טיפול קדם GTCpFE הביא דלדול משמעותי של CD44 + CD24 - האוכלוסייה (איור 2 ב) בתאים מד"א- MB-231. יחד, תוצאות אלה לבסס את היכולת של GTCpFE למקד השד CSCS ביעילות.

איור 1
איור 1: GTCpFE מעכב את מסלול NFĸB בתאי סרטן השד. (א) המבנה הכימי של prodrug אספירין-fumarate, GTCpFE. - ג) MCF-7 תאים היו שטופלו מראש עבור 2 שעות עם ריכוזים שונים של GTCpFE, אס"א, או רכב ואחריו טיפול עם TNFα (10 ng / ml) במשך 2-4 שעות. (ב) NFκB-RE פעילות נמדדה על ידי assay כתב בלוציפראז כפול. הביטוי (C) של גני מטרה NFκB, ICAM1, CCL2 ו- TNF נמדדה על ידי RT-QPCR. פעילות התרופה מעכבת זממה כמו% של TNFα לבד. הנתונים מוצגים כממוצע ± SEM. נתון זה יש הבדל בין התייחסות 15. אנא לחץ כאן כדי להציג גרסה גדולה יותר של figu זהמִחָדָשׁ.

איור 2
איור 2: GTCpFE מעכב היווצרות mammosphere ואת CD44 + CD24 - immunophenotype בתאי סרטן השד. (א) Mammosphere (MS) היווצרות של תאים מד"א- MB-231 נמדדה לאחר הטיפול עם ריכוזים שונים של GTCpFE. כימות של צמיחת MS (משמאל) ותמונות נציג MS ב 20X (מימין) מוצגת. השפעת GTCpFE זממה כמו שליטה ברכב%. (ב) CD44 + CD24 - האוכלוסייה נקבע על ידי ניתוח FACS של תאים מד"א- MB-231 מטופלים עם 50 מיקרומטר GTCpFE במשך 72 שעות. כימות של כל אחוז אוכלוסייה (משמאל) מגרש פיזור נציג FACS (מימין) מוצגת. הנתונים מוצגים כממוצע ± SEM וניתוח סטטיסטי של 2-way ANOVA follשחב posttest Tukey. *** P <0.001. נתון זה יש הבדל בין התייחסות 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics