Enkeltcelle RNA-Seq av definerte subsets av retinal Ganglion-celler

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her presenterer vi en kombinatorisk tilnærming for klassifisering av nevrale celletyper før isolasjon og for den etterfølgende karakterisering av enkeltcelletransskriptomer. Denne protokollen optimaliserer utarbeidelsen av prøver for vellykket RNA-sekvensering (RNA-Seq) og beskriver en metodikk som er spesielt utviklet for å forbedre forståelsen av cellulært mangfold.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Laboissonniere, L. A., Sonoda, T., Lee, S. K., Trimarchi, J. M., Schmidt, T. M. Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells. J. Vis. Exp. (123), e55229, doi:10.3791/55229 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Oppdagelsen av celletypespesifikke markører kan gi innsikt i cellefunksjon og opprinnelsen til cellulær heterogenitet. Med en nylig press for forbedret forståelse av neuronal mangfold, er det viktig å identifisere gener hvis uttrykk definerer ulike subpopulasjoner av celler. Retina fungerer som en utmerket modell for studiet av sentralnervesystemdiversitet, da det består av flere store celletyper. Studien av hver hovedklasse av celler har gitt genetiske markører som letter identifiseringen av disse populasjonene. Imidlertid finnes det flere undertyper av celler innenfor hver av disse store retinale celleklasser, og få av disse subtypene har kjent genetiske markører, selv om mange har blitt preget av morfologi eller funksjon. Kunnskap om genetiske markører for individuelle retinale subtyper vil tillate studier og kartlegging av hjernemål rettet mot bestemte visuelle funksjoner og kan også gi innsikt i gennettene somOpprettholde mobilt mangfold. Nåværende veier som brukes til å identifisere de genetiske markørene til subtypene, har ulemper, for eksempel klassifisering av celletyper som følger sekvensering. Dette gir en utfordring for dataanalyse og krever strenge valideringsmetoder for å sikre at klynger inneholder celler med samme funksjon. Vi foreslår en teknikk for å identifisere morfologi og funksjonalitet av en celle før isolering og sekvensering, noe som vil tillate enklere identifisering av subtypespesifikke markører. Denne teknikken kan utvides til ikke-neuronale celletyper, så vel som sjeldne populasjoner av celler med mindre variasjoner. Denne protokollen gir data av utmerket kvalitet, ettersom mange av bibliotekene har gitt lese dybder større enn 20 millioner, leser for enkeltceller. Denne metoden overstyrer mange av hindrene presentert av single-cell RNA-Seq og kan være egnet for forskere som har som mål å profilere celletyper på en enkel og svært effektiv måte.

Introduction

Neuronal mangfold er observert gjennom sentralnervesystemet, spesielt i ryggradshinnen, et høyt spesialisert vev som består av 1 glial og 6 nevrale celletyper som oppstår fra en populasjon av retinale stamceller 1 , 2 , 3 . Mange subtyper av celler kan klassifiseres funksjonelt, morfologisk og genetisk. Målet med denne protokollen er å knytte den genetiske variabiliteten til celletyper til deres identifiserbare funksjonelle og / eller morfologiske egenskaper. En rekke gener er identifisert for klassifisering av celler, men mange subtyper fortsetter å gå ukarakterisert, da de representerer en liten del av den totale befolkningen. Identifikasjonen av gener innenfor disse spesifikke subtypene vil muliggjøre en større forståelse av neuronal mangfold i retina og kan også kaste lys over diversifiseringen av nevrale celler andre steder. FuVidere kan enkeltcellede studier muliggjøre avdekking av nye celletyper, som kanskje har blitt oversett på grunn av deres lave representasjon blant den samlede befolkningen 4 , 5 , 6 , 7 .

En av fordelene ved enkeltcelletranscriptomikk er at unike markører eller kombinasjoner av markører som definerer en bestemt cellulær subtype, kan oppdages. Disse kan da brukes til å få genetisk tilgang til den celletypen for forskjellige manipulasjoner. For eksempel bruker vi denne protokollen til å karakterisere celletypespesifikke gener av en delmengde av retinale ganglionceller som uttrykker fotopigmentet melanopsin. Bruken av en fluorescerende markør i melanopsin-uttrykkende retinale ganglionceller gjør det mulig å studere disse cellene, da de blir klynget sammen på grunn av deres uttrykk for et kjent gen. Interessant er det fem kjente undertyper av denne cellen popuLation i muslinen 8 . For å isolere RNA fra celler av hver type har vi således brukt etablerte morfologiske klassifikasjoner innenfor den transgene modellen for å identifisere hver subtype før cellisolasjon. Denne teknikken tillater karakterisering av celler så vel som isolasjon direkte fra netthinnen, uten behov for vevsdissociasjon, noe som kan forårsake stressrespons i celler og forurensning på grunn av avskårne dendriter 9 .

En rekke nye teknikker har kommet til lys de siste årene, ettersom RNA-Seq-metoden fortsetter å utvikle seg. Disse verktøyene tillater maksimert celleoppkjøp og større kostnadseffektivitet mens du nærmer deg spørsmålet ved hånden 4 , 7 , 10 , 11 , 12 , 13 . Imidlertid, mensDisse teknikkene har vært gode stepping stones, det er en rekke hindringer fortsatt oppdaget at denne protokollen er i stand til å adressere. Først isolerer mange av de nåværende prosedyrene celler fra dissociert vev og forsøker å bruke enten hovedkomponentanalyse eller hierarkisk clustering post-hoc for å bestemme celleklassifisering. Å stole på disse verktøyene for å klassifisere undertyper, kan ikke produsere pålitelige resultater og kan tvinge en til å finne nye måter å validere disse dataene for korrelasjonen av en genetisk markør til en funksjonell celletype. Kravet på dissosiasjon i andre protokoller kan noen ganger føre til vevskader og kan føre til at neuroneprosesser blir kuttet, noe som resulterer i et potensielt tap av mRNA. Videre kan i spredte cellepreparater begynne å påvirke transkriptomene av disse cellene 14 . Denne protokollen overvinter disse utfordringene ved å bestemme funksjonell celletype før isolasjon, og det opprettholder bedre hEalth av cellene ved å holde retinal vev intakt.

En teknikk ble introdusert i 2014 og besto av in vivo analyse av transkriptomet av levende celler 15 . Mens denne teknikken tillater undersøkelse av transkriptomet med minimal mekanisk forstyrrelse av vevet, mangler det evnen til å klassifisere spesifikke celletyper i vevet før de undersøker transkriptomerene uten å bruke en meget spesifikk reportermus. Vår protokoll krever ikke en bestemt reporter, da vi bruker cellefylling og elektrofysiologi til å karakterisere celler før isolasjonen. En annen begrensning av denne tidligere protokollen er at den krever en bestemt bølgelengde for å spenne det fotoaktiverbare elementet, mens protokollen vår tillater bruk av en fluorescerende reporter og fluorescerende fargestoff, som er lett tilgjengelig eller kan velges av hver enkelt laboratorie individuelt. Likevel har andre laboratorier giftet seg med to metoder for elektrOphysiologi og transkriptomikk for studier av cellulær mangfold. Bruken av patch-clamp-opptak for å karakterisere funksjonen til en celle før isolasjonen, har blitt utført på dissocierte nevroner 16, og i noen tilfeller har den gått foran bruken av mikroarrayanalyse 17 for disse studiene. De samme komplikasjonene oppdages av disse tilnærmingene, da de krever vevsdissociasjon eller bruk av mikroarray-teknologi, som er avhengig av hybridisering av prøver til tilgjengelige prober. En av de siste fremskrittene har vært utviklingen av Patch-Seq, en teknikk som kombinerer bruken av patch-clamp-opptak og RNA-Seq-teknologi for å forstå celler fra helhjerneskiver 18 . Selv om denne teknikken har likheter med protokollen som presenteres her, er det igjen viktig å merke seg at vår tilnærming tillater at vevet forblir intakt for cellens helse. Her presenterer vi en protokoll for optimaliseringenIon av denne alliansen, som genererer høykvalitets, single-cell biblioteker for bruk av RNA-Seq for å oppnå en høy lese dybde og kartlegging dekning.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle prosedyrer ble godkjent av Institutional Animal Care and Use Committee (IACUC) ved Northwestern University.

1. Fremstilling av løsninger for elektrofysiologi (4 timer)

  1. Lag 0,1% DEPC-behandlet H20 ved å tilsette 1 ml dietylpyrokarbonat (DEPC) til 999 ml omvendt osmose-renset H20. Bland grundig og la blandingen inkuberes i 1 time ved romtemperatur. Deretter autoklaverer DEPC-blandet H20 i 15 minutter på en væskesyklus. La den DEPC-behandlede H 2 O avkjøles ved RT.
  2. Lag den ekstracellulære løsningen ved å blande en flaske Ames 'medium og 1,9 g (23 mM) natriumbikarbonat i 1 liter H20. Boble den ekstracellulære oppløsningen med
    95% O 2 /5% CO 2 og opprettholde den ved en pH på 7,3-7,4.
  3. Generer den intracellulære løsningen ved å kombinere 125 mM K-glukonat, 2 mM MgCl2, 10 mM EGTA, 10 mM HEPES og 0,1% DEPC-behandlet H2 O. Oppbevar den i 1 ml alikvoter ved -20 ° C. Tilsett 10 μM fluorescerende sporer i begynnelsen av hvert forsøk.
  4. Lag enzymoppløsning ved å legge til 10.000 enheter kollagenase og 83 mg hyaluronidase til 4,15 ml ekstracellulær løsning. Enzymoppløsningen skal lagres i 50 μl alikvoter ved -20 ° C.

2. Fremstilling av retinalvæv (2 timer)

MERK: Alle prosedyrer i denne delen skal utføres under svakt rød belysning

  1. Mørk tilpasse dyr i minst 1 time før disseksjon. Utfør alle prosedyrer under svak rød belysning.
  2. Euthanize dyrene ved CO 2 -kjøling og kjerne øyebollene inn i en petriskål med tidligere oksygenert ekstracellulær løsning.
  3. Poke hornhinnen med en nål og kutt den bort ved å kutte med oftalmisk saks ved grensen til hornhinnen og sclera 19 .
  4. Fjern linsen med# 5 tanger. Forsiktig gjør en tåre i scleraen med tang og skjær den optiske nerveen der netthinnen og sclera møtes. Forsvør forsiktig med å fjerne sclera fra netthinnen.
  5. Fjern den gjennomsiktige glassplaten med # 5 tang Når en gang er fjernet, vises glassplaten som en gelatinøs substans som sitter fast i tangen. Skjær retina i halvparten (slik at det er 4 stk / dyr) og lagre dem i oksygenert ekstracellulært oppløsning ved RT til bruk.
  6. Når du er klar til å montere vevet i opptakskammeret, plasser et retina for å inkubere i enzymoppløsning fortynnet i 500 ul oksygenert ekstracellulær løsning. Inkubér i en petriskål i 2 min ved RT på en shaker.
    1. Vask retina i oksygenert ekstracellulær løsning og legg vevet i et glassbunnsopptakskammer; Bruk en plastoverføringspipette med tippen kuttet av for å tillate at nesen overføres uten å skade vevet.
  7. Bruke tilCeps å forsiktig flate vevet med fotoreceptor laget vendt nedover. Fjern overflødig væske ved hjelp av en pipette. Anker vevet ved hjelp av en platinring med nylonnett.
    MERK: Denne metoden kan også brukes til å forberede vevet til isolering av RNA fra merkede amakrine og bipolare celler.
  8. Fyll kammeret med oksygenert ekstracellulær løsning og monter den på et mikroskopfase. Perfusjonsvev med oksygenert ekstracellulær løsning ved 2-4 ml / min.

3. Visualisering og målretting av GFP + Retinal Ganglion-celler (10 min)

MERK: Alle prosedyrer i denne delen skal utføres under svakt rød belysning

  1. Før du begynner, trekk glassmikropipetter (OD: 1,2 mm, ID: 0,69 mm) for elektrofysiologiske opptak ved hjelp av en mikropipettuttak. Bruk følgende protokoll for elektrodene (vær oppmerksom på at parametrene skal justeres tilsvarende for å oppnå ønsket motstand og viljeVarierer over trekk og med forskjellig glass): Varme: Ramp +10; Trekk: 0; Vel: 23; Forsinkelse: 1; Trykk: 500; Programsløyfe: 5 ganger. Forsikre deg om at tipsene er ~ 1 μm i diameter, med motstander på 2-4 MΩ for målretting av store celler og 5-7 MΩ for målretting av mindre celler.
  2. Legg merke til ganglioncellelaget ved hjelp av infrarød differensial interferenskontrast (IR-DIC) optikk ( figur 1A ). Identifiser GFP + Retinal Ganglion Cells (RGCs) ved bruk av epifluorescens (~ 480 nm) ( Figur 1B ).
  3. Finn pipetten fylt med intracellulær løsning i DIC. Påfør lite positivt trykk og null eventuelle spenningsforskjeller på forsterkeren.
  4. Trykk glassmikropipetten mot en GFP + -celle og påfør negativt trykk for å danne en GΩ-tetning mellom pipetten og cellemembranen. Påfør testspennings-kommandosteg ( f.eks. 5 mV) for å overvåke tetningsmotstanden. Etter å ha dannet en stabil segl, bryt membranen ved å bruke korte pulser av nEgativt trykk for å få tilgang til hele cellen.
  5. Vent 1-2 min for dendrittene i cellen for å fylle med fluorescerende sporer.
    MERK: Cellen kan skrives morfologisk ved å undersøke morfologien i epifluorescens ( figur 1C ). Når det gjelder melanopsin-uttrykkende RGCs, blir dendritisk stratifisering i det indre plexiformlaget visualisert ved å undersøke dendrittene fylt med fluorescerende sporingsenhet under epifluorescerende belysning og avgjøre om de stratifiserer langt fra summen i OFF sublina (M1 ipRGCs), nær ganglionet Celle lag i ON sublamina (M2 & M4 ipRGCs), eller begge (M3 ipRGCs). Denne observasjonen, kombinert med soma-størrelse (M4s har tydelig store somer sammenlignet med alle andre ipRGC-undertyper), tillater identifikasjon av celletype 20 , 21 , 22 . Dermed tillater denne teknikken for identifisering av celletype in vitro før RNA isosjons. Denne metoden kan modifiseres for andre celletypidentifikasjonsprotokoller som involverer enten dendritisk morfologi eller cellulær fysiologi.

4. Cellisolasjon (2 min)

  1. Før du begynner, sett bordplaten mikrocentrifugen til 2000 x g. Klargjør et prøveutvisningsapparat ved å koble slangen (OD: 3/32 i, ID: 1/32 in) med en 1 cm sprøyte.
  2. Plasser 0,2 ml PCR-rør inneholdende 10 ul lysisbuffer og 1% p-merkaptoetanol på is. Klargjør en 1 cm sprøyte med DEPC-behandlet H 2 O for å skylle pipettespissene. Klargjør en beholder tørr is for å fryse lysisbufferen etter prøveinnsamling.
  3. Trekk forsiktig cytoplasmatisk innhold av cellepipetten ved å påføre negativt trykk ved å bruke en 10 ml sprøyte; Alt cytoplasmatisk innhold, inkludert organeller, bør ekstraheres om mulig.
    1. Overvåk utvinningen i DIC ved å visualisere cellekroppens avtagende størrelse. Etter ekstraksjon Det cytoplasmatiske innholdet løfter pipetten forsiktig av vevet og fjerner pipetten raskt fra løsningen.
  4. Fjern pipetten raskt fra hodestøtten og skyll pipettespissen kort med DEPC-behandlet H 2 O med en 1 ml sprøyte. Koble pipetten til en 1 ml sprøyte via tettsittende rør for å utvise prøven.
  5. Utsett cellene umiddelbart inn i 10 μl lysisbuffer 1 som inneholder 1% β-merkaptoetanol i 0,2 ml PCR-rør.
    MERK: Hele aspiratet med cellene skal utvises forsiktig slik at det ikke innføres bobler.
    1. Sentrifuger røret kort i en minisentrifugering av bordplaten ved 2000 xg i 10 s. Blitsfrys prøvene øyeblikkelig i 5 minutter på tøris. Etter frysing, oppbevar dem ved -80 ° C i opptil to uker for å få de beste resultatene; Prøvene kan vare lenger, men det anbefales at de behandles så raskt som mulig.
E "> 5. RNA-rensing (30 min)

  1. Før du begynner, sett opp en magnetisk separator enhet ved å tappe den øverste delen av en omvendt P20 eller P200 tippholder til 96-brønn magnetisk stativ 23 .
  2. Forbered fersk 70% etanol (EtOH) - ca. 1 ml per prøve vil være tilstrekkelig. Fjern RNA magnetiske perler fra 4 ° C lagring og tine dem ved RT i minst 30 min.
    MERK: Ikke mer enn 8 prøver skal behandles på en gang, så mange trinn i denne protokollen er avhengige av effektivitet og rask håndtering.
  3. Når de magnetiske perlene er ved RT, virvel i 30 s for å sikre at løsningen er godt blandet.
    MERK: Perlene bruker en RNA-spesifikk buffer for å selektivt binde RNA, og de tillater fjerning av annet cellulært avfall når de brukes med en magnetisk platestativ.
  4. Tine celler ved RT i 1 min, og deretter tilsett 5 μL RNase-fri H20 til hver prøve; Pipetter opp og ned. Tilsett 22 μL RNA perler til hvert rør og pipettE grundig å blande. Inkuber prøvene ved RT i 5 minutter for å tillate RNA å samhandle og binde med magnetiske perler.
  5. Plasser rørene på en magnetisk separator enhet og la sitte i 8 minutter; Før du fortsetter, sørg for at supernatanten er tydelig. Vær oppmerksom på perlene fra en pellet og vær sikker på at du ikke løsner den under pipettering.
  6. Fjern supernatanten fra prøvene og tilsett 150 μl 70% EtOH. Fjern EtOH og gjenta vasken to ganger.
  7. La prøvene lufttørke i 6 minutter. Sjekk periodisk for å se om mer EtOH har samlet seg på bunnen av røret. Fjern det tilsvarende.
  8. Mens prøvene tørker, lag 10X reaksjonsbuffer ved å kombinere 19 μl lysisbuffer 2 og 1 μl RNase Inhibitor (40 U / μl). Snurre det ned og hold det på is.
  9. Når prøvene er tørre og perlepellets ikke lenger ser skinnende ut, fjern rørene fra den magnetiske separatoren og tilsett 9,5 μL RNase-fri H20Å rehydrere prøvene. Plasser prøvene på is og tilsett 1 μl 10x reaksjonsbuffer til hver prøve.

6. Omvendt transkripsjon (10 min)

MERK: Før du begynner, tine de nødvendige reagensene for revers transkripsjon (RT, unntatt enzymet) på is. Disse inkluderer: primer II, buffer 1, oligonukleotid og RNase inhibitor.

  1. Til hvert rør tilsettes 2 μl primer II (AAGCAGTGGTATCAACGCAGAGTACT (30) N -1N, for hvilken N- 1 kan være A, C eller G og N kan være A, C, G eller T; 12 μM). Plasser rørene i en termocykler som har blitt forvarmet ved 72 ° C i 3 minutter.
  2. Under inkubasjon skal du forberede RT-mastermixen. Til hver reaksjon tilsettes 4 μl buffer 1 (250 mM Tris-HCl, pH 8,3, 375 mM KCl og 30 mM MgCl2), 1 μl oligonukleotid (48 μM) og 0,5 μl RNase-inhibitor (40 U / uL).
  3. Straks etter inkuberingen, plasser rørene påIs i 2 min.
  4. Tilsett 2 μL per reaksjon av revers transkriptase (100 U / μl) til masterblandingen og pipetten grundig. Tilsett 7,5 μL masterblanding til hvert rør og bland ved forsiktig pipetting. Spinn rørene kort for å samle innholdet i bunnen og plasser dem i en forvarmet termocykler med følgende program: 42 ° C i 90 minutter, 70 ° C i 10 minutter og et hold ved 4 ° C.
  5. Oppbevar rørene ved -20 ° C / N før du fortsetter, selv om det anbefales at prøvene føres gjennom forsterkningstrinnet før de lagres i lange perioder. Andre kilder antyder O / N-lagring ved 4 ° C vil også være akseptabelt i dette trinnet 24 .

7. cDNA amplifisering (2,5 timer)

MERK: Tørk PCR-bufferen og PCR-primeren på isen før du begynner, og rør rørene ned i en mini-sentrifugering i bordplaten før du gjør PCR-masterblandingen.

  1. For hver reaksjon sReparere en PCR-masterblanding inneholdende 25 μl PCR-buffer, 1 μl PCR-primer (12 μM), 1 μl DNA-polymerase og 3 μl nukleasefri H20. Tilsett DNA-polymerasen sist, like før tilsetningen Av masterblandingen til prøvene.
  2. Tilsett 30 μl masterblanding til hvert rør og spinn ved 2000 xg i 10 s for å samle innholdet på bunnen av rørene.
  3. Plasser rørene i en forvarmet termocykler med følgende program: 95 ° C i 1 min; 34 sykluser på 98 ° C i 10 s, 65 ° C i 30 s og 68 ° C i 3 minutter; 72 ° C i 10 minutter; Og et hold ved 4 ° C.
    MERK: Antall sykluser for denne PCR har blitt økt til 34, forskjellig fra den foreslåtte produsentens instruksjoner. Etter gjentatt testing ble dette syklusnummer funnet å gi konsekvent pålitelige resultater.
  4. Oppbevar rørene ved -20 ° C i opptil ett år før du fortsetter.

8. Rensing av forsterket cDNA (30 min)

  1. Før du begynner rensing, ta DNA-perlene og elueringsbufferen til RT i minst 30 minutter. Forbered fersk 80% EtOH; 1 ml per prøve bør være tilstrekkelig. Tilsett 1 μL 10X lysisbuffer til hver prøve.
  2. Vortex DNA-perlene i 30 s og tilsett 50 μl DNA-perler til hver prøve. Bland godt gjennom pipettering, og spinn dem deretter kort ved 2.000 xg i 10 s. Inkuber rørene ved romtemperatur i 8 minutter.
  3. Plasser rørene på magnetisk separasjonsanordning i 5 minutter. Pip opp supernatanten forsiktig opp og ned to ganger og la prøvene sitte i 2 minutter. Mens prøvene er på den magnetiske enheten, fjern supernatanten og kast bort.
  4. Tilsett 150 μL nylagd 80% EtOH til hver prøve og la dem sitte ved romtemperatur i 30 s. Fjern EtOH og gjenta EtOH-vasken en gang.
  5. Snurre prøvene kort og plasser dem på magnetisk separator i 1 minutt. Fjern eventuelt resterende EtOH og la prøvene lufttørke i 5 minutter.
  6. Når perlpellet ikke lenger ser ut som det er skinnende, men før sprekker begynner å vises, fjern røret fra den magnetiske separatoren og tilsett 17 μL elueringsbuffer. Pipett forsiktig opp og ned for å resuspenere perlene helt.
  7. Inkuber de resuspenderte prøvene ved romtemperatur i 2 minutter.
  8. Snakk om prøvene for å samle all væske i bunnen og plasser dem på magnetisk separator i 2 minutter. Overfør 15 μl klar supernatant til et 1,5 ml RNase-fritt rør og lagre det ved -20 ° C.
  9. Undersøk kvaliteten og størrelsen på cDNA-biblioteket med en høysensiv bioanalysatorbrikke ved bruk av 1 μl cDNA. Den ideelle størrelsen på et cDNA-bibliotek er 0,3-2 Kb, med en konsentrasjon på minst 10 ng / μl ( figur 2 ).
    MERK: Du kan velge å benytte PCR som en måte å skjerme prøver for å sikre uttrykk for kjente markører før du fortsetter med prøve preparation.

9. Bestem konsentrasjoner og merking cDNA (20 min)

  1. Før begynnelsen, ta analysereagenset, fortynningsbufferen og standardene til RT i 30 minutter. Klargjør en masterblanding som inneholder 1 μl analysereagens og 199 μl fortynningsbuffer per reaksjon. Aliquot 199 μL av denne blandingen i 500 μl assayrør. Tilsett 1 μL prøve og bland godt sammen.
  2. Aliquot 190 μL masterblanding til rør 1 og 2. Tilsett 10 μL standard 1 til rør 1 og 10 μL standard 2 til rør 2. Vortex alle prøverør og standardrør i 5 s; Inkuber ved RT i 3 minutter.
  3. Bestem konsentrasjon av prøver med høy følsomhet fluorometer. Forsikre deg om at riktig prøvebeløp er innført ved å velge alternativet "Beregn lagerløsning" og markere "1 μL". Fortyn hver prøve i et separat 1,5 ml rør til en sluttkonsentrasjon på 0,2 ng / μl i RNase-fri H20.
    MERK:Mens produsentens instruksjoner tyder på at man skal begynne med 1 ng / μl totalt DNA, har vi brukt et mindre startbeløp og har også justert protokollen for å ta hensyn til dette endringen.
  4. I nye 0,2 ml PCR rør, pipette 2,5 μl buffer 2. Tilsett 1,25 μL cDNA til riktig rør for totalt 250 pg. Til slutt legger du 1,25 μL tagmenteringsblanding til hvert rør og pipetter grundig for å blande; Transposasen i merkingsblandingen vil fragmentere DNA-en i korte tråder og anneale adaptrene til hver ende av hver streng, for senere bruk av sekvenseringsinstrumentet.
    MERK: Volumene som brukes til merking og indekskobling er en brøkdel av mengden som foreslås av produsentens instruksjoner. Dette tillater ikke bare bevaring av reagenser, men det har også konsekvent produsert tagmented prøver i vår erfaring.
  5. Sentrifuger rørene på en mikrobølgeovn i 1 minutt.
  6. Plasser røreneI en forvarmet termocykler med følgende program: 55 ° C i 10 minutter og et hold ved 10 ° C.
    MERK: Lengden på denne inkubasjonen er 10 min, i motsetning til den foreslåtte 5 min fra produsentens instruksjoner.
  7. Umiddelbart etter at dette programmet er ferdig, fjern rørene og legg til 1,25 μL tagmenterings nøytraliserende buffer til hver. Pipetter godt å blande og inkubere ved romtemperatur i 5 minutter. Fullfør dette trinnet raskt, ettersom transposasen forblir aktiv til bufferen nøytraliserer enzymet og stopper reaksjonen.

10. Indekskobling og rensing (1 time)

MERK: Før du begynner, ta DNA-perlene og resuspensjonsbufferen til RT i minst 30 minutter. Bestem hvilke indekser som skal brukes for hver av prøvene.

MERK: Disse indeksene vil bli festet til de respektive 5'- og 3'-ender av det fragmenterte DNA for identifisering av prøver som følger sekvensering. Pass på at ingen toSammenkoblinger er de samme for prøver som kan sekvenseres sammen. Hvis eksempel 1 vil bruke indekser hvitt 1 og oransje 1, bør prøve to bruke hvit 1 og oransje 2 eller hvit 2 og oransje 2, men aldri den samme kombinasjonen av indekser. Dette settet inneholder 4 forskjellige hvite og 6 forskjellige oransjeindekser. Alle de forskjellige mulige kombinasjonene tillater opptil 24 prøver å bli samlet i en sekvenseringsbane. Selv om vi vanligvis bare samler 10 prøver i en kjørefelt, kan man også bruke settet som inneholder 24 indekser, noe som ville tillate samling av 96 prøver i en enkelt sekvensering, hvis ønskelig.

  1. Til hvert rør legger du til 1,25 μL av venstre indeks og 1,25 μL av høyre indeks for den aktuelle prøven. Tilsett 3,75 μL PCR master mix og pipette godt å blande.
  2. Sentrifuger i en mikrobølgeovn i benkeplate i 1 min.
  3. Plasser rørene i en forvarmet termocykler med følgende program: 72 ° C i 3 minutter; 95 ° C i 30 s; 12 sykluser på 9576 ° C i 10 s, 50 ° C i 30 s og 72 ° C i 1 min; 72 ° C i 5 minutter; Og et hold ved 4 ° C.
    MERK: Det første 95 ° C trinnet ble endret fra 98 ° C, som ble foreslått av produsentens instruksjoner. Dessuten ble syklusdetaljene justert slik at temperaturer og tidslengder tillatt for optimal merking av våre prøver. Den endelige 72 ° C inkubasjonen ble også lagt til vår protokoll og ble ikke inkludert i produsentens instruksjoner.
  4. Spinn rørene kort for å samle inn innholdet på bunnen. Vortex DNA-perlene i 30 s, og tilsett deretter 30 μL til hvert rør og bland godt gjennom pipettering.
  5. Inkuber prøvene ved RT i 5 min.
  6. Plasser prøvene på en magnetisk separator i 2 minutter. Pipetter supernatanten opp og ned to ganger og inkuber prøver i 1 min.
  7. Fjern og kassér den klare supernatanten. Tilsett 150 μl 80% EtOH til hver prøve og fjern. Gjenta EtOH-vasken en gang.
  8. Tillat thE prøver å lufttørke i 10 minutter. Sjekk periodisk for å se om noe EtOH har samlet i bunnen av rørene og fjern etter behov.
  9. Når en sprekk begynner å dukke opp i DNA-pelletspellet, fjern prøven fra den magnetiske separatoren og tilsett 27,5 μL resuspensjonsbuffer for å rehydrere pelleten. Kontroller at pellet er fullstendig resuspendert, og inkuber deretter ved romtemperatur i 2 minutter.
    MERK: Volumet som ble brukt til resuspensjonsbufferen ble modifisert for å ta hensyn til mindre mengde utgangsmateriale i protokollen vår og avviker fra det foreslåtte volumet i produsentens instruksjoner.
  10. Plasser rørene på magnetisk separatoren i 2 minutter. Overfør 25 μl klar supernatant i et RNase-fritt rør og lagre ved -20 ° C.
    MERK: Ikke fortsett med produsentens instruksjoner for å fullføre bibliotekets normalisering. Prøver blir vellykket forberedt etter dette trinnet og er forberedt på sekvensering som det er.
  11. Analyser tAgmentering av prøvene ved bruk av en bioanalysatorchip og 1 μl av hver prøve.
    MERK: Analysen av smears vil bli utført som tidligere; Imidlertid bør cDNA nå detekteres i et størrelsesområde på 0,2-1 Kb ( figur 3 ). Smører under dette punktet representerer sannsynligvis nedbrytning av prøver, mens større smører tyder på ufullstendig merking.

11. Pooling av prøver (10 min)

  1. Hent konsentrasjoner av tagmenteringsprøver med høysensitiv fluorometer fra tidligere og bestem konsentrasjonen i nM.
    MERK: Denne beregningen kan beregnes ved bruk av et Internett-konverteringsverktøy, og avhenger av gjennomsnittlig fragmentlengde fra bioanalysator-sporet. For å bestemme den gjennomsnittlige fragmentlengden, observere sporet for hver prøve enkeltvis og bestem størrelsen på gjennomsnittlig DNA-fragment. Dette kan også beregnes ved undersøkelse av bioanalysator-sporet ved å markere spekterets rekkevidde og undersøkelseE molaritet beregnet av programmet.
  2. Kombiner prøver slik at bassenget inneholder samme konsentrasjon av hver prøve. Ikke fortynn prøver; Bassenget bør bare være like fortynnet som den lavest konsentrerte prøven og vil helst ha en total konsentrasjon på minst 15 nM.
  3. Oppbevar de samlede prøvene ved -20 ° C før sekvensering; Det foreslås at prøver gjennomgår sekvensering innen 1 uke etter samling. Utfør parreend, 100 bp sekvensering med en HiSeq-plattform.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Celletyper klassifiseres lett etter fargestoffinjeksjonen

Figur 1 viser et eksempel på en GFP + RGC før og etter fluorescerende sporingspåfylling. Denne cellen ble identifisert basert på dens ekspresjon av GFP i den transgene linjen ( Figur 1A ). En tett forsegling ble dannet med en finspiss, trukket glasselektrode på summen av denne cellen. For å karakterisere subtypen ble det fluorescerende fargestoff injisert i summen og tillatt å fylle alle tilknyttede prosesser ( figur 1B ). Klassifiseringen som en M4 ipRGC ble aktivert gjennom observasjonen at denne cellen har en veldig stor soma, og at dens prosesser slutter innenfor ON-sublimina av det indre plexiformlaget ( Figur 1C ). Som en illustrasjon av forskjeller i stratifisering som kan oppfattes i en isolert retinalpreparasjon, fylte vi M1 (OFF-stratifyinG), M3 (registrert) og M4 (ON-stratifiserende) ipRGCs med en fluorescerende sporingsenhet, fikserte dem og utførte konfokal bildebehandling av ON og OFF-underlinjen ( Figur 1D ). Denne visualiseringen av dendrittene via konfokal avbildning er svært lik hvordan dendritene ser ut i ufiksert in vitro vev når cellene er fylt med en fluorescerende sporer (Schmidt og Kofuji 2009, 2010, og 2011).

CDNA-biblioteker fra enkeltceller

Bruken av en Oligo d (T) primer tillater selektiv revers transkripsjon og amplifisering av mRNA. Etter generering og amplifisering av cDNA-bibliotekene fra hver celle ble bioanalysatorchips brukt til å vurdere kvaliteten og størrelsen på bibliotekene. Resultatene av denne analysen viser at de ideelle cDNA-smearene er 0,5-2 Kb i en god prøve ( figur 2A ). Noen prøver viser noen få bånd eller smører under 300 bp mark, sugGis at disse bibliotekene er av dårlig kvalitet (se tabell 1 for feilsøking). Et eksempel på en god kvalitet bioanalysator spor viser få eller ingen DNA bånd under 300bp og et robust smear mellom 500bp og 2Kb (figur 2B). Tomme kontrollbaner skal vise nedre og øvre markører ved henholdsvis 35 og 10380 bp, samt en stabil grunnlinje som ikke svinger. Ulike biblioteker kan produsere kvalitetsdata, som det fremgår av både figur 2B og 2C , som ga gode lesedybder og høy kartingshastighet. Bare de prøvene med sterke cDNA-biblioteker av den forventede størrelsen bør gjennomføres til tagmentering (se tabell 1 for feilsøking).

Low-input tagmentation forbereder høykvalitets prøver for sekvensering

Denne protokollen er optimalisert for tagmentering med en mindre mengde startmateriale l. Bare 250 pg fungerer best for en vellykket tagmentering, da lavere mengder ikke forsterkes ordentlig og høyere mengder ikke vil fragmentere helt. Etter fullføring av tagmenteringen og PCR-amplifikasjon / prøveopprydding ble prøvene igjen analysert på en bioanalysatorchip. Den ideelle cDNA-smøret på dette tidspunktet skal være 0,2-1 Kb ( figur 3A ). Sporet skal vises jevnt og jevnt fordelt mellom de to størrelsene ( figur 3B ); Dette sporet tilsvarer prøven i bane 1. Figur 3C viser en ufullstendig merking, som kan løses lett (se tabell 1 for feilsøking). Vi har utført dataanalyse på prøvene og funnet ut at denne protokollen produserte prøver med gode lesedybder, ofte over 12 millioner avlesninger per prøve; Gjennomsnitt på 69,1% kartlegging; Og mer enn 5000 uttrykte gener.

/55229fig1.jpg "/>
Figur 1: Identifikasjon av RGC-typer basert på GFP-ekspresjon i Melanopsin-uttrykkende ipRGC'er og på morfologiske egenskaper. ( A ) Ganglion-celle laget av netthinnen, visualisert ved å bruke IR-DIC i hele montering av retina. ( B ) Det samme preparatet visualisert i epifluorescens (~ 480 nm) for å identifisere GFP-uttrykkende ganglionceller. ( C ) En GFP-uttrykkende celle rettet for patch-clamp opptak og fylt med en fluorescerende sporingsenhet. Cellen kan identifiseres som en M4 ipRGC basert på dens meget store soma størrelse og ON-stratifiserende dendritter 25 , 26 . ( D ) Konfokalt bilde av ipRGC-dendriter som er avbildet i IPL (M1) ON og / eller OFF-underlinjen, i IPL (M4) ON-underlinjen, og i både IPL (M3) ON og OFF-underlinjen. IR-DIC: Infrarød differensial interferenskontrast..jove.com / files / ftp_upload / 55229 / 55229fig1large.jpg "target =" _ blank "> Vennligst klikk her for å se en større versjon av denne figuren.

Figur 2
Figur 2: Analyse av cDNA-bibliotekskvalitet med et Bioanalyzer-spor. ( A) Bioanalyzer-utgangseksempel for flere prøver som har blitt omvendt transkribert, forsterket og renset. Banene 1-3 viser de ideelle DNA-smørene, med størstedelen av DNA som er større enn 300 bp. Biblioteker med smører i dette området har konsekvent gitt utmerkede sekvenseringsdata, som viser et gjennomsnitt på 5,683 gener uttrykt per celle. Bane 4 representerer en prøve som ikke ble behandlet og dermed ikke produsert cDNA. Den vellykkede kontrollbanen har en konstant grunnlinje og to rene topper ved 35 og 10 380 bp. ( B ) Eksempel på et vellykket bioanalysatorspor med en høy intensitet av cDNA rundt 2 Kb. Dette s Møre tilsvarer prøven i bane 1. ( C ) Eksempel på et vellykket bioanalyserspor med cDNA sentrert rundt 500 bp. Dette sporet tilsvarer prøven i bane 3. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 3
Figur 3: Taggerte prøver viser robuste smører mellom 0,2 og 2 Kb. ( A ) Et representativt eksempel bioanalyserutgang etter tagmentering, amplifisering og PCR-opprydding. ( B ) Spor av en vellykket merket prøve som svarer til sporet 1 i (A). ( C ) Eksempel på spor for en prøve med ufullstendig tagmentering, klar av toppintensiteten rundt 1 Kb."> Vennligst klikk her for å se en større versjon av denne figuren.

2 "> Fortynn prøve til konsentrasjon på 0,4 ng / μl og gjenvinnings tagmentering
Problem Mulig årsak Løsning
Trinn 3.3) Kan ikke danne GΩ-segl Overflaten av cellen er ikke ren nok Rengjør videre ved hjelp av positivt trykk
Trinn 3.3) Celle ser ut til å deflate / dø Forbered ny pipette og målrett en ny celle
Trinn 3.4) Kan ikke bestemme terminalsted for dendriter Alexafluor har ikke fått nok tid til å diffundere gjennom cellen eller konsentrasjonen av Alexafluor er ikke høy nok Kontroller at forsterknings- og eksponeringstiden på kameraet er høy nok. Vent ytterligere 5 minutter før du visualiserer dendriter. Hvis dendriter fortsatt ikke er synlige, lag oppløsning med høyere Alexafluorkonsentrasjon.
Trinn 4.1) Kan ikke aspirere hele cytoplasma
Trinn 5.5) Supernatant er ikke klart etter 8 minutter Pipett hele løsningen forsiktig to ganger, mens den fortsatt er på magnetisk separator, og la den sitte i ytterligere 5 minutter
Trinn 5.5) Pellet dispergerer under pipettering Eksemplet er for langt fra magnet Hold rør på magnetisk separeringsenhet under all pipettering. Utstøt løsningen og la perlene pille på nytt i 5 min
Trinn 5.7) Etter 5 minutter vises prøver fortsatt skinnende Maksimal mengde EtOH er ikke fjernet Fortsett å overvåke prøver under tørking. Hver 2 min, bruk en P10 pipette og fjern alt EtOH på bunnen av røret
Trinn 8.9) Pellet hadde sprekker før rehydrering Tillat prøve å rehydRate for totalt 4 minutter, i stedet for 2 (trinn 8.10)
Trinn 8.11) Liten mengde perle ble tatt opp med supernatant Skyll hele prøven tilbake i rør og sett på magnetisk separator i 1 min. Pip opp forsiktig og sørg for å unngå pellet
Trinn 8.12) DNA-smear er inkonsekvent og fluorescensskalaen endres kontinuerlig For høy DNA-konsentrasjon for en HS-chip Kontroller konsentrasjonen av prøven og fortynn mellom 1 - 10 ng / μL. Rerun bioanalyzer
Trinn 8.12) Smøremiddel med lav molekylvekt RNA-nedbrytning Sørg for å blinse frysecellen umiddelbart etter innsamling. Kast dette cDNA-biblioteket ut
Trinn 8.12) Fluktuerende markørbaseline i kontrollbanen Forurensning eller gammelt reagens Kast DNA-markør og bruk nytt rør for Bioanalyzer-løp
Trinn 8.12) Ingen DNA-smear Manglende utvisning av celle Trekk nye nåler med en litt større spiss
RNA-beadfeil Forsikre deg om at perlene har blitt fullstendig resuspendert før bruk og la prøvene inkuberes før du plasserer på magnetisk separator
Trinn 8.12) Svakt DNA-smear Ikke nok forsterkning Bruk flere PCR-sykluser
Trinn 8.12) DNA smear utenfor 500bp-2Kb rekkevidde DNA-smører under 0,5 og over 2 Kb er sannsynlig forurensning. Kast prøve ut
Trinn 8.12) Regelmessig fordelte pigger på DNA-spor Forurensning av prøven Bruk alltid friske hansker og lage ny etanol for skylle; Filtertips skal alltid brukes
Trinn 9.3) Kunne ikke oppdage konsentrasjon av prøve på fluorometer Prøver under deteksjonsnivå har for lite DNA for tagmentering og kan ikke brukes
Trinn 10.10) Prøver er ikke tørre etter 10 minutter Fortsett å fjerne overflødig EtOH La prøvene lufttrykke lenger, kontroller dem hvert minutt
Trinn 10.13) Smøre skjev mot 2Kb Ufullstendig fragmentering Refortynnet prøve til en konsentrasjon på 0,15 ng / μL, i stedet for 0,2 ng / μl; Rerun tagmentation
Trinn 10.13) Smøre skjev mot 200bp For lite DNA-inngang Fortynn prøven mindre, prøv en konsentrasjon på 0,4 ng / μL; Rerun tagmentation
Tagmenteringsreaksjon for lenge Reduser reaksjonstid for tagmentering til 8 min
Trinn 10.13) Svake smører Feil forsterkning av DNA
Trinn 11.2) Maksimal oppnåelig bassengkonsentrasjon er under 5 nM Identifiser hvilke prøver som har betydelig lave konsentrasjoner og gjenvinning med nye fortyndinger

Tabell 1: Løsninger og forslag til potensielle hindringer i protokollen. Denne tabellen viser potensielle vanskeligheter som kan oppstå under denne protokollen, og trinnene der det kan oppstå dem. Denne tabellen viser mulige årsaker til mange av disse problemene, samt løsninger som kan bidra til å løse eventuelle problemer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vår protokoll demonstrerer, gjennom en rask og brukervennlig guide, en metode for å forberede enkeltceller av identifiserte morfologiske klasser for kvalitetssekvensering, med liten skade på prøven. I det nåværende manuskriptet er iboende lysfølsomme retinale ganglionceller morfologisk karakterisert, isolert og fremstilt for RNA-Seq. Cellulære påkjenninger kan oppstå under retinalhåndtering; Av denne grunn erstatter vi hvert stykke vev etter ikke mer enn 4 timer bruk. Vi kan vurdere tilstanden til cellene ved å bruke elektrofysiologi-riggen til å registrere fra disse cellene og for å overvåke deres responser, noe som gjør at vi kan sikre at cellene har god helse. Vår protokoll tillot genereringen av vellykkede cDNA-biblioteker fra 15 av 23 prøver behandlet, noe som gir en suksessrate på 65%. Videre var kvaliteten på våre sekvenseringsdata utmerket, ettersom gjennomsnittlig antall gener uttrykt av våre celler varierte fra 2,316-10,353, med et gjennomsnitt på 5,683Gener registrerer med en ikke-null FPKM-verdi. Disse tallene ligner på uttrykte gental funnet av andre studier av nevroner 5 , som viser at våre data er også av god kvalitet.

Selv om vi har hatt suksess med denne protokollen for disse spesifikke nevronene, bør det bemerkes at mindre endringer i denne teknikken kan brukes for en rekke forskjellige applikasjoner. Ved hjelp av fluorescensaktivert cellesortering (FACS) i en separat musemodell, har vi isolerte små populasjoner av celler (1000 -25.000) merket med en GFP-markør fra sentralnervesystemet. RNA fra disse populasjonene ble isolert, og 1 μl (ved eller litt under 12 ng / μl) av dette RNA ble brukt til å starte revers transkripsjonen i trinn 6.1. Den eneste justeringen som skal gjøres til protokollen etter dette trinnet, skjer i trinn 7.4, på hvilket tidspunkt kan man velge å benytte færre PCR-sykluser. Vi har brukt 19 sykluser i tilfeller der den første prøven inneholdt gReater enn 10.000 celler og har funnet ut at dette produserer cDNA-biblioteker av god kvalitet. For eksempel ble celleprøver fremstilt fra en FACSortert populasjon, og antallet gener uttrykt varierte fra 12,340-14,052, med et gjennomsnitt på 13.265 gener med en ikke-null FPKM-verdi. Denne teknikken kan brukes på forskjellige musemodeller som en fluorescerende reporter er til stede. På grunn av dette endringen kan forskere potensielt studere hvilken som helst cellepopulasjon som en fluorescerende reportermus er tilgjengelig for, og utvide studier forbi området neuronal mangfold.

En andre justering kan gjøres til profilceller basert på funksjonalitet i stedet for bare morfologi. Dette prosjektet er avhengig av en transgen modell, men denne teknikken kan brukes på nevroner uten kjente molekylære identifikatorer. For eksempel er det over 30 funksjonelle subtyper av retinal ganglionceller som for tiden er identifisert 27 , hvorav få av dem har unike markører. Som denne teknikkenEr allerede avhengig av en elektrofysiologisk rigger for cellefyllingen, kan man benytte lappeklemming for å identifisere den funksjonelle responsprofilen til hver celle basert på dens spikningsmønster. Ved bruk av lettutviklede spikeopptak, kunne klassifiseringen av retinalneuroner bestemmes før cellisolasjon. Denne teknikken virker på retinale ganglionceller, men det kan bli utvidet til å undersøke andre retinale neuroner. Det skal imidlertid bemerkes at hvis denne protokollen brukes til å skrive retinebipolare eller amakrine celler i det indre kjernefysiske laget, må man for eksempel være forsiktig med å gi konstant positivt trykk ved elektrodens spiss for å unngå å kontakte celler som Elektroden går gjennom ganglioncellelaget og det indre plexiformlaget. For retinalneuroner i det indre kjernefysiske lag, vil forberedelsen av retinalseksjoner før cellulære opptak sannsynligvis fungere best for å konsekvent unngå konsentrasjon. Hver celle ville bli isolert og fremstilt som beskrevet her etter claSsification trinn. Videre foreslår vi bruken av denne protokollen for undersøkelse av nevroner, men denne teknikken kan brukes på hvilken som helst celletype som kan bli morfologisk karakterisert eller isolert ved bruk av en transgen modell.

Denne teknikken kan også modifiseres for å arbeide med tidligere fremstilte cDNA-biblioteker, som vi tidligere har generert for mikroarray-hybridisering 28 . Med et separat forberedt bibliotek begynner man med cDNA-mengder i området 50-150 ng og starter protokollen i trinn 8.4; Høyere og lavere konsentrasjoner har ikke blitt forsøkt, selv om de kan fungere også. Rensing av cDNA ved bruk av DNA-perler vil oppstå først, etterfulgt av tagmentering og PCR-amplifisering. Vi har testet denne justeringen med cDNA fra bibliotekspreparasjoner, slik som for mikroarray-hybridisering 29 , og har vellykket produsert tagmenterte biblioteker for RNA-Seq.

FinAlliert, denne protokollen kan brukes i vurderingen av suksessen til en bestemt induksjon av cellepopulasjoner fra induserte pluripotente stamceller (iPSCs). Drivkraften bak differensiering av disse omprogrammerte pluripotente celler er avhengig av forståelse av transkripsjonsfaktorene som fører til at celletyper utvikles separat fra hverandre. Kjøring av iPSCs mot bestemte cellefeller er en ny metode for å studere neuronal mangfold, da det kan brukes til å selektivt generere celletyper. Denne protokollen kan tilpasses for å vurdere kvaliteten på mangfoldet mellom differensierte celler fra denne modellen. Som tidligere nevnt er det mer enn 30 funksjonelle subtyper av retinal ganglionceller, og mange anstrengelser har blitt gjort for å generere funksjonelle RGCer fra iPSCs. Identifiseringen av markører for undertyper av RGCs - i vårt tilfelle, ipRGCs - vil tillate forskeren å evaluere suksessen til protokollen sin i å produsere ulike undertyper av RGCs. Evalueringen av celletyperBlant disse nevronene vil ha nytte av denne protokollen og kan også fungere som et verktøy for fortsatt undersøkelse av subtypespesifikke markører som dette modellsystemet blir lett tilgjengelig.

I det nåværende manuskriptet beskriver vi en enkel teknikk for isolering og fremstilling av enkeltceller for transkriptomisk analyse. Videre foreslår vi måter å redigere protokollen på, slik at denne teknikken kan brukes til en rekke eksperimenter med en rekke mål i tankene. Protokollen beskrevet her ble tilpasset fra en protokoll beskrevet av Trombetta et al. 24 som en justering av anbefalte kit-instruksjoner for lav-inngangs-RNA-Seq. De store forskjellene ligger innenfor celleisolasjon og ulike volumetriske endringer som vi har valgt for å best passe behovene til dette prosjektet. Det er viktig å fremheve at det viktigste trinnet i denne protokollen er isoleringen av celler fra retinalvevet. Dette er poenget i protokollen durinG som de fleste feil kan oppstå, og det skal utføres med den mest forsiktige oppmerksomheten. Enhver mengde forurensning kan resultere i ubrukelige prøver, mens tapet av cytoplasma kan forårsake en alvorlig uttømming av mRNA-molekyler. Dette trinnet skal utføres med forsiktighet og av samme person fra eksperiment for å eksperimentere for å sikre at prøvene har blitt håndtert nøyaktig.

Sammendrag beskriver denne protokollen en teknikk for klassifisering, isolering og fremstilling av celler for RNA-Seq av høy kvalitet. Dette er en effektiv, relativt billig måte å optimalisere kvaliteten på data fra enkeltceller. Denne teknikken er allsidig og kan være minimal modifisert for anvendelse på ulike studier.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Vi vil gjerne anerkjenne Jennifer Bair og Einat Snir, samt Universitetet i Iowa Institute for Human Genetics, for hjelp til å forberede og håndtere prøver.

Materials

Name Company Catalog Number Comments
Ames' Medium Sigma Aldrich A1420-10X1L
Sodium Bicarbonate Sigma Aldrich S8875
K-gluconate Spectrum Chemical PO178
EGTA Sigma Aldrich E4378
HEPES Sigma Aldrich H3375
Diethyl pyrocarbonate (DEPC) Sigma Aldrich D5758
Alexa Fluor 594 Hydrazide Invitrogen A10442
Collagenase Worthington Biochemical  LS005273
Hyaluronidase Worthington Biochemical  LS002592
Petri dish (35 mm diameter) Thermo Fisher Scientific 153066
Ophthalmologic scissors Fine Science Tools 15000-00
#5 Forceps Fine Science Tools 11252-30
Microplate Shaker Fisher Scientific 13-687-708
Glass Micropipette Sutter BF120-69-10
Micropipette Puller Sutter P-1000 horizontal pipette puller
1 mL syringe Fisher Scientific 14-823-2F
Flexible tubing Fisher Scientific 14-171
TCL lysis buffer Qiagen 1031576 Lysis Buffer 1
β-mercaptoethanol Sigma Aldrich M3148
RNase-free Water Qiagen 129112
0.2 mL PCR tubes Eppendorf 30124359
Ethyl Alcohol, Pure Sigma Aldrich E7023 Ethanol
Analog Vortex Mixer Thermo Fisher Scientific 02215365 Vortex
Mini Centrifuge Thermo Fisher Scientific 05-090-100
Agencourt RNAClean XP Beads Beckman Coulter A63987 RNA magnetic beads
MagnaBlot II Magnetic Separator Promega V8351 Magnetic stand
1.5 mL MCT Graduated Tubes Thermo Fisher Scientific 05-408-129
Smart-Seq v4 Ultra Low Input RNA Kit Clontech 634888 Reagents for Reverse Transcription and PCR Amplification
10x Lysis Buffer Lysis Buffer 2
5x Ultra Low First-strand Buffer Buffer 1
3' SMART-Seq CDS Primer II A Primer II
SMART-Seq v4 Oligonucleotide Oligonucleotide
SMARTScribe Rverse Transcriptase Reverse Transcriptase (RT)
2x SeqAmp PCR Buffer PCR Buffer
PCR Primer II A PCR Primer
SeqAmp DNA Polymerase DNA Polymerase
Mastercycler pro S Eppendorf 950030020 Thermocycler
Agencourt AMPure XP Beads Beckman Coulter A63881 DNA magnetic beads
2100 Bioanalyzer Agilent Technologies G2939AA
HS Bioanalyzer Chips & Reagents Agilent Technologies 5067-4626
Qubit HS Assay Kit Thermo Fisher Scientific Q32851 For the calculation of sample concentrations
Qubit Assay Tubes Thermo Fisher Scientific Q32856
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866
Nextera XT DNA Sample Preparation Kit Illumina FC-131-1024 Reagents for Tagmentation and Index Coupling
TD Buffer Buffer 2
ATM Tagmentation Mix
NT Buffer Tagmentation Neutralizing Buffer
NPM PCR Master Mix
Nextera XT Index Kit Illumina FC-131-1001 Indices for Tagmentation
N501 White 1
N502 White 2
N701 Orange 1
N702 Orange 2
HiSeq 2500 Illumina SY-401-2501 For completing sequencing of samples

DOWNLOAD MATERIALS LIST

References

  1. Austin, C., Cepko, C. L. Specification of Cell Fate in the Vertebrate Retina. Neural Cell Specif. 3, 139-143 (1995).
  2. Masland, R. H. The Neuronal Organization of the Retina. Neuron. 76, (2), 266-280 (2012).
  3. Rodieck, R. The First Steps in Seeing. Sinauer Associates, Inc. Sunderland, MA. (1998).
  4. Chiu, I. M., et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife. 3, e04660 (2014).
  5. Tasic, B., et al. Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci. 19, (2), 335-346 (2016).
  6. Trapnell, C. Defining cell types and states with single-cell genomics. Genome Res. 25, (10), 1491-1498 (2015).
  7. Zeisel, A., et al. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science. 347, (6226), 1138-1142 (2015).
  8. Schmidt, T. M., Do, M. T. H., Dacey, D., Lucas, R., Hattar, S., Matynia, A. Melanopsin-Positive Intrinsically Photosensitive Retinal Ganglion Cells: From Form to Function. J. Neurosci. 31, (45), 16094-16101 (2011).
  9. Eberwine, J., Miyashiro, K., Kacharmina, J. E., Job, C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc. Natl. Acad. Sci. 98, (13), 7080-7085 (2001).
  10. Darmanis, S., et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl. Acad. Sci. 112, (23), 7285-7290 (2015).
  11. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  12. Usoskin, D., et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, (1), 145-153 (2015).
  13. Poulin, J. F., Zou, J., Drouin-Ouellet, J., Kim, K. Y. A., Cicchetti, F., Awatramani, R. B. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell. Rep. 9, (3), 930-943 (2014).
  14. Gross, A., Schoendube, J., Zimmermann, S., Steeb, M., Zengerle, R., Koltay, P. Technologies for Single-Cell Isolation. Int. J. Mol. Sci. 16, 16897-16919 (2015).
  15. Lovatt, D., et al. Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue. Nat Methods. 11, (2), 190-196 (2014).
  16. Qiu, S., et al. Single-neuron RNA-Seq: Technical feasibility and reproducibility. Front. Genet. 3, (124), 1-8 (2012).
  17. Subkhankulova, T., Yano, K., Robinson, H. P. C., Livesey, F. J. Grouping and classifying electrophysiologically-defined classes of neocortical neurons by single cell, whole-genome expression profiling. Front. Mol. Neurosci. 3, (10), 1-11 (2010).
  18. Fuzik, J., et al. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat. Biotechnol. 34, (2), 175-183 (2016).
  19. Schmidt, T. M., Kofuji, P. An isolated retinal preparation to record light response from genetically labeled retinal ganglion cells. J. Vis. Exp. (47), e2367 (2011).
  20. Schmidt, T. M., Kofuji, P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci. 29, (2), 476-482 (2009).
  21. Schmidt, T. M., Kofuji, P. Structure and Function of Bistratified Intrinsically Photosensitive Retinal Ganglion Cells in the Mouse. J Comp Neurol. 519, (8), 1492-1504 (2011).
  22. Schmidt, T. M., Kofuji, P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci. 30, (48), 16262-16271 (2010).
  23. Clontech Laboratories I. SMARTerTM Ultra Low RNA Kit for Illumina® Sequencing. (2013).
  24. Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K., Regev, A. Preparation of single-cell RNA-Seq libraries for next generation sequencing. Curr. Protoc. Mol. Biol. 4, (22), 1-17 (2014).
  25. Ecker, J. L., et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: Cellular diversity and role in pattern vision. Neuron. 67, (1), 49-60 (2010).
  26. Schmidt, T. M., et al. A Role for Melanopsin in Alpha Retinal Ganglion Cells and Contrast Detection. Neuron. 82, (4), 781-788 (2014).
  27. Sanes, J. R., Masland, R. H. The Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification. Annu. Rev. Neurosci. 38, 221-246 (2014).
  28. Goetz, J. J., Trimarchi, J. M. Single-cell Profiling of Developing and Mature Retinal Neurons. J. Vis. Exp. e3824 (2012).
  29. Trimarchi, J. M., et al. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. J. Comp. Neurol. 502, 1047-1065 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics