Sintesi e caratterizzazione di un profarmaco Aspirina-fumarato che inibisce NFκB attività e della mammella cellule tumorali staminali

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

L'infiammazione è un segno distintivo di cancro che sta alla base l'incidenza del cancro e la promozione, e la progressione alla fine di metastasi. Pertanto, l'aggiunta di un farmaco anti-infiammatorio per reggimenti standard per il cancro può migliorare l'esito dei pazienti. Uno di questi farmaci, l'aspirina (acido acetilsalicilico, ASA), è stato esplorato per la chemioprevenzione del cancro e l'attività anti-tumorale. Oltre inibendo la ciclossigenasi asse 2-prostaglandine, le attività anti-cancro di ASA sono anche stati attribuiti a fattore nucleare ĸB (NFĸB) inibizione. Poiché l'uso ASA prolungato può causare tossicità gastrointestinale, una strategia profarmaco è stata implementata con successo. In questo profarmaco progettare l'acido carbossilico di ASA viene mascherato e pharmacophores aggiuntivi sono incorporati.

Questo protocollo descrive come abbiamo sintetizzato un profarmaco aspirina-fumarato, GTCpFE, e caratterizzato la sua inibizione del percorso NFĸB nelle cellule di cancro al seno e attenuazione del cancro stelo-come correttacravatte, un importante fenotipo NFĸB-dipendente. GTCpFE inibisce in modo efficace il percorso NFĸB nelle linee di cellule di cancro al seno, mentre ASA è priva di qualsiasi attività inibitoria, che indica che l'aggiunta di fumarato alla struttura ASA contribuisce in modo significativo alla sua attività. Inoltre, GTCpFE mostra significativa l'attività delle cellule staminali anti-cancro, bloccando la formazione di mammosphere e attenuando la associati CD44 delle cellule staminali del cancro + CD24 - immunofenotipo. Questi risultati stabiliscono una strategia praticabile per sviluppare farmaci anti-infiammatori migliorate per la chemioprevenzione e terapia del cancro.

Introduction

L'infiammazione è una caratteristica che sta alla base molteplici aspetti della tumorigenesi, come ad esempio l'incidenza e la promozione, e la progressione alla fine di metastasi 1. Nel carcinoma mammario, questo è ulteriormente supportata da osservazioni epidemiologiche mostrano che l'uso regolare della classica aspirina farmaci non steroidei anti-infiammatori (acido acetilsalicilico, ASA) è associato ad una riduzione sia del seno incidenza del cancro, e il rischio di metastasi e recidive 2,3. ASA agisce principalmente inibendo l'attività della cicloossigenasi-2, che è spesso upregulated nel cancro della mammella 4,5. Tuttavia, gli effetti anti-cancro di ASA possono essere mediati da sopprimere aberrante fattore nucleare kB (NFκB) di segnalazione 6-8. Questo è importante perché un percorso NFκB deregolamentato promuove la sopravvivenza delle cellule tumorali, la proliferazione, la migrazione, l'invasione, angiogenesi, e la resistenza alla terapia 9-11. attivazione della via NFκB è essenziale anche per il montaggiouna risposta immunitaria. Pertanto, per la terapia anti-cancro in cui è richiesta l'inibizione NFκB prolungato, si deve considerare gli effetti collaterali negativi coinvolgono duratura soppressione immunitaria. Quindi, ASA può servire come un buon punto di partenza per l'ottimizzazione terapeutica.

Una limitazione per l'applicazione ASA nella terapia del cancro è dosi elevate richieste per cicloossigenasi 2 e l'inibizione NFκB, che sono associati con la tossicità gastrointestinale, come ulcere e sanguinamento dello stomaco 12,13. Tuttavia, la conversione in ASA profarmaco come estere, può ridurre la tossicità gastrointestinale di ASA. Per migliorare ulteriormente la potenza e / o aggiungere funzionalità, elementi strutturali aggiuntive o pharmacophores accessori possono altresì essere incorporati nella progettazione estere profarmaco. Uno di questi farmacoforico aggiunto per migliorare la potenza ASA contro il percorso NFκB è fumarato, che abbiamo già dimostrato di essere importante per NFκB via inibizione 14,15.

15, GTCpFE, e ipotizzato che tale molecola ibrida sarebbe stato al sicuro ancora potente contro il percorso NFκB. Abbiamo testato la sua attività anti-NFκB nelle cellule di cancro al seno e la sua capacità di bloccare le cellule staminali del cancro al seno (CSC) 15, che si basano su NFκB segnalazione per la sopravvivenza e la crescita 16-21. Troviamo che la potenza del GTCpFE contro il percorso NFκB è notevolmente migliorata nel corso ASA 15. Inoltre, blocca la formazione GTCpFE mammosphere e attenua il CSC marcatore di superficie CD44 + CD24 - immunofenotipo, indicando che GTCpFE è in grado di sradicare CSC 15. Questi risultati stabiliscono il profarmaco aspirina-fumarato come agente anti-infiammatorio efficace che può anche riguardare CSC seno. In termini di terapia del cancro al seno, GTCpFE potrebbe avere il potenziale per il trattamento di malattia aggressiva e letale.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Sintesi di Aspirina-fumarato Prodrug GTCpFE

  1. Utilizzando una siringa stantuffo di plastica, misura 0,81 ml (20 mmoli) di metanolo e mescolare in acqua (10 ml) in un pallone a fondo tondo. Raffreddare la miscela risultante a 0 ° C ponendo il pallone in un bagno di ghiaccio-acqua. Aggiungere alcool 4-idrossibenzil (2,48 mg, 20 mmol) e mescolare la miscela di reazione fino a quando la soluzione è chiara.
  2. Preparare una soluzione di cloruro O -acetylsalicyloyl (3,77 mg, 19 mmoli) in toluene anidro (10 ml) pesando la quantità desiderata di cloruro O -acetylsalicyloyl e dissoluzione nel solvente in un pallone separato. Utilizzando una siringa stantuffo di plastica, aggiungere questa soluzione del composto preparato al punto 1.1, e lasciare la reazione sotto agitazione a 0 ° C.
  3. Monitorare la reazione utilizzando cromatografia su strato sottile (TLC). Le piastre TLC dovrebbero avere silice come fase stazionaria.
    1. Preparare una fase mobile costituita da 20:80 acetato di etile (AcOEt) / esano. In una camera TLC(O piccolo contenitore) aggiungere 5 ml di fase mobile per coprire il fondo della camera.
      NOTA: La quantità di fase mobile dipende dalla camera selezionata. Aggiungere sempre sufficiente a coprire il fondo, ma una volta che la TLC è posto all'interno, la linea di solvente non deve superare l'altezza in cui vengono individuati i composti.
    2. Prelevare un campione della reazione con una siringa (0,2 ml), posizionarlo in una piccola fiala, e diluire con acetato di etile (2-3 gocce). Con un spotter TLC, fare attenzione un campione della miscela di reazione diluita e spot nel TLC.
      NOTA: Le macchie dovrebbero essere di 1-2 mm e questo dovrebbe essere fatto al minore di 1/4 di pollice della piastra TLC.
    3. Sulla stessa TLC, posizionare un punto di una soluzione di cloruro O-acetylsalicyloyl (0,2 mg in 0,5 ml di acetato di etile) come confronto. Una volta che le macchie sono secche, posizionarlo nella camera e farlo funzionare fino a che il fronte del solvente ha quasi raggiunto la parte superiore del TLC.
    4. Prendere la TLC fuori, lasciare asciugare e visualizzarlo sotto una lampada UV. il REACzione è completa quando il punto di cloruro O -acetylsalicyloyl scompare dalla miscela di reazione.
    5. Quando la reazione è completa, rimuovere il bagno di ghiaccio-acqua, e lasciare che la reazione di agitazione a temperatura ambiente per 20 ore.
  4. Filtrare il precipitato usando un imbuto Buchner con un disco poroso di porosità media. Posizionare il solido in una fiala di scintillazione, e lasciare il composto sotto vuoto durante la notte in un essiccatore a temperatura ambiente. Utilizzare anidride fosforica (P 2 O 5) come essiccante.
  5. Essiccare un pallone a fondo rotondo ponendolo in un forno a 80 ° C per almeno due giorni prima di impostare questa reazione. In alternativa, sigillare il pallone con un setto e forare con un ago che è collegato ad un sistema di pompa a vuoto. Ruotare la pompa di aspirazione e asciugare il matraccio con una pistola termica. Lasciare raffreddare e ripetere questo passaggio altre 2 volte.
  6. Gonfiare un palloncino con gas argon, e collegarlo a una siringa di plastica (il cui stantuffo hcome stato rimosso) con un ago. Spegnere la pompa a vuoto e rimuovere l'ago ad esso che è stata inserita nel pallone a fondo rotondo ormai essiccato. Inserire l'ago collegato al pallone argon attraverso il setto di tenuta del pallone a fondo tondo.
    1. Aggiungere 4 hydroxymethylphenol estere dell'acido 2-acetyloxybenzoic acid (100 mg, 0,349 mmoli), 4-dimetilaminopiridina (4 mg, 0,033 mmoli) e trietilammina (53 mg, 0.523 mmol) in un pallone separato, quindi sciolto in tetraidrofurano anidro (5 ml). Con una siringa di plastica attaccata ad un ago, aggiungere questa soluzione al pallone a fondo rotondo sigillato. Raffreddare la miscela fino a 0 ° C ponendo il recipiente in un bagno di acqua ghiacciata.
  7. Alla miscela precedente, aggiungere una soluzione di cloruro di etile fumaroyl (68 mg, 0,419 mmoli) in tetraidrofurano anidro (5 ml), goccia a goccia nell'arco di 10 min. Agitare la soluzione risultante a 0-5 ° C per 2-4 ore.
  8. Estrarre la miscela di reazione con acetato di etile (100 ml) e con soluzione salina (50 ml). <br /> NOTA: Salamoia è una soluzione satura di cloruro di sodio (NaCl). Per prepararlo, posizionare 200 ml di acqua in un recipiente di vetro pulito quindi avviare aggiungendo NaCl (agitando) finché non si dissolve più.
    1. Dopo l'estrazione, si preleva la fase acquosa e ripetere il secondo passaggio altre due volte.
    2. Essiccare la miscela aggiungendo solfato di sodio nella fase organica, finché il solido non ammassarsi quando il vetro viene agitata. Utilizzando un altro imbuto Buchner con un disco poroso, filtrare la miscela in un pallone a fondo rotondo per rimuovere il solfato di sodio, poi evaporare a secco mediante un evaporatore rotativo con la temperatura impostata a 40 ° C.
  9. Utilizzando una TLC, determinare una fase mobile appropriata da utilizzare per cromatografia su colonna.
    NOTA: Per questo esperimento è stato utilizzato un gradiente di 20:80 AcOEt / esano.
  10. Preparare una colonna con gel di silice e la fase solvente appropriato. Una volta che il composto è stato aggiunto, aggiungere uno strato di solfato di sodio (o sabbia) per protect viene aggiunto alla colonna come solvente.
    1. Come colonna corre, monitorare l'eluato dalla TLC. Spot ogni altra provettone sono raccolti dalla colonna. Quando il prodotto di interesse eluisce, miscelare tutti i campioni contenenti il ​​prodotto puro in una grande pallone a fondo rotondo, e asciugare utilizzando un evaporatore rotante con la temperatura del bagno fissata a 40 ° C.
      NOTA: Il prodotto dovrebbe apparire come un solido bianco.
  11. Per confermare la struttura del GTCpFE, raccogliere protone e carbonio (1 H e 13 C, rispettivamente) spettri di risonanza magnetica nucleare (NMR) secondo le istruzioni del produttore.
    NOTA: In questo studio uno spettrometro FT NMR 400 MHz è stato utilizzato per raccogliere il 1 H e 13 C spettri. Esegui almeno 25 scansioni a temperatura ambiente per ottenere la risoluzione dei dati abbastanza. I picchi NMR osservati sono stati i seguenti, 1 H NMR (CDCl 3): δ 1,29 (t, 3 H, 3J = 7,0 Hz, CH 3); 2,31 (s, 3 H, CH 3); 4.26 (q, 2 H, 3J = 7,0 Hz, COOCH 2); 5,25 (s, 2 H, OCH 2); 6.89 (s, 2 H, HC = CH); 7,19 (m, 3 H, Ar); 7,42 (m, 3 H, Ar); 7,65 (m, 1 H, Ar); 8,22 (dd, 1H, 3J = 7.8, 4J = 1.2 Hz, Ar). 13 C NMR (CDCl 3) δ: 169.70, 164.86, 164,75, 162.89, 151.28, 150.69, 134.76, 134.32, 133.26, 133.16, 132.25, 129.81, 126.26, 124.11, 122.47, 122.04, 66.40, 61.43, 21.05, 14.15.
  12. Inoltre, raccogliere uno spettro di massa ad alta risoluzione utilizzando HPLC-MS in combinazione con trappola ionica e che richiede tempo della tecnologia di volo (LCMS-IT-TOF) per misure di massa accurate come da istruzioni del produttore.
    NOTA: In questo studio (M + NH 4 +) calcolato: 430,1496; osservato: 430,1477.

2. GTCPFE Inibisce la NFĸB attività nelle cellule tumorali del seno

  1. COLTURE CELLULARI Condizioni
    1. Mantenere linee di cellule umane di cancro al seno, MCF-7 e MDA-MB-231 come da cul cella standardtecniche ture e propagarsi in un incubatore umidificato a 37 ° C con 5% di CO 2.
      1. Preparare medio cellule MCF-7 da Roswell Park Memorial Institute (RPMI) 1640 con rosso fenolo integrato con siero 10% bovino fetale (FBS), aminoacidi non essenziali 1%, 2 mM L-glutammina, 1% di antibiotici penicillina streptomicina e 6 ng / ml di insulina. Preparare medio delle cellule MDA-MB-231 da Migliorata Minimum Essential Medium (IMEM) integrato con il 5% FBS, aminoacidi non essenziali 1%, 2 mM L-glutammina e l'1% di antibiotici di penicillina-streptomicina.
  2. NFκB-RE reporter luciferasi Assay
    1. Trypsinize cancro mammario MCF-7 cellule utilizzando 0,25% tripsina per 5 min a 37 ° C, il valore manualmente utilizzando un emocitometro e seme in piastre da 24 pozzetti a 90.000 cellule per densità bene.
    2. I seguenti cellule giorno, co-trasfezione con il plasmide DNA di un elemento di risposta NFκB (NFκB-RE) luciferasi costrutto, 1 mg / e, along con il promoterless Renilla luciferasi costrutto, 0,2 mg / pozzetto. Eseguire trasfezioni per ciascun gruppo di trattamento in triplice copia.
      1. Lavare le cellule due volte con PBS, e incubare con miscele di DNA plasmidi e 1 ml per pozzetto di trasfezione del reagente (ad es Lipofectamine) in media liberi siero. Dopo 6 ore, cambiare il mezzo per 1 ml di terreno normale (senza antibiotici penicillina e streptomicina).
    3. Dopo 16 ore, aggiungere 1 ml di veicolo o di diverse soluzioni di riserva della GTCpFE o droghe ASA a ciascun pozzetto. Sciogliere soluzioni droga stock (100, 50, 20, 10 e 1 mm) in dimetilsolfossido a 1,000x concentrazione. Dopo l'aggiunta dei farmaci, incubare le cellule per 2 ore a 37 ° C.
    4. Per attivare il percorso NFκB, aggiungere la citochina pro-infiammatoria TNF (10 mg / ml di soluzione) in tutti i pozzetti per una concentrazione finale di 10 ng / ml e incubare per 4 ore. Includere un controllo solo TNF. Aspirare il mezzo e memorizzare la cellas a -80 ° C.
    5. Misurare luciferasi utilizzando un sistema di analisi giornalista luciferasi in base alle istruzioni del produttore.
      NOTA: Quando si usa il sistema di dosaggio luciferasi (ad esempio sistema di dosaggio doppio Luciferase) per la prima volta, preparare una soluzione di luciferasi reagenti del dosaggio da ri-sospensione in 10 ml di tampone e riporlo a -80 ° C in aliquote di 1 ml.
      1. Preparare tampone di lisi 1x diluendo 5x magazzino tampone con acqua. Lisare le cellule in ogni 100 microlitri di buffer 1x lisi bene usando. Incubare le piastre su un agitatore orbitale per 15 minuti, a velocità media.
      2. Etichettare una provetta 1,5 ml per campione. Scongelare dosaggio reagenti luciferasi a temperatura ambiente (saranno necessari 50 ml per campione) e conservare in un foglio. Preparare 1x reagente tempra in un flacone di vetro, 01:49 diluizione nel buffer e vortici che (saranno necessari 50 ml per campione).
      3. Aggiungere 10 ml di lisato cellulare in una provetta etichettata. Quindi aggiungere 50 ml di reagente di test luciferasi edelicatamente vortice. Subito dopo, porre la provetta in un supporto e misurare la luminescenza tramite il programma di doppia luciferasi in luminometro. Selezionare e premere il seguente: Run Promega protocolli → doppio Glo → OK.
      4. Aggiungere 50 ml di reagente tempra nella provetta e delicatamente vortice. Misurare la luminescenza. Ripetere questi passaggi per ogni campione.
      5. Analizzare i dati utilizzando fogli di calcolo normalizzando NFκB-RE per il controllo interno Renilla (NFκB-RE / Renilla). Confronto inibitori dati a TNF solo il controllo (solo TNF è fissato al 100%).
  3. NFκB-Target trascrizione genica
    1. Seed cellule MCF-7 a 6 pozzetti a 250.000 cellule per pozzetto in 2 ml di volume medio preparate come descritto nel paragrafo 2.1.
    2. Il giorno seguente, aggiungere 2 ml di diverse GTCpFE 1,000x scorte (100, 50, 20, 10 e 1 mm) per 2 ore prima di aggiungere TNF-alfa 10ng / ml per un altro 2 ore. Esegui ogni trattamentoin triplice copia. Include veicolo e da solo controlli TNF-alfa.
    3. Isolare l'RNA utilizzando il metodo di estrazione guanidinio tiocianato-fenolo-cloroformio secondo le istruzioni del produttore 22. Determinare la concentrazione di RNA (in dietilpirocarbonato (DEPC) acqua -treated) e la purezza di RNA utilizzando uno spettrofotometro. I campioni di RNA in ghiaccio o conservare a -80 ° C. Utilizzare solo puntali RNasi-free durante la manipolazione di RNA.
    4. Reverse trascrivere 0,5 mg RNA totale utilizzando un kit disponibile in commercio di Moloney murine leukemia virus (M-MLV) trascrittasi inversa.
      NOTA: Il kit comprende 5x buffer e ditiotreitolo (DTT), insieme con la miscela dNTP, e la miscela di esameri casuali.
      1. Aggiungere 0,5 mg di RNA a 200 unità di M-MLV, 0,5 mM dNTP, 100 ng di esameri casuali, 10 mM DTT, 1x tampone e acqua DEPC ad un volume finale di reazione 10 microlitri. Effettuare la reazione trascrittasi inversa utilizzando un cycler PCR per 50 min a 37 ° C, e poi 15 min a 70 &# 176; C per riscaldare-inattivare l'enzima.
    5. Diluire il prodotto cDNA risultante a 100 microlitri con acqua bidistillata e utilizzare 2 microlitri per ogni successiva reazione reazione a catena della polimerasi quantitativa (PCR).
      1. Mescolare in avanti e retromarcia primer per il gene di interesse a 1.25 micron concentrazione ciascuno. Preparare una master mix con 2 ml di acqua distillata doppia, 1 ml di 1,25 micron miscela di primer e 5 ml di 2x del colorante per attivare il rilevamento del DNA a doppia elica. Caricare i 2 ml di cDNA e 8 ml di master mix in 96 pozzetti PCR.
    6. Effettuare PCR quantitativa utilizzando un sistema PCR in tempo reale (40 cicli, 95-60 ° C) secondo le istruzioni del produttore e analizzare i dati manualmente.
      NOTA: Tutte le primer PCR utilizzati sono stati convalidati e riportato in precedenza 23.
    7. Calcola l'espressione del gene fold change utilizzando fogli di calcolo tramite il metodo ΔΔCt, con ribosomiale proteina 36MRNA B4 che funge da controllo interno 23.

3. GTCpFE inibisce le cellule staminali del cancro della mammella in vitro

  1. Mammosphere saggio Formazione
    1. Preparare mammosphere (MS) medio, completandolo Modified Eagle Medium di Dulbecco: Nutrient Mixture F-12 (DMEM / F12) fenolo rosso medio-libero con 1% metilcellulosa. Lasciar sciogliere delicatamente agitando notte a 4 ° C. Filtro sterilizzare il medium e integrare con B27 1x, 1% di penicillina e la streptomicina, 5 mg / ml di insulina, 1 mg / ml di idrocortisone, e 20 ng ml / fattore ricombinante umano di crescita epidermico.
    2. Preparare singole cellule della linea di cellule MDA-MB-231 dalla tripsina digestione (tripsina 0,25% per 5 min a 37 ° C) di colture monostrato e filtrare attraverso setacci a maglia. contare manualmente cellule dissociate singola e piastra in piastre da 96 pozzetti fissaggio ultra-bassa ad una densità di 400 cellule / pozzetto. Il giorno successivo, aggiungere diverse concentrazioni di GTCpFE (ad esempio, le concentrazioni finali GTCpFE: 1, 10, 20, 50 mM) in un volume finale è di 100 microlitri. Condurre ogni trattamento in triplice copia.
    3. Dopo 7 giorni di coltura nell'incubatrice, acquisire immagini tramite un software di imaging utilizzando un microscopio invertito. contare manualmente il numero di MS> 75 micron di diametro. Confrontare il trattamento farmacologico di controllo del veicolo.
      NOTA: Il diametro di MS> 75 micron è determinato utilizzando il software di imaging.
  2. CD44 + CD24 - CSC Immunofenotipo
    1. Trypsinize MDA-MB-231 cellule con 0,25% tripsina per 5 min a 37 ° C. Conte utilizzando un emocitometro e le sementi in 10 piatti cm a 3 milioni di cellule per piatto in 10 ml di mezzo come descritto nel paragrafo 2.1. Aggiungere veicolo (10 ml dimetilsolfossido) o GTCpFE (10 ml di 50 mM magazzino) per le cellule per 72 ore.
    2. Per i gruppi di veicoli o di trattamento GTCpFE, trypsinize cellule (come nel passaggio 3.2.1) e distribuire 1 milione di cellule in 'Test & #39; o 5 ml provette di polistirene 'di controllo' contenente 2 ml di soluzione salina bilanciata di Hank 1x (HBSS) Buffer integrato con il 2% FBS.
    3. Per colorare per l'marcatori di superficie CD44 e CD24, le cellule spin down e aggiungere 20 ml di ogni anticorpo coniugato e HBSS + 2% FBS per Provette per una finale di 100 microlitri volume complessivo (diluizione 1: 5). Aggiungere 100 ml di HBSS + 2% FBS al controllo tubi. Includi CD44-APC anticorpo coniugato e anticorpi CD24-PE controlli singoli o macchia i controlli immunoisotype IgG.
    4. Incubare le cellule al buio a 4 ° C per 30 min. Spin le cellule per 5 min a 400 xg e ricostituire in 200 microlitri tampone HBSS con 2% FBS. Mantenere cellule in ghiaccio al buio.
    5. Eseguire fluorescenza-attivato l'ordinamento delle cellule (FACS) di cellule vive con uno strumento analizzatore FACS secondo le istruzioni del produttore. Raccogliere almeno 50.000 eventi per ogni tubo. trattamenti analizzato in triplicato.
      NOTA: Soppressione si basa su controlli da nessuna colorazione (Cotubo ntrol), immunoisotypes IgG, e il CD44-APC e le macchie singole CD24-PE.
    6. Analizzare i dati utilizzando un software di citometria a flusso disponibile.
      NOTA: La percentuale di cellule GTCpFE-trattati con il CD44 + CD24 - immunofenotipo è stimato e confrontato con il controllo del veicolo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Nella figura 1, la struttura chimica di aspirina-fumarato profarmaco, GTCpFE, e la sua attività inibitoria sulle citochine indotta percorso NFĸB nelle cellule di cancro al seno sono indicati. GTCpFE inibisce entrambi gli endpoint NFĸB, NFĸB-RE attività luciferasi (Figura 1B) e l'espressione di NFĸB geni bersaglio, come la molecola di adesione intercellulare 1 (ICAM1), chemochine CC Motif Ligand 2 (CCL2), e fattore di necrosi tumorale (TNF) (Figura 1C) in cellule MCF-7 di cancro al seno. Calcolato concentrazione di inibizione al 50% (IC 50) valore su entrambi i parametri è ~ 20 micron. IC50 valore viene calcolato utilizzando un software di grafica. In confronto ASA sé anche a 200 micron (10x IC 50 di GTCpFE) non mostra alcuna attività inibitoria (Figura 1B, linea blu) nelle cellule del cancro al seno. Questo indica che la strategia profarmaco di aggiungere fumarato farmacoforico ad ASA significamigliora nte la sua attività anti-NFĸB.

Per misurare l'attività anti-CSC, abbiamo utilizzato due saggi: il mammosphere (MS) saggio di formazione e la popolazione di cellule che esprimono il CD44 + CD24 - immunofenotipo, una buona marcatore di superficie bona CSC nel cancro della mammella 24. GTCpFE inibisce la formazione MS di MDA-MB-231 cellule di cancro al seno in modo dose-dipendente mostrato nella Figura 2A. Simile a NFĸB inibizione percorso nelle culture aderenti, il valore di IC 50 per la formazione mammosphere è ~ 20 micron. Si prevede questa coerenza, dato che si affidano a CSC NFĸB segnalazione per la sopravvivenza e la propagazione 16-21. Inoltre, GTCpFE pretrattamento determinato una significativa deplezione del CD44 + CD24 - popolazione (Figura 2B) in MDA-MB-231 cellule. Insieme, questi risultati stabiliscono la capacità di GTCpFE di indirizzare in modo efficace CSC seno.

Figura 1
Figura 1: GTCpFE inibisce il percorso NFĸB nelle cellule del cancro al seno. (A) La struttura chimica del profarmaco aspirina-fumarato, GTCpFE. (B - C) cellule MCF-7 sono stati pre-trattati per 2 ore con varie concentrazioni di GTCpFE, ASA o veicolo seguita da trattamento con TNF (10 ng / ml) per 2-4 ore. Attività (B) NFκB-RE è stata misurata con doppio saggio giornalista luciferasi. (C) Espressione di NFκB geni bersaglio, ICAM1, CCL2 e TNF è stata misurata mediante RT-QPCR. Drug attività inibitoria è tracciata come% del TNF-alfa da solo. I dati sono presentati come media ± SEM. Questa cifra è stata modificata dal riferimento 15. Clicca qui per vedere una versione più grande di questa figuri.

figura 2
Figura 2: GTCpFE inibisce la formazione mammosphere e il CD44 + CD24 - immunofenotipo a cellule del cancro al seno. (A) Mammosphere (MS) formazione di MDA-MB-231 cellule è stato misurato dopo il trattamento con concentrazioni variabili di GTCpFE. La quantificazione della crescita MS (a sinistra) e le immagini rappresentative della SM a 20X (a destra) sono mostrati. L'effetto di GTCpFE è tracciata come il controllo del veicolo%. (B) L'CD44 + CD24 - la popolazione è stata determinata mediante analisi FACS di MDA-MB-231 cellule trattate con 50 mM GTCpFE per 72 ore. La quantificazione di ciascuna percentuale della popolazione (a sinistra) e grafici a dispersione rappresentativi da FACS (a destra) sono mostrati. I dati sono presentati come media ± SEM ed analisi statistica di ANOVA a 2 vie folldovuta da Tukey post-test. *** P <0.001. Questa cifra è stata modificata dal riferimento 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics