Интернет эксклюзионной и ионообменной хроматографии на МУРР пучкового

1Structural Biology Group, European Synchrotron Radiation Facility, 2European Molecular Biology Laboratory, 3School of Chemical and Physical Sciences, Keele University, 4Groupe de Microscopie Electronique et Méthodes, Institut de Biologie Structurale
Published 1/05/2017
0 Comments
  CITE THIS  SHARE 
Biochemistry
 

Summary

Определение структуры раствора белка с помощью малоуглового рассеяния рентгеновских лучей (МУРР) требует монодисперсных образцов. Здесь мы представляем две возможности, чтобы обеспечить минимальные задержки между подготовки проб и сбора данных: онлайн с исключением по размеру хроматографии (SEC) и онлайн ионообменной хроматографии (IEC).

Cite this Article

Copy Citation

Brennich, M. E., Round, A. R., Hutin, S. Online Size-exclusion and Ion-exchange Chromatography on a SAXS Beamline. J. Vis. Exp. (119), e54861, doi:10.3791/54861 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Биологический малый угол рассеяния рентгеновских лучей (BioSAXS) является мощным средством в области молекулярной и структурной биологии используется для определения структуры раствора, размера и формы частиц, а также отношение поверхности к объему макромолекул. Методика применима к очень широким разнообразием условий решений , охватывающих широкий диапазон концентраций, значений рН, ионной силы, температуры, добавки и т.д., но образец должен быть монодисперсных. Это предостережение привело к реализации жидких систем-хроматографии на МУРР beamlines. Здесь мы описываем вверх по течению интеграции исключением по размеру (SEC) и ионообменной хроматографии (IEC) на пучкового, различные методы для оптимального вычитание фона и сокращение данных. В качестве примера, мы опишем, как мы используем втор- и IEC-SAXS на фрагменте основной вирус коровьей белка D5, состоящий из домена D5N геликазной. Мы определяем его общую форму и молекулярную массу, показывая гексамерных структуру йе белка.

Introduction

BioSAXS является мощным инструментом для определения формы наноразмерных объектов 1-4. Рассеяние рентгеновских лучей раствором, содержащим макромолекулы, размера в диапазоне нм, регистрируется при очень малых углах. Этот угловой диапазон содержит информацию о глобальных параметров: радиуса инерции; наибольшее расстояние внутричастичного; форма частиц; и степень складывания, денатурации или расстройства. Методика не требует кристаллов, а макромолекула остается в растворе и , таким образом , могут быть сохранены в условиях , имитирующих некоторые важные параметры клетки, такие как ионная сила, рН и т.д. Знание этих факторов может помочь определить, например, физиологически соответствующие олигомерные состояние интересующего белка или для проверки предложенной модели комплекса. Характеристика белок-белковых взаимодействий в различных буферных условиях, создание моделей недостающих доменов, уточнение моделей гомологии и депрекращение дискретных свернутых и развернутых состояний может быть выполнена быстро и легко 5.

Как и с любой техникой, BioSAXS имеет внутренние слабости: агрегированные или денатурированные образцы, смеси частиц, гетерогенные образцы, радиационных повреждений и буфер рассогласования может привести к не-интерпретируемых данных. Для многих методов анализа, неявно предполагается, что образец монодисперсных, причем это требование зачастую трудно получить на практике. Во многих случаях деградация образца является тонким и не может быть обнаружен в данных по своей собственной, и любая попытка интерпретировать данные дает неточные или даже ошибочные результаты. Для преодоления этих препятствий, сочетание размера вытеснительной хроматографии (SEC) и МУР была реализована на многих beamlines для обеспечения качества данных и сделать эту технику более доступной для более сложных образцов 6-11. Недавно мы добавили новый метод в репертуар путем разработки онлайн-ионного обменахроматографии (IEC) -coupled МУРР 12. Обе технологии открывают SAXS для широкого спектра биологических частиц, ранее невозможно анализировать. Выбор используемого способа зависит от биофизических свойств частиц, представляющих интерес.

SEC разделяет макромолекулы по их размеру, причем, по меньшей мере, 10% разницы в кажущейся молекулярной массы, необходимой для разделения. Физические ограничения столбца и физиологических свойств образцов, как гидрофобных поверхностей, гибкость и отсутствие стабильности, а также осложнить сбор данных, анализ и интерпретацию.

Ионообменная хроматография, которая отделяет молекулы на основе их заряда и, следовательно, их аффинность связывания с колонкой IEC, могут быть использованы вместо или в дополнение к SEC. Полный заряд может быть легко манипулировать путем изменения рН или изменения концентрации соли в буфере,, обеспечивая относительно простой метод контролируемой эльсоциологическое загрязнение молекул из колонки IEC. Используя заряд, разделение подобных типов и размеров молекул, которые иначе были бы трудно отделить, могут быть выполнены обычно с МЭК. Кроме того, МЭК имеет то преимущество, что в состоянии справиться с разбавленных образцов, позволяя избежать стадии концентрирования, которые несут потенциальный риск денатурации белка. К сожалению, поскольку распределение заряда сильно выборки зависит, МЭК требует оптимизации в отношении рН и концентрации соли 13,14.

Для многих белков, которые трудно выразить, очистить, или оба, только низкие количества образца доступны для изучения. Важно, чтобы быть эффективными и свести к минимуму количество стадий очистки, и, следовательно, потери. По этой причине последний этап очистки в Интернете непосредственно до сбора данных МУРР, с тем чтобы повысить вероятность сбора хорошего набора данных.

ВотМы представляем и сравнить онлайн SEC-SAXS и IEC-SAXS. Оба метода были реализованы на BioSAXS пучкового BM29 на европейском синхротронного излучения (ESRF) в Гренобле, Франция 15. В качестве тестового примера, мы использовали D5N и хеликазную домен белка вируса коровьей D5, который был довольно трудно анализировать конструктивно с использованием других методов. Вирус коровьей оспы является членом семьи Poxviridae и 98% идентична вируса натуральной оспы, причиной оспа. Используя систему коровьей, мы изучаем механизм репликации, сосредоточив здесь на существенной хеликаза-праймаза D5.

Д5 представляет собой белок 95-кДа с N-концевым Archeo-эукариотической праймаза (AEP) доменов 16 , за которым следует область цистеин кластера (Рез. 240-345) 16. Далее по направлению к С-концу приходит домена D5N (Рез. 340-460), который всегда связан с геликаз Д5 типа, и , наконец , суперсемейством 3 (SF3) хеликаза домена (Рез. 460-785) 17 (Figurе 1А). Домен хеликаза из D5 строит гексамерных кольцевую структуру, которая необходима для плотного связывания с ДНК. Благодаря последним исследованиям МУРР и ЭМ, структуры с низким разрешением о праймаза и геликазы домены В настоящее время известны 18.

Здесь мы покажем, как использовать реализованные онлайновые методы хроматографии на BioSAXS пучкового BM29 в ESRF, чтобы получить представление о структуре С-концевого фрагмента (остаток 323-785) из D5.

Protocol

1. Описание автономной подготовки и образца Генерация белка D5 Удаления

Примечание: Д5 323-785 конструкция (Фигура 1А) , был клонирован, выраженный, и очищали , как описано 18.

  1. Клонирование конструкцию в вектор pProEx HTB
    1. Выполните полимеразной цепной реакции (ПЦР) на D5R, используя '-5'-3 ATGCAAGCTTTTACGGAGATGAAATATCCTCTATGA и' праймеров 5'-GCGCCATGGGTAATAAACTGTTTAATATTGCAC-3 и реакционную смесь ПЦР с полимеразой, следуя указаниям производителя.
    2. Очищают фрагменты ПЦР с помощью спиновых столбцов, следуя указаниям производителя.
    3. Дайджест фрагментов ПЦР и плазмиду с NcoI и HindIII ферментами рестрикции, в соответствии с рекомендациями изготовителя для композиции буфера и времени инкубации.
    4. Запуск фрагментов на агарозном геле 1% в 0,5 × ТАЕ буфере (20 мМ Трис, 10 мМ уксусной кислоты,и 0,5 мМ ЭДТА) и окрасить гель с красителем ДНК.
    5. Expose гель УФ-излучения.
      Внимание: Использовать средства индивидуальной защиты! Вырежьте полосы расщепленных фрагментов ПЦР и переваривается плазмиды и очищают ДНК с использованием набора спина колонны очистки гель, в соответствии с рекомендациями производителя.
    6. Перевязывать очищенных ПЦР-фрагментов в плазмиды с использованием набора для лигирования быстро, в соответствии с рекомендациями производителя.
    7. Transform с помощью теплового шока продукт от реакции лигирования в оптимизированные для амплификации плазмиды компетентных бактерий.
      1. Добавьте половину лигирования продукта к ампуле бактерий.
      2. Инкубируют реакционную пробирку на льду в течение 20 мин.
      3. Инкубируйте пробирку при 42 ° С в течение 30 сек.
      4. Поместите пробирку на льду в течение 2 мин.
      5. Добавить 1 мл Лурии Бертани (LB) Бульон (Миллер) без антибиотиков и пусть клетки восстанавливается при температуре 37 ° С в течение 1 ч.
      6. Спин вниз клетки при 16,100 XG Foг 3 s в настольном микропробирок центрифуге и удалить большую часть среды.
      7. Распространение клеток на чашку с агаром LB с ампициллином (50 мкг / мл Конечное) и пусть колонии растут при 37 ° С в течение ночи.
    8. Поместите колонию в 3 мл LB с ампициллином (50 мкг / мл Конечное) и выращивать культуру при 37 ° С, встряхивая при 160 оборотах в минуту в течение ночи.
    9. Следуйте инструкциям комплекта минипрепаративную для извлечения плазмиды.
    10. Отправить образец плазмиды для секвенирования и анализа последовательности для отсутствии мутаций и для правильной вставки.
    11. Преобразуем pProEx HTB D5 323-785 построить в бактерии , оптимизированные для экспрессии белка (используйте 1 мкл и следуйте инструкциям , приведенным в шаге 1.1.7). Распространение бактерий на агаровой пластине LB с ампициллином (50 мкг / мл Конечное).
    12. Для создания исходной культуры, положить одну колонию в 300 мл LB с ампициллином (50 мкг / мл конечного) и выращивать бактерии при температуре 37 ° С, встряхивая при 160 гвечера в течение ночи.
  2. Инокулируйте 12 х 1 л LB в присутствии ампициллин (50 мкг / мл , конечная), каждый из которых имеет 20 мл pProEx HTB Д5 323-785 бактерий закваски при 37 ° С до OD 600 с = 0,3 не будет достигнута. Уменьшить температуру до 18 ° C , и индуцируют экспрессию при OD 600 = 0,5 с помощью 1 мМ IPTG. Инкубируйте культур, встряхивая их при 160 оборотах в минуту и ​​18 ° С в течение ночи.
  3. Урожай бактерий путем центрифугирования при 50000 х г и при температуре 4 ° С в течение 30 мин. Ресуспендируют бактериальных гранул в приблизительно 150 мл буфера для лизиса (50 мМ Трис-HCl [pH 7], 150 мМ NaCl, 5 мМ MgCl 2, 10 мМ β-меркаптоэтанола, и 10% глицерина) с ингибитором 1х протеазы и 25 единиц ( U) / 10 мл ДНКазы. Лизировать бактерии через озвучивания на льду (1-дюймового зонда, 50% мощности, 0,5-х импульсов, 0,5-s пауза, 3x 5 мин).
  4. Загрузите супернатанта на никелевом сродства колонке (Ni-колонки, 1,5 мл объем слоя), и промойте его с 10 объемами колонки (CV) Ьinding буфер (50 мМ Трис-HCl [pH 7], 150 мМ NaCl, 10 мМ β-меркаптоэтанола, и 10% глицерина), 10 CV промывочного буфера (50 мМ Трис-HCl [pH 7], 1 М NaCl, 10 мМ β-меркаптоэтанола, 10% глицерина) и 10 CV имидазола стирке (50 мМ Трис-HCl [pH 7], 150 мМ NaCl, 10 мМ β-меркаптоэтанола, 10% глицерина, и 30 мМ имидазола). Элюируют Д5 323-785 (20 мМ Трис-HCl [pH 7], 150 мМ NaCl, 10 мМ β-меркаптоэтанола, 10% глицерина, и 200 мМ имидазола).
  5. Проверьте различные этапы очистки с помощью додецилсульфата натрия (SDS) -polyacrylamide гель-электрофореза (PAGE).
    1. Нагрузка 2-20 мкл каждой стадии очистки потока через смешанный с красителем 1x (2x: 4% SDS, 20% глицерина, 120 мМ Трис-HCl [рН 6,8], и 0,02% вес / объем бромофенолового синий) на 10 % SDS гель и запустить их на 200 в в 1х Laemmli проточном буфере (25 мМ Трис, 0,192 М глицина и 0,1% SDS).
    2. Пятно гель с готовым к употреблению раствором Кумасси синим.
  6. отлвисящий буфер элюированного белка с буфером для связывания с использованием колонки обессоливания в соответствии с инструкцией завода-изготовителя.
  7. Сколите His-тег, добавив Tobacco Etch Virus ядерного включения-а эндопептидазы (ТРВ, 1 мг / 100 мг белка) к раствору белка. Инкубируют при комнатной температуре в течение ночи.
  8. Проверьте пищеварение, выполняя SDS-PAGE (см шаг 1.5)
  9. Равновесие на Ni-колонку в буфере для связывания. Пусть раствор белка проходят через и мыть шарики с 2 CV имидазольного буфера для промывки во время сбора проточные.
  10. Концентрат белка с использованием центробежного концентратора до конечного объема 0,5 мл.
  11. Вводят концентрированного белка на колонку вытеснительной, уравновешенную буфером для гель-фильтрации (20 мМ Трис-HCl [рН 7], 150 мМ NaCl, 10% глицерина и 1 мМ дитиотреитола [ДТТ]).
  12. Соберите проточный в 0,5-мл фракции.
  13. Проверьте наличие и чистоту белка в пиковых образцах путемвыполняя SDS-PAGE (см шаг 1.5).
  14. Объединяют фракции элюированного пика Д5 323-785. Развести образца до 25 мМ NaCl и 5% глицерина при сохранении концентрации Трис и DTT постоянной (в течение 5 мл раствора белка в 20 мМ Трис-HCl [рН 7], 150 мМ NaCl, 10% глицерина и 1 мМ DTT, первый добавляют 5 мл 20 мМ Трис-HCl, рН 7 [] и 1 мМ DTT, а затем добавляют 20 мл 20 мМ Трис-HCl [рН 7], 5% глицерина и 1 мМ DTT).
  15. Загрузите образец на колонку ионообменной. С помощью буфера А (20 мМ Трис [рН 7], 25 мМ NaCl, 5% глицерина и 1 мМ ДТТ) и буфер В (20 мМ Трис [рН 7], 1 М NaCl, 5% глицерина и 1 мМ DTT), с образованием соли градиент от 25 мМ до 1 М.
  16. Сбор элюированного белка в 1,5 мл фракции.
  17. Проверьте наличие и чистоту белка в пиковых образцах, выполняя SDS-PAGE (см шаг 1.5 и рисунок 1В)
  18. Reconcentrate раствора белка в центробежном концентраторе до конечного объема 0,5 мл.
  19. ReruN концентрированный белок на гель-фильтрационной колонке для гель-фильтрации в буфере (20 мМ Трис-HCl [рН 7], 150 мМ NaCl, 5% глицерина и 1 мМ DTT; см этап 1.11).

2. Сбор данных

Примечание: Запрос времени луч как можно раньше. Для ESRF, рекомендации по типам имеющихся доступа и о том, как подать заявку можно найти по адресу:
http://www.esrf.eu/UsersAndScience/UserGuide/Applying . После принятия предложения и приглашения для эксперимента все участники должны пройти инструктаж по технике безопасности. После проверки тренинга, заполнить "А-формы" (через пользовательский портал ESRF) объявить исследователей, посещающие пучкового для эксперимента, наряду с необходимой информацией по безопасности на образцах. Свяжитесь с местным контактным лицом, чтобы обсудить эксперимент.

  1. Сбор данных SEC-МУРР
    ПРИМЕЧАНИЕ: Для получения ONLочистка ине, использовать систему хроматографии высокоэффективной жидкостной (ВЭЖХ), установленного на BM29. Система состоит из поточного дегазатора, бинарной насос, клапан для выбора буфера и градиентов, автосамплера, УФ-VIS photospectrometer массива, и кондуктометра. Он напрямую подключен к проточным капилляра блока 19 экспозиции МУРР.
    1. Поместите 1 мл буфера гель-фильтрации в сторону. Подключите буферную бутылку к системе SEC (по умолчанию порт A).
    2. Выбор скорости потока в зависимости от столбца в использовании. Примечание: Для столбца вытеснительной используемого здесь, скорость потока составляет 0,1 мл / мин. Определить максимальное давление для колонны, принять к сведению обратного давления, а также установить время приобретения, по крайней мере, 1,2 CV.
    3. Промывка насосов и вверх по течению трубы с помощью функции "автоматического" продувки.
    4. Подождите, пока система не будет заполнена с буфером и подключить колонку. Равновесие колонку путем пропускания по меньшей мере, 1,5 CV.
    5. блокировкаклетку и измерить буфер отмененного в шаге 2.1.1, с помощью смены образцов для контроля изменения сигнала из-за радиационного повреждения. Только продолжаться, если нет радиационных повреждений в буфер.
    6. Включите систему управления пучкового в режим высокоэффективной жидкостной хроматографии. Сделайте пробный прогон буфера, собирая 200 кадров с 1 сек на кадр. Запишите число отсчетов данных с помощью детектора в суммарном интенсивности участка.
      Примечание: Сигнал должен соответствовать ранее измеренного буфера, а суммарная интенсивность с течением времени должно оставаться постоянным. Если сигнал не соответствует или не является постоянной величиной, большей уравновешивание системы требуется.
    7. Спин вниз образца при 13000 мкг в настольный микропробирок центрифуге в течение по крайней мере 10 мин.
    8. Заполнить образец в стеклянную пробирку для ВЭЖХ-совместимый (прилагается) и поместить его в автоматический инжектор. Обратите внимание на положение скважины.
    9. Скрестите экспериментальную клетку, используя стандартную процедуру, как описано в инструктаж по технике безопасности пользователя.
    10. Войдите в и создать папку для хранения данных с помощью программного обеспечения управления пучкового.
    11. Программирование системы высокоэффективной жидкостной хроматографии с помощью "быстрого пакетного" функцию. Установить место хранения для УФ-данных в папку, созданную на шаге 2.1.10. Убедитесь в том, чтобы активировать автоматическое преобразование ASCII УФ данных, хранения файла ASCII в той же папке.
      1. Выберите объем впрыска и положение скважины. Добавить измерение в очередь, нажав на кнопку "Пуск". Программа попросит сохранить партию. Подготовка к экономии, но не нажимайте на кнопку "Сохранить", так как это автоматически запускает измерение.
    12. Настройка параметров сбора данных в программном обеспечении управления пучкового. Выберите количество кадров, так что общее время сбора данных в небольшом избытке по времени приобретения, определенной на этапе 2.1.2.
    13. Откройте затвор безопасности и начать сбор данных МУР с помощью программного обеспечения управления пучкового. Убедитесь в том, что данные являются корвильно приобрела. Сравните вновь собранные данные с данными, собранными на этапе 2.1.6 и убедитесь, что число отсчетов в суммарном интенсивности остается постоянной в течение по крайней мере 100 кадров и соответствует значению с шага 2.1.6.
      1. Запуск SEC запустить, нажав на кнопку "Сохранить", подготовленный на этапе 2.1.11, и запишите номер кадра, отображаемого в программном обеспечении camserver, когда инъекции завершен и начинается сбор UV данных.
    14. После сбора данных, откройте базу данных ISPyB 20 на Откройте вкладку "Сбор данных" и нажмите кнопку "Go" , чтобы получить доступ к набору данных и результатов автоматического анализа 21.
  2. Сбор данных IEC-МУРР
    Примечание: вместо непрерывного линейного градиента, обычно применяемой в МЭК экспериментах используют пошаговый градиент, в котором количество буфера В увеличивается в заранее установленных дискретных шагов.
    1. Создать программу ВЭЖХ для SAMPLэлектронный буфер без запуска. Программирование поэтапного градиента, начиная с 0% буфера B и увеличился на 5 процентных пунктов после двух CV до 100% буфера В не будет достигнута.
    2. Помещенный некоторые из каждого буфера в сторону. Подключите бутылку с низким содержанием соли буфера А к порту А и один с высоким содержанием соли буфера В до порта B.
    3. Выберите скорость потока и оставаться ниже предела давления колонны (в этом примере, 1 мл / мин).
    4. Как и в шаге 2.1.3, промойте насос и вверх по течению трубки с помощью функции "автоматического" продувки.
    5. Равновесие системы в странах с низким содержанием соли буфера А (см шаг 1.15) и подключить ионообменной колонки. Подождите, пока колонна не будет полностью уравновешена (по крайней мере, 1,5 CV).
    6. Используйте буфер отмененного в шаге 2.2.2 для изучения буферов А и В для радиационных повреждений с помощью смены образцов, как на этапе 2.1.5.
    7. Проверьте буфер, выходящий из колонны, как на этапе 2.1.6. Сравните сигнал к сигналу буфера А, записанной на этапе 2.2.6. Обратите внимание, сновачисло отсчетов в суммарном интенсивности участка.
    8. Создайте папку для хранения данных для буферного прогона.
    9. Настройка сбора данных в режиме системы высокоэффективной жидкостной хроматографии. Выберите количество кадров, так что общее время сбора данных превышает общее время прогона МЭК (см этапа 2.2.1).
    10. Откройте затвор безопасности и начать сбор данных МУР. Убедитесь в том, что она протекает правильно и дважды проверьте, что суммарная интенсивность остается постоянной при значении указанном в шаге 2.2.7, по крайней мере, 100 кадров.
    11. Используйте "Single Run" особенность программного обеспечения высокоэффективной жидкостной хроматографии и начать пошаговый градиент, запрограммированный на этапе 2.2.1. Для инъекции, установите флакон число -1, чтобы не вводить никакого образца на этой стадии. Запишите количество кадров, полученных в начале программы.
    12. Создать программу для ВЭЖХ образца прогона. Программирование поэтапного градиента, начиная от 0% буфера B. оценить процент буфера В на каждом пике измеряется в автономном режиме в шаге 1.1.5 ( (Рисунок 1С). Добавление конечной стадии при 100% буфера B в течение 2,5 CV.
    13. Спин вниз образца при 13000 мкг в настольный микропробирок центрифуге в течение по крайней мере 10 мин.
    14. Развести D5 323-785 в концентрации соли буфера А (25 мМ) , путем смешивания его с 20 мМ Трис-HCl , рН [7], 10% глицерина и 1 мМ DTT.
    15. Загрузите образец вручную на колонку. Помещенный буфер A входной трубки в разведенной пробы после временной остановки насосов, чтобы избежать образования пузырьков воздуха. Отсоедините колонку от детекторов непосредственно собирать проточного из колонки.
      1. Когда контейнер образец почти пуст, возвращают входную трубку в буфере А (снова пауза насосов при перемещении трубки) и перезапустить сцеживание с буфером А для переноса образца из трубки в колонну. После того, как весь образец былзагружен, передать 2 CV буфера А, а затем повторно подключите колонки к детекторам.
    16. Для образца перспективе, создать папку для хранения данных.
    17. Откройте затвор безопасности и начать сбор данных МУР. Убедитесь в том, что сбор данных происходит правильно и дважды проверьте, что суммарная интенсивность остается постоянной при значении указанном в шаге 2.2.7, по крайней мере, 100 кадров.
    18. Используйте "Single Run" особенность программного обеспечения высокоэффективной жидкостной хроматографии, чтобы начать пошаговый градиент, запрограммированный на этапе 2.2.12. Для инъекции, установите флакон число -1, чтобы не вводить никакого образца на этой стадии. Запишите количество кадров, полученных в начале программы.
    19. "Сбор данных" Открыть в ISPyB 20 и нажмите кнопку "Go" , чтобы посмотреть на набор данных и автоматического анализа 21.
    20. Экспорт УФ данных из системы ВЭЖХ в формате ASCII с помощью программного обеспечения "Postrun анализа".

3.SEC-МУРР Снижение данных и анализ

  1. Открыть данные в системах сбора данных в ISPyB, нажав на кнопку "Go". Определите, в обзоре, который окаймляет сбора данных МУРР соответствуют пику элюции. Убедитесь, что радиус вращения является стабильным в течение всего пика.
  2. Убедитесь, что автоматизированная коррекция буфера была выполнена правильно. Загружайте кадры из центральной части пика в программу , которая выполняет манипуляции с экспериментальными данными МУРР файлов 22 и их среднее значение . Затем загрузите автоматически сгенерированный файл буфера и проверьте , является ли высокая добротность областей усредненных кадров и матч буфера кадров.
  3. Сравните кадры , полученные на протяжении пика количественно при помощи теста CORMAP 23.
    1. Загрузите автоматически созданные вычитаний (* _sub.dat файлы) кадров, охватывающих область интереса.
    2. Масштаб их друг с другом, нажав на кнопку «Масштаб».
    3. Comparе их с помощью функции "Сравнение данных". Там не должно быть никаких систематических изменений между кадрами на протяжении пика.
  4. Открыть все * -_ sub.dat кадры, представляющие интерес, объединить их с помощью кнопки "Объединить", и сохраните объединенный файл в формате .dat.
  5. Определить радиус вращения с "гирорадиус" инструмента в программе, отметив первую точку данных в диапазоне гинье для последующего кадрирования данных при низком разрешении.
  6. Определить функцию распределения пара расстояния с "Расстояние Distribution" инструмента в программе и сохраните полученный файл .out как gnom.out.

4. Неэмпирические Моделирование

  1. На машине Unix, запустить программу реконструкции 40 х неэмпирические модели без ограничений симметрии. Создайте новую папку и скопировать файл gnom.out к нему. Запустите программу следующим образом:
    для ((я = 1; г <= 40; я ++)); сделать dammif gnom.out -ms -p dammifp1_ $ я; dодин
  2. Аналогично, запустить программу реконструкции неэмпирические модель с ограничениями симметрии для шестикратным симметрии во второй папке:
    для ((я = 1; г <= 40; я ++)); Do dammif gnom.out -ms -s -p P6 dammifp6_ $ я; сделанный
  3. Совместите все выходные программы AB реконструкция первых принципов модели файлов (* -1.pdb). В двух папках с шагом 4.1 и 4.2, запустите damaver -a * -1.pdb.
  4. Открыть объединение всех моделей (damaver.pdb), а также модели фильтрованной к правильному объему (damfilt.pdb) в подходящем программном обеспечении молекулярной визуализации 26 и сравнить их.
  5. Откройте файл damsel.log в текстовом редакторе. Модель указана в качестве "ссылки" в нижней части файла является наиболее представительной модели.

5. IEC-МУРР Снижение данных, анализ и моделирование

  1. В программе , которая выполняет манипуляции с экспериментальными файлами данных 22 МУРР, загрузить около 50 МУРР кадров из каждого шага смешиваниебуфер запуска, нажмите кнопку "Average", и сохранить результаты.
  2. На основании результатов автоматической обработки, доступных через ISPyB, определить, какие кадры из эксперимента соответствуют элюции белка и проверки того, что (предварительный) радиус вращения является стабильным в течение всего пика.
  3. Загрузка кадров в экспериментальную МУРР программы 22 манипулирования файлами данных и их среднее значение , как это было сделано для буфера кадров (этап 5.1). Затем загрузите файлы буфера , сгенерированные на этапе 5.1 и сравнить добротный области (выше 4,2 нм -1) , чтобы найти буфер , который соответствует в среднем от пика.
    ПРИМЕЧАНИЕ: Там не должно быть никакого систематического смещения между средним от пика и буфера. Если кривая образца, кажется, падает между двумя кривыми буфера, интерполировать их кривые путем вычисления среднего значения.
  4. Вычтите буфер, идентифицированного как лучший матч со средней кривой рассеяния пиковой фракции и сохранить полученный subtrдействовал файл. Кроме того, создают вычитают кривые, используя усредненные кривые буфер из предыдущего и последующего смешивания шагов, чтобы оценить предел погрешности вычитания.
  5. Повторите шаги 5.3 и 5.4 отдельно для левой и правой половинах пика и сравнить результаты с теми, с шага 5.4 для проверки стабильности сигнала в течение всего пика.
  6. Выполните шаги 3.5 и 3.6 для всех трех кривых вычитаются из шага 5.4.
  7. Сравните результаты для всех трех кривых вычитаются.
    Примечание: Только результаты, которые остаются надежными в пределах допустимой погрешности вычитания можно доверять.
  8. Выполните моделирование как в шагах 4.1 и 4.2 для лучшего вычитания, идентифицированного в шаге 5.3.
  9. Выполните шаг 4.3 до 4.5 для выравнивания моделей и определить наиболее представительным.

6. Сравнение результатов

  1. Запуск программы для 3D - структур накладывать 12 на представительных моделях SEC (шаг 4.5)Данные d IEC-МУРР (шаг 5.9) с P6 симметрией: supcomb model_sec.pdb model_iec.pdb
  2. Импорт model_sec.pdb и model_iec-r.pdb в программное обеспечение молекулярной визуализации.
  3. Откройте .fir файлы в modelsec.pdb и modeliec-r.pdb в электронную таблицу и создать 2D график экспериментальных и расчетных кривых рассеяния.

Representative Results

Результаты безмодельного инвариантного анализа приведены в таблице 1. Анализ 323-785 данных Д5 SEC-МУРР показал молекулярную массу оценку (от анализа) Порода 345 кДа по сравнению с 338 кДа, наблюдаемые с помощью IEC-SAXS. Оба находятся в согласии с ожидаемой массой 6 раз 53,5 кДа (321 кДа) для гексамере. Из первых принципов моделирования аб обоих наборов данных была проведена без каких - либо наложены симметрии (SEC-МУР: χ 2 = 0,88, IEC-МУРР: х 2 = 3,1) и с использованием C6 симметрии (SEC-SAXS: χ 2 = 1,0, IEC-МУРР : χ 2 = 4). По мере того как общие подходит к данным рассеяния для обеих реконструкций сопоставимы в обоих случаях (рис 1D и Е), C6 симметрии можно предположить. Таким образом, модель соответствует гексагональной конусообразной структуры с центральным каналом, который появляется частично закупорен (SEC: Рисунок 1F; IEC: Рисунок 1H). Изучение отдельных моделей до усреднения показывает, что это препятствие может быть артефактом процесса усреднения.

Рисунок 1
Рисунок 1: анализ данных МУРР и сравнение D5 323 -785 (рисунок адаптирован из Список литературы 12 и 18). А) Схематическое доменная структура белка D5 и D5 323-785. B) Офлайн ионообменной хроматограммы с указанием трех пиков. Оранжевый кривая: поглощение при длине волны 280 нм (Au), синяя кривая: процент буфера B. Процентами буфера В на вершинах указаны. C) Интернет ионообменной хроматограммы. Цвет ключа, как в В. Кроме того, измеренная интенсивность обозначается зеленым цветом. Экспериментальное рассеяние кривая ай расчетной кривой модели , полученной с помощью SEC-МУР D) и IEC E) анализа данных D5 323-785. F) Бусина модель D5 323-785 на основе данных SEC и данных G) МЭК. H) Накладка моделей SEC и МЭК. Панели в F) в H) были созданы с использованием программного обеспечения молекулярной визуализации 24. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Параметры по сбору данных
Прибор: ESRF BM29
Длина волны (Å) 0,99
Q-диапазон (Å -1) 0,0032 - 0,49
Образец к детектору расстояния 2,864 м
Время экспозиции (сек) 1 за один кадр
интервал концентрации не доступно
Температура (K) 293
детектор Pilatus 1M (Dectris)
Поток (фотонов / с) 1 × 10 12
Размер луча (мкм 2) 700 × 700
Структурные параметры для D5 323-785, SEC
I 0 (см -1) [от Гинье] 0,0237
Rg (Å) [от Гинье] 48
д мин R г - д макс R г используется для Гинье 0,77 - 1,24
D макс (Å) [от р (г)] 145
Q-диапазон , используемый для р (г) (Å -1) 0,02 - 0,17
Объем V Порода р3) [от рассыпного] (570 ± 5) × 10 3
Молекулярная масса М г (кДа) [от V р] 345
Рассчитано мономерный Mr из последовательности (кД) 321
Структурные параметры для D5 323-785, IEC
I 0 (см -1) [от Гинье] 0,386
Rg (Å) [от Гинье] 46,5 ± 0,1
д мин R г - д макс R г используется для Гинье 0,44 - 1,29
D макс (Å) [от р (г)] 120
Q-диапазон , используемый для р (г) (Å -1) 0,03 - 0,18
Объем V Порода р (& #197; 3) [от рассыпного] (577 ± 5) × 10 3
Молекулярная масса М г (кДа) [от V р] 339
Рассчитано гексамерный Mr из последовательности (кД) 321

Таблица 1: Параметры данных МУРР. В следующей таблице приведены параметры сбора МУРР и анализа данных.

Discussion

Для многих макромолекул, конечная стадия очистки с использованием хроматографии требуется до сбора данных МУРР для получения хорошего качества набора данных. Однако, не все образцы остаются стабильными; они могут быть склонны к агрегации или переуравновешивания к смеси олигомеризации состояниях. Таким образом, окончательный онлайн стадию очистки на пучкового требуется, чтобы свести к минимуму время между очисткой и сбора данных для того, чтобы получить данные МУРР качества лучше всего. В зависимости от биофизических свойств белка, представляющего интерес, втор-МУРР или МЭК-МУРР могут быть выбраны для получения оптимального качества образцов. Здесь, на белковой конструкции, полученной из хеликаза / праймаза D5, оба метода объяснены и обсуждены.

Получение данных SEC-МУРР становится все более и более стандартизированной и доступен на многих BioSAXS beamlines. Анализ данных, особенно вычитание фона, является относительно простым и легким. Тем не менее, устойчивый сигнал буфераи достаточное разделение макромолекулярных видов остается существенным. Поэтому очень важно выделить достаточно времени, чтобы тщательно уравновешиванию колонку. Несоблюдение этого метода может быть из-за стойких загрязнителей аналогичного размера до интересующего белка, низких концентрациях, а также радиационно-чувствительных буферов.

На практике, первоначально, втор-МУРР, скорее всего, будет использоваться в качестве метода выбора для большинства макромолекулярных образцов. Тем не менее, многие протоколы очистки требуют предварительного IEC шаг в связи с наличием загрязняющих веществ или агрегации. Учитывая, что каждая концентрация и хроматография шаг связан с потерями образца (по оценкам, на 30-50%), а также время, прямое МЭК-МУРР является выгодным. Для образцов, которые не могут быть очищены с помощью SEC, будь то из-за наличия аналогичного размера «загрязняющие вещества», или потому, что они сильно агрегатный в необходимых концентрациях, МЭК-МУРР всегда был бы лучше подходит подход. Кроме того, поддерживаются более высокие скорости потокамногие IEC колонки может помочь сократить время перехода между очистки и измерения. В примере , представленном здесь, IEC был использован с шагом элюирования, что позволяет для разделения близких пиков Д5 323-785 от загрязнений, тщательно выбирая шаги концентрации соли. В принципе, число шагов не ограничено, но практически, по крайней мере, 1 шаг за пика требуется, и не слишком многие из них должны быть выбраны. Для метода вычитания фона, описанного выше, важно, чтобы измерить относительно большое количество различных буферных композиций для того, чтобы найти соответствующий один.

Общий недостаток обоих методов является отсутствие точной информации концентрации белка. В связи с этим, точное определение массы основано на рассеянии вперед не представляется возможным. Для глобулярных белков , таких как D5 323-785, объем Порода представляет собой альтернативу, хотя и менее точной, массовой оценки, но для очень гибких или неупорядоченных белков, Этот подход не будет действительным.

Разновидностью пошаговый градиентного метода IEC-МУРР представленной здесь является использование линейного градиента вместо. В то время как можно работать с таким количеством шагов, как желательно выделить суб-пиков, используя ступенчатое элюирование в линейном градиенте подходе, необходимо тщательно оптимизировать условия градиента для того, чтобы разделить пики полностью перед запуском SAXS эксперимент. Вычитание фона при таком подходе можно было бы сделать покадровой и может быть проверена путем сравнения отдельных кадров, но это требует более продвинутой обработки данных, а также специализированное программное обеспечение еще не существует.

Выбор подходящего столбца имеет решающее значение для обоих методов, поскольку он определяет разделение макромолекул рных видов. Вытеснительной колонки различаются по грузоподъемности, в диапазоне размеров отделяемых макромолекул и разрешением, в то время как ионообменные колонки различаются от вида и плотностиих иммобилизованных зарядов.

Хотя протокол, представленные здесь, специфичные для ESRF пучкового BM29, адаптация к любым другим МУРР пучкового, в принципе, простой. Основными требованиями являются достаточно высокий поток рентгеновского излучения и подходящий детектор (в идеале однофотонный подсчета), чтобы получить приемлемые данные сигнал-шум в диапазоне секунд или меньше, и система онлайн-хроматографии жидкости, способной создавать градиенты. Конкретная реализация будет, конечно, зависеть от локальной среды пучкового.

Результаты , полученные на d5 323-785 с использованием двух методов незначительно отличаются. Радиус инерции немного меньше для данных IEC, чем для данных SEC, а локальные минимумы кривой рассеяния смещаются немного больше векторов рассеяния. Это означает , что Д5 323-785 измеренная с IEC-МУР немного более компактным , чем Д5 323-785 , измеренной с помощью втор-МУР. Это может бе из-за различий в процессе подготовки образца, в то время между очисткой и измерения (МЭК быстрее), или, что менее вероятно, к загрязнителя в SEC-очищенного образца. Модели из бисера , полученные полностью независимо друг от друга с обоими методами сопоставимы (рис 1H). D5 323-785 показывает ожидаемую полую структуру гексамерных 18.

В заключение, онлайн ионообменная и онлайн исключением по размеру хроматографии , являются важными биохимические методы очистки , которые могут быть соединены непосредственно с МУР 6,7,9-12,25,26. Фоновый Вычитание данных МЭК-МУРР является немного более сложным и неоднозначным, чем для SEC-МУР, но тем не менее это возможно. В зависимости от биофизических свойств белка, представляющего интерес, как SEC и МЭК-МУРР позволит оптимизировать видового разделения с присущими им преимуществами. При условии, что правильно соблюдены этапы проверки (как описано), полученные данные можно анализировать остроумиеч уверенность и модели могут быть определены с помощью стандартных инструментов, доступных в рамках сообщества. Вместе обе методики позволяют онлайн разделения для широкого спектра биологических макромолекул, получая данные не были доступны через стандартные статические измерения.

Materials

Name Company Catalog Number Comments
1,4-dithiothreitol [DTT] Euromedex EU0006-B
10% Mini-PROTEAN TGX Precast Protein Gel Biorad 4561033
2x Phusion Flash PCR Master Mix ThermoFisher scientific F 548
acetic acid glacial VWR Chemicals (BDH Prolabo) 20104.298
Agarose D-5 Euromedex LF45130653
Amicon Ultra -15 Centrifugal filters Ultracel -30K Millipore Ltd UFC903024
Ampicillin sodium salt Euromedex EU0400-D
Benzonase Novagene 70750-3
bromophenol blue  MERCK 8122
Complete protease inhibitor cocktail  Roche 11231400
Econo-Pac 10 DG Desalting column Bio-rad 732-2010
EDTA Sigma E-5134
Glycerol VWR Chemicals (BDH Prolabo) 24388.295
Glycine Euromedex 26-128-6405-C
HindIII Roche 656313
HisSelect HF Nickel Affinity Gel Sigma H0537
Hydrochloric acid (HCl) VWR Chemicals (BDH Prolabo) 20252.295
Imidazole AppliChem Panreac A1073,0500
InstantBlue Expedeon ISB1L
LB broth Miller Fluka Analytical L3152
MgCl2 ICN Biomedicals Inc. 191421
NaCl VWR Chemicals (BDH Prolabo) 27808.297
NcoI Fermentas ER0571
One Shot BL21 Star (DE3)  ThermoFisher scientific C6010-03
pProEx HTb vector  Addgene 10711018
Primer  Eurofins mwg operon
QIAprep Spin Miniprep kit QIAGEN 27106
QIAquick Gel extraction kit QIAGEN 28706
QIAquick PCR purification kid QIAGEN 28106
SDS  Sigma 75746
Superose 6 10/300 GL GE Healthcare 17-5172-01
SYBR Safe DNA gel stain Invitrogen life technology S33102
T4 ligase ThermoFisher scientific EL0011
TEV home made
TOP 10 Invitrogen life technology C404003 
Tris base Euromedex 26-128-3094-B
Uno Q 1R column  Bio-rad 720 0011
β-mercaptoethanol MPBiomedicals, LLC 194834
Name Company Catalog Number Comments
Softwares
Beamline control software BsXCuBE ESRF Pernot et al. (2013), J. Synchrotron Rad. 20, 660-664 local development
Camserver software Dectris n.a. detector control software
DAMAVER ATSAS 2.6.0 http://www.embl-hamburg.de/biosaxs/download.html program to align ab initio models 
DAMMIF ATSAS 2.6.0 http://www.embl-hamburg.de/biosaxs/download.html ab initio model reconstruction program
HPLC program Biologic Duo Flow Bio-rad
HPLC program LabSolutions Shimadzu n.a.
ISPyB ESRF De Maria Antolinos et al. (2015). Acta Cryst. D71, 76-85. local development
PRIMUS ATSAS 2.6.0 http://www.embl-hamburg.de/biosaxs/download.html program, which performs the manipulation with experimental SAXS
PyMOL DeLano Scientific LLC https://www.pymol.org/ software for visualization
SUPCOMB ATSAS 2.6.0 http://www.embl-hamburg.de/biosaxs/download.html program to superimpose 3D structures
Name Company Catalog Number Comments
Equipment
BioLogic Duo Flow Biorad
BioLogic Biofrac Fraction collector Biorad
HPLC system Shimadzu
Labsonic P Sartorius Stedim biotech BBI8535108

DOWNLOAD MATERIALS LIST

References

  1. Graewert, M. A., Svergun, D. I. Impact and progress in small and wide angle X-ray scattering (SAXS and WAXS). Curr. Opin. Struct. Biol. 23, 748-754 (2013).
  2. Jacques, D. A., Trewhella, J. Small-angle scattering for structural biology-Expanding the frontier while avoiding the pitfalls. Protein Sci. 19, 642-657 (2010).
  3. Kikhney, A. G., Svergun, D. I. A practical guide to small angle X-ray scattering (SAXS) of flexible and intrinsically disordered proteins. FEBS Lett. 589, 2570-2577 (2015).
  4. Putnam, C. D., Hammel, M., Hura, G. L., Tainer, J. A. X-ray solution scattering (SAXS) combined with crystallography and computation: defining accurate macromolecular structures, conformations and assemblies in solution. Q. Rev. Biophys. 40, 191-285 (2007).
  5. Vestergaard, B. Analysis of biostructural changes, dynamics, and interactions - Small-angle X-ray scattering to the rescue. Arch. Biochem. Biophys. (2016).
  6. David, G., Pérez, J. Combined sampler robot and high-performance liquid chromatography: a fully automated system for biological small-angle X-ray scattering experiments at the Synchrotron SOLEIL SWING beamline. J. Appl. Crystallogr. 42, 892-900 (2009).
  7. Graewert, M. A., et al. Automated Pipeline for Purification, Biophysical and X-Ray Analysis of Biomacromolecular Solutions. Sci. Rep. 5, (2015).
  8. Lambright, D., et al. Complementary techniques enhance the quality and scope of information obtained from SAXS. ACA Trans. 1-12 (2013).
  9. Mathew, E., Mirza, A., Menhart, N. Liquid-chromatography-coupled SAXS for accurate sizing of aggregating proteins. J. Synchrotron Radiat. 11, 314-318 (2004).
  10. Round, A., et al. Determination of the GH3. 12 protein conformation through HPLC-integrated SAXS measurements combined with X-ray crystallography. Acta Crystallogr. Sect. D. Biol. Crystallogr. 69, 2072-2080 (2013).
  11. Watanabe, Y., Inoko, Y. Size-exclusion chromatography combined with small-angle X-ray scattering optics. J. Chromatogr. 1216, 7461-7465 (2009).
  12. Hutin, S., Brennich, M. E., Maillot, B., Round, A. Online ion-exchange chromatography for small angle X-ray scattering. Acta Cryst. (2016).
  13. Selkirk, C. Ion-exchange chromatography. Protein Purification Protocols. 125-131 (2004).
  14. Yigzaw, Y., Hinckley, P., Hewig, A., Vedantham, G. Ion exchange chromatography of proteins and clearance of aggregates. Curr. Pharm. Biotechnol. 10, 421-426 (2009).
  15. Pernot, P., et al. Upgraded ESRF BM29 beamline for SAXS on macromolecules in solution. J. Synchrotron Radiat. 20, 660-664 (2013).
  16. Iyer, L. M., Koonin, E. V., Leipe, D. D., Aravind, L. Origin and evolution of the archaeo-eukaryotic primase superfamily and related palm-domain proteins: structural insights and new members. Nucleic Acids Res. 33, 3875-3896 (2005).
  17. Singleton, M. R., Dillingham, M. S., Wigley, D. B. Structure and mechanism of helicases and nucleic acid translocases. Annu. Rev. Biochem. 76, 23-50 (2007).
  18. Hutin, S., et al. Domain organization of vaccinia virus helicase-primase D5. J. Virol. 4604-4613 (2016).
  19. Round, A., et al. BioSAXS Sample Changer: a robotic sample changer for rapid and reliable high-throughput X-ray solution scattering experiments. Acta Crystallogr. Sect. D. Biol. Crystallogr. 71, 67-75 (2015).
  20. De Maria Antolinos, A., et al. ISPyB for BioSAXS, the gateway to user autonomy in solution scattering experiments. Acta Crystallographica Section D. 71, 76-85 (2015).
  21. Brennich, M. E., et al. Online data analysis at the ESRF bioSAXS beamline, BM29. J. Appl. Crystallogr. 49, (2016).
  22. Petoukhov, M. V., Konarev, P. V., Kikhney, A. G., Svergun, D. I. ATSAS 2.1-towards automated and web-supported small-angle scattering data analysis. J. Appl. Crystallogr. 40, 223-228 (2007).
  23. Franke, D., Jeffries, C. M., Svergun, D. I. Correlation Map, a goodness-of-fit test for one-dimensional X-ray scattering spectra. Nat. Methods. 12, 419-422 (2015).
  24. Schrodinger, LLC. The PyMOL Molecular Graphics System, Version 1.8. (2015).
  25. Jensen, M. H., et al. Time-resolved SAXS measurements facilitated by online HPLC buffer exchange. J. Synchrotron Radiat. 17, 769-773 (2010).
  26. Hynson, R. M., Duff, A. P., Kirby, N., Mudie, S., Lee, L. Differential ultracentrifugation coupled to small-angle X-ray scattering on macromolecular complexes. J. Appl. Crystallogr. 48, 769-775 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats