Single-cell RNA-Seq van gedefinieerde subsetjes van retinale Ganglion-cellen

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier presenteren we een combinatorische aanpak voor het classificeren van neuronale celtypes voorafgaand aan isolatie en voor de daaropvolgende karakterisering van enkelvoudige transcriptomen. Dit protocol optimaliseert de voorbereiding van monsters voor succesvolle RNA Sequencing (RNA-Seq) en beschrijft een methodologie die speciaal is ontwikkeld voor een beter begrip van cellulaire diversiteit.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Laboissonniere, L. A., Sonoda, T., Lee, S. K., Trimarchi, J. M., Schmidt, T. M. Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells. J. Vis. Exp. (123), e55229, doi:10.3791/55229 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De ontdekking van celtypespecifieke markers kan inzicht verschaffen in de cellulaire functie en de oorsprong van cellulaire heterogeniteit. Met een recente push voor het verbeterde begrip van neuronale diversiteit is het belangrijk genen te identificeren waarvan de expressie verschillende subpopulaties van cellen definieert. Het retina dient als een uitstekend model voor de studie van de diversiteit van het centrale zenuwstelsel, omdat het bestaat uit meerdere belangrijke celtypes. De studie van elke belangrijke celklasse heeft genetische markers opgedaan die de identificatie van deze populaties vergemakkelijken. Echter, er zijn meerdere subtypes van cellen binnen elk van deze belangrijke retinale celklassen, en weinig van deze subtypes hebben genetische markers bekend, hoewel veel door morfologie of functie gekenmerkt zijn. Kennis van genetische markers voor individuele retinale subtypen zou de studie en het in kaart brengen van hersendoelstellingen in verband met specifieke visuele functies mogelijk maken en kan ook inzicht geven in de genenetwerken dieHandhaven van cellulaire diversiteit. Huidige lijnen die gebruikt worden om de genetische markers van subtypen te identificeren bezitten nadelen, zoals de classificatie van celtypen die volgend op sequentiebepaling. Dit geeft een uitdaging voor data-analyse en vereist strikte validatiemethoden om ervoor te zorgen dat clusters cellen van dezelfde functie bevatten. Wij stellen een techniek voor om de morfologie en functionaliteit van een cel te identificeren voorafgaand aan isolatie en sequencing, waardoor de subtypespecifieke markers eenvoudiger kunnen worden geïdentificeerd. Deze techniek kan uitgebreid worden naar niet-neuronale cel typen, evenals zeldzame populaties van cellen met kleine variaties. Dit protocol levert uitstekende data, zoals veel bibliotheken hebben gelezen diepte groter dan 20 miljoen leest voor enkele cellen. Deze methode overwint veel van de hindernissen die door single-cell RNA-Seq worden gepresenteerd en kunnen geschikt zijn voor onderzoekers die op een eenvoudige en zeer efficiënte manier mobiele types typen.

Introduction

Neuronale diversiteit wordt waargenomen in het centrale zenuwstelsel, in het bijzonder in het vertebrate retina, een zeer gespecialiseerd weefsel dat bestaat uit 1 glial- en 6 neuronale celtypen die voortvloeien uit een populatie van retinale voorlopercellen 1 , 2 , 3 . Veel subtypes van cellen kunnen functioneel, morfologisch en genetisch worden ingedeeld. Het doel van dit protocol is om de genetische variabiliteit van celtypen te binden aan hun identificeerbare functionele en / of morfologische eigenschappen. Er zijn een aantal genen geïdentificeerd voor de indeling van cellen, maar veel subtypes blijven ongekarakteriseerd, aangezien zij een kleine fractie van de totale populatie vertegenwoordigen. De identificatie van genen binnen deze specifieke subtypes zal een groter begrip van de neuronale diversiteit in het netvlies mogelijk maken en kan ook de diversificatie van neurale cellen elders schuiven. FuDaarnaast kunnen single-cell studies de ontbinding van nieuwe celtypes toestaan, die kunnen worden over het hoofd gezien door hun lage representatie onder de totale populatie 4 , 5 , 6 , 7 .

Een van de voordelen van single-cell transcriptomics is dat unieke markers of combinaties van markers die een bepaald cellulaire subtype definiëren, ontdekt kunnen worden. Deze kunnen dan gebruikt worden om genetische toegang te krijgen tot dat celtype voor verschillende manipulaties. Bijvoorbeeld, we gebruiken dit protocol om de celtype-specifieke genen van een subset van retinale ganglioncellen die de fotopigment melanopsin uitdrukken, te karakteriseren. Het gebruik van een fluorescerende marker in melanopsine-expressie-retinale ganglioncellen maakt het mogelijk om deze cellen te bestuderen, aangezien ze samen worden geclusterd door hun expressie van een bekend gen. Interessant genoeg zijn er vijf bekende subtypen van deze cel popuLatie in het muisnetje 8 . Dus, om RNA van cellen van elk type te isoleren, hebben we gevestigde morfologische classificaties binnen het transgene model gebruikt om elk subtype voorafgaand aan celisolatie te identificeren. Deze techniek zorgt voor de karakterisering van cellen alsook voor hun isolatie rechtstreeks van het retina, zonder dat er een weefseldissociatie nodig is, wat een stressrespons binnen cellen kan veroorzaken en besmetting door afgescheiden dendrieten 9 .

In de afgelopen jaren is een groot aantal nieuwe technieken aan het licht gekomen, aangezien de RNA-Seq-methode verder ontwikkelt. Deze hulpmiddelen maken het mogelijk om een ​​maximale celverwerving te verkrijgen en een grotere kosten-efficiëntie, terwijl u de vraag 4 , 7 , 10 , 11 , 12 , 13 nadert. Echter, terwijlDeze technieken zijn uitstekende stepping stones, er zijn nog steeds een aantal hindernissen die dit protocol kan adresseren. Ten eerste isoleren veel van de huidige procedures cellen uit gedissocieerd weefsel en proberen om hoofdcomponentanalyse of hiërarchische clustering posthoc te gebruiken om de celclassificatie te bepalen. Vertrouwen op deze hulpmiddelen om subtypes te classificeren, kan geen betrouwbare resultaten opleveren en kan een dwingen om nieuwe manieren te vinden om deze gegevens te valideren voor de correlatie van een genetische marker naar een functioneel celtype. De vereiste voor dissociatie in andere protocollen kan soms weefselschade veroorzaken en kunnen neuronale processen scheiden, waardoor een mogelijk verlies van mRNA kan ontstaan. Bovendien kunnen in de gedissocieerde celpreparaten de stressresponsen beginnen de transcriptomen van deze cellen 14 te beïnvloeden. Dit protocol overwint deze uitdagingen door het functionele celtype voorafgaand aan isolatie te bepalen en het handhaaft het beterGezondheid van de cellen door het retinale weefsel intact te houden.

Een techniek werd in 2014 geïntroduceerd en bestond uit de in vivo analyse van het transcriptoom van levende cellen 15 . Hoewel deze techniek het onderzoek van het transcriptoom met minimale mechanische verstoring van het weefsel mogelijk maakt, ontbreekt het de mogelijkheid om specifieke celsoorten in het weefsel te classificeren alvorens hun transcriptomen te onderzoeken zonder gebruik te maken van een zeer specifieke reportermuis. Ons protocol heeft geen specifieke reporter nodig, omdat we celvulling en elektrofysiologie gebruiken om cellen te karakteriseren voor hun isolatie. Een andere beperking van dit vorige protocol is dat het een specifieke golflengte nodig heeft om het foto-activeerbare element op te wekken, terwijl ons protocol het mogelijk maakt om een ​​fluorescerende reporter en fluorescerende kleurstof te gebruiken die gemakkelijk verkrijgbaar zijn of per laboratorium afzonderlijk kunnen worden gekozen. Nog steeds hebben andere laboratoria getrouwd met de twee methoden van electrOphysiologie en transcriptomics voor de studie van cellulaire diversiteit. Het gebruik van patch-klemopnamen om de functie van een cel voorafgaand aan zijn isolatie te karakteriseren is uitgevoerd op gedissocieerde neuronen 16 en in sommige gevallen is het voorafgegaan door het gebruik van microarray analyse 17 voor deze studies. Dezelfde complicaties worden ondervonden door deze benaderingen, aangezien ze weefseldissociatie of het gebruik van microarray technologie nodig hebben, die afhankelijk is van de hybridisatie van monsters naar beschikbare probes. Een van de meest recente ontwikkelingen is de ontwikkeling van Patch-Seq, een techniek die het gebruik van patch-clamp-opnamen en RNA-Seq-technologie combineert om cellen van hele hersenschijfjes 18 te begrijpen. Hoewel deze techniek haar overeenkomsten heeft met het hier gepresenteerde protocol, is het opnieuw belangrijk om op te merken dat onze aanpak het in staat stelt om het weefsel intact te houden voor de gezondheid van de cellen. Hier presenteren wij een protocol voor de optimizatIon van deze alliantie, die hoge kwaliteit, single-cell bibliotheken voor het gebruik van RNA-Seq genereert om een ​​hoge leesdiepte en mapping dekking te verkrijgen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle procedures werden goedgekeurd door het Instituut voor Dierenzorg en -gebruik (IACUC) aan de noordwestelijke universiteit.

1. Bereiding van oplossingen voor elektrofysiologie (4 uur)

  1. Maak 0,1% DEPC-behandelde H20 door 1 ml diethylpyrocarbonaat (DEPC) toe te voegen aan 999 ml omgekeerde osmose-gezuiverde H20. Meng grondig en laat het mengsel gedurende 1 uur bij kamertemperatuur (RT) incuberen. Vervolgens geautoclaaf de DEPC-gemengde H20 gedurende 15 minuten op een vloeibare cyclus. Laat de DEPC-behandelde H 2 O afkoelen bij RT.
  2. Maak de extracellulaire oplossing door één fles Ames-medium en 1,9 g (23 mM) natriumbicarbonaat in 1 L H20 te mengen. Bubble de extracellulaire oplossing met
    95% O 2 /5% CO 2 en houd deze bij een pH van 7,3-7,4.
  3. Genereer de intracellulaire oplossing door 125 mM K-gluconaat, 2 mM MgCl2, 10 mM EGTA, 10 mM HEPES, en 0,1% DEPC-behandelde HBewaar het in 1 ml porties bij -20 ° C. Voeg aan het begin van elk experiment 10 μM fluorescerende tracer toe.
  4. Maak een enzymoplossing door 10.000 eenheden collagenase en 83 mg hyaluronidase toe te voegen aan 4,15 ml extracellulaire oplossing. De enzymoplossing moet worden opgeslagen in 50 μl aliquots bij -20 ° C.

2. Voorbereiding van retinale weefsel (2 uur)

OPMERKING: Alle procedures in dit gedeelte dienen onder dim rode verlichting te worden uitgevoerd

  1. Donkere aanpassingsdieren gedurende ten minste 1 uur voor dissectie. Voer alle procedures uit bij donkere rode verlichting.
  2. Euthanize de dieren door CO 2 versmetting en enucleate de eyeballs in een Petri schotel met eerder geoxydeerde extracellulaire oplossing.
  3. Poke de hoornvlies met een naald en snijd het weg door te snijden met oftalmische schaar aan de rand van de hoornvlies en sclera 19 .
  4. Verwijder de lens met behulp van# 5 tang. Zachtjes in de sclera maken met de tang en snijd de optische zenuw waar de retina en sclera elkaar ontmoeten. Maak de sclera nauwkeurig af van het netvlies.
  5. Verwijder de transparante glasplaat met behulp van # 5 tang; Eenmaal verwijderd, verschijnt de glasplaat als een gelatineuze stof die op de tang zit. Snijd de retina's in de helft (zodat er 4 stuks / dier zijn) en sla ze op in zuurstofoplosbare extracellulaire oplossing bij kamertemperatuur tot het gebruik.
  6. Als u klaar bent om het weefsel in de opnamekamer te monteren, plaats een retina om te incuberen in enzymoplossing verdund in 500 μL geoxydeerde extracellulaire oplossing. Incubeer in een petrischaal gedurende 2 minuten bij RT op een shaker.
    1. Was het stuk retina in een geoxydeerde extracellulaire oplossing en plaats het weefsel in een glazen bodem opname kamer; Gebruik een plastic transfer pipette met de tip afgesneden om ervoor te zorgen dat het netvlies kan worden overgedragen zonder schade aan het weefsel te veroorzaken.
  7. Gebruik voorCeps om het weefsel zorgvuldig af te vegen met de fotoreceptorlaag naar beneden gericht. Verwijder overtollige vloeistof met een pipet. Anker het weefsel met behulp van een platina ring met nylon mesh.
    OPMERKING: Deze methode kan ook gebruikt worden om het weefsel voor de isolatie van RNA uit gelabelde amacrine en bipolaire cellen te bereiden.
  8. Vul de kamer met geoxydeerde extracellulaire oplossing en zet deze op een microscoopstadium. Perfuse weefsel met geoxydeerde extracellulaire oplossing bij 2-4 ml / min.

3. Visualisatie en targeting van GFP + Retinale Ganglioncellen (10 min)

OPMERKING: Alle procedures in dit gedeelte dienen onder dim rode verlichting te worden uitgevoerd

  1. Voordat u begint, trek glasmikropipetten (OD: 1,2 mm, ID: 0,69 mm) voor elektrofysiologische opnamen met behulp van een micropipette-trekker. Gebruik het volgende protocol voor de elektroden (let op dat de parameters dienovereenkomstig moeten worden aangepast om de gewenste weerstand en de wil te bereikenVariëren over trekkers en met ander glas): Warmte: Ramp +10; Trek: 0; Vel: 23; Vertraging: 1; Druk: 500; Programma lus: 5 keer. Zorg ervoor dat de tips ~ 1 μm in diameter zijn, met weerstanden van 2-4 MΩ voor het richten van grote cellen en van 5-7 MΩ voor het richten op kleinere cellen.
  2. Let op de ganglion cel laag met behulp van infrarood differential interferentie contrast (IR-DIC) optiek ( figuur 1A ). Identificeer GFP + Retinale Ganglioncellen (RGC's) met behulp van epifluorescentie (~ 480 nm) ( Figuur 1B ).
  3. Zoek de pipet gevuld met intracellulaire oplossing in DIC. Breng een lichte positieve druk aan en stel geen spanningsverzettingen op de versterker.
  4. Druk de glazen micropipette tegen een GFP + cel en gebruik negatieve druk om een ​​GΩ-afdichting tussen de pipet en het celmembraan te vormen. Breng de testspanningskommando's aan ( bijv. 5 mV) om de afdichtingsweerstand te controleren. Na het vormen van een stabiele afdichting breekt u het membraan door korte pulsen van n toe te passenEgatieve druk om toegang tot de hele cel te verkrijgen.
  5. Wacht 1-2 minuten voor de dendrieten van de cel om met fluorescerende tracer te vullen.
    OPMERKING: De cel kan morfologisch getypt worden door de morfologie in epifluorescentie te onderzoeken ( Figuur 1C ). In het geval van melanopsine-expressie-RGC's, wordt dendritische stratificatie in de binnenste plexiforme laag zichtbaar gemaakt door de dendrieten die met fluorescerende sporen zijn gevuld onder epifluorescerende verlichting te onderzoeken en te bepalen of ze ver van de soma in de OFF sublinaire (M1 ipRGCs) stratificeren, vlakbij de ganglion Cellaag in de ON sublamina (M2 & M4 ipRGCs), of beide (M3 ipRGCs). Deze waarneming, gecombineerd met soma-grootte (M4's hebben duidelijk grote somen vergeleken met alle andere ipRGC subtypes), laten de identificatie van het celtype 20 , 21 , 22 toe . Zo maakt deze techniek mogelijk voor het identificeren van celtype in vitro voorafgaand aan RNA isoning. Deze methode kan worden aangepast voor andere identificatieprotocollen van de celtype die dendritische morfologie of cellulaire fysiologie omvatten.

4. Cellisolatie (2 min)

  1. Voordat u begint, zet u de tabletop microcentrifuge op 2.000 x g. Bereid een monsteruitstootapparaat aan door een slang te verbinden (OD: 3/32 in, ID: 1/32 in) met een 1 cc spuit.
  2. Plaats 0,2 ml PCR-buizen die 10 μl lysisbuffer en 1% P-mercaptoethanol op ijs bevatten. Bereid een 1 cc spuit met DEPC-behandelde H 2 O op om de pipetpunten te spoelen. Bereid een container droogijs op om de lysisbuffer na het verzamelen van monsters te bevriezen.
  3. Zet de cytoplasmatische inhoud van de celpipet voorzichtig uit door negatieve druk toe te passen met behulp van een 10 ml spuit; Alle cytoplasmatische inhoud, inclusief organellen, moet zo mogelijk worden geëxtraheerd.
    1. Monitor de extractie in DIC door het afbeelden van de cellichaam afnemend. Na extractie De cytoplasmatische inhoud, lig de pipet voorzichtig uit het weefsel en verwijder het pipet snel uit de oplossing.
  4. Verwijder de pipet snel van de hoofdstadiumhouder en spoedig de pipetpunt met de DEPC-behandelde H 2 O spoelen met een 1 ml spuit. Sluit de pipet aan op een 1 ml spuit via een strakke buis om het monster te laten verdwijnen.
  5. Verwijder de cellen onmiddellijk in 10 μl lysisbuffer 1 die 1% P-mercaptoethanol bevat in 0,2 ml PCR-buizen.
    OPMERKING: Het volledige aspiraat met de cellen moet voorzichtig worden verdreven, zodat bellen niet worden geïntroduceerd.
    1. Centrifugeer de buis kort in een minuscentrifuge van een tafelblad bij 2.000 xg gedurende 10 s. Blokvries de monsters onmiddellijk gedurende 5 minuten op droogijs. Na het bevriezen, houd ze maximaal twee weken bij -80 ° C voor de beste resultaten; De monsters kunnen langer duren, maar het wordt aanbevolen om zo snel mogelijk te verwerken.
E "> 5. RNA-zuivering (30 min)

  1. Voordat u begint, installeer een magnetisch scheidingsapparaat door het bovenste gedeelte van een omgekeerde P20 of P200 tiphouder vast te zetten op de 96-brons magnetische stand 23 .
  2. Bereid vers 70% ethanol (EtOH) - ongeveer 1 ml per monster volstaat. Verwijder de magnetische kralen van RNA vanaf 4 ° C opslag en doe deze gedurende minstens 30 minuten bij RT.
    OPMERKING: Er mogen maximaal 8 monsters tegelijk worden verwerkt, omdat veel stappen in dit protocol afhankelijk zijn van efficiëntie en snelle verwerking.
  3. Zodra de magnetische kralen bij RT zijn, draait de vortex gedurende 30 s om ervoor te zorgen dat de oplossing goed gemengd is.
    OPMERKING: De kralen gebruiken een RNA-specifieke buffer om RNA selectief te binden en ze laten toe op het verwijderen van ander cellulair afval wanneer ze worden gebruikt bij een magnetische plaatstandaard.
  4. Dooi cellen bij RT gedurende 1 minuut en voeg vervolgens 5 μL RNase-vrije H20 toe aan elk monster; Pipet omhoog en omlaag. Voeg 22 μL RNA-kralen aan elke buis en pipet toeE grondig te mengen. Incubeer de monsters bij RT gedurende 5 minuten om het RNA in staat te stellen om te interageren en te binden met de magnetische kralen.
  5. Plaats de buizen op een magnetisch scheidingsapparaat en laat het 8 minuten zitten; Zorg ervoor dat de supernatant duidelijk is voordat u verder gaat. Let op de kralen van een pellet en let erop dat u het niet loslaat tijdens het pipetteren.
  6. Verwijder de supernatant uit de monsters en voeg 150 μl 70% EtOH toe. Verwijder de EtOH en herhaal de was twee keer meer.
  7. Laat de monsters gedurende 6 minuten drogen. Controleer af en toe of er meer EtOH in de bodem van de buis heeft verzameld. Verwijder het dienovereenkomstig.
  8. Terwijl de monsters drogen, bereid 10X reactiebuffer door 19 μL lysisbuffer 2 en 1 μL RNase-inhibitor (40 U / μl) te combineren. Snijd het kort en houd het op ijs.
  9. Zodra de monsters droog zijn en de kralenpellets niet meer glanzend zijn, verwijder de buizen uit de magnetische scheider en voeg 9,5 μL RNase-vrije H20De monsters rehydreren. Plaats de monsters op ijs en voeg 1 μL van 10x reactiebuffer toe aan elk monster.

6. Reverse transcriptie (10 min)

OPMERKING: Doe de benodigde reagentia voor omgekeerde transcriptie (RT, behalve het enzym) op ijs voor het begin. Deze omvatten: primer II, buffer 1, oligonucleotide en RNase inhibitor.

  1. Voeg bij elke buis 2 μL primer II (AAGCAGTGGTATCAACGCAGAGTACT (30) N -1N toe, waarvoor N -1 A, C of G en N kan zijn A, C, G of T; 12 μM). Plaats de buizen in een thermocycler die voor 3 minuten bij 72 ° C voorverwarmd is.
  2. Bereid tijdens de incubatie de RT master mix op. Voor elke reactie voeg 4 μl buffer 1 (250 mM Tris-HCl, pH 8,3, 375 mM KCl en 30 mM MgCl2), 1 μl oligonucleotide (48 μM) en 0,5 μl RNase-inhibitor (40 U / pi).
  3. Plaats de buizen onmiddellijk na de incubatieIjs voor 2 minuten.
  4. Voeg 2 μL per reactie van het omgekeerde transcriptase (100 U / μl) grondig aan de master mix en pipette toe. Voeg 7,5 μL master mix toe aan elke buis en meng door zacht pipettering. Draai de buizen kort om de inhoud aan de onderkant te verzamelen en plaats ze in een voorverwarmde thermocycler met het volgende programma: 42 ° C gedurende 90 minuten, 70 ° C gedurende 10 minuten en een greep bij 4 ° C.
  5. Bewaar de buizen bij -20 ° C / N voordat u verder gaat. Het wordt aanbevolen om de monsters door de versterkingstap te dragen voordat u langere tijd opslaat; Andere bronnen suggereren O / N-opslag bij 4 ° C zou ook in deze stap 24 aanvaardbaar zijn.

7. cDNA amplificatie (2,5 uur)

OPMERKING: Voordat u begint, ontdooit PCR-buffer en PCR-primer op ijs en draai de buizen naar beneden in een mini-centrifugetafel voor de PCR-mastermix.

  1. Voor elke reactie, pRepareer een PCR-mastermix die 25 μl PCR-buffer bevat, 1 μl PCR-primer (12 μM), 1 μL DNA-polymerase en 3 μL nuclease-vrij H 2 O. Voeg de DNA-polymerase laatste toe, net voor de toevoeging Van de master mix naar de monsters.
  2. Voeg 30 μL mastermix aan elke buis toe en spin bij 2.000 xg gedurende 10 s om de inhoud op de bodem van de buizen te verzamelen.
  3. Plaats de buizen in een voorverwarmde thermocycler met het volgende programma: 95 ° C gedurende 1 minuut; 34 cycli van 98 ° C gedurende 10 s, 65 ° C gedurende 30 s en 68 ° C gedurende 3 minuten; 72 ° C gedurende 10 minuten; En een greep bij 4 ° C.
    OPMERKING: Het aantal cycli voor deze PCR is verhoogd naar 34, afwijken van de instructies van de voorgestelde fabrikant. Na het herhalen van testen bleek dit cyclusnummer consistente betrouwbare resultaten te produceren.
  4. Bewaar de buizen bij -20 ° C gedurende maximaal één jaar voordat u verder gaat.

8. Zuivering van versterkte cDNA (30 min)

  1. Voordat u de zuivering begint, breng de DNA-kralen en elueringsbuffer gedurende tenminste 30 minuten aan RT. Bereid vers 80% EtOH; 1 ml per monster moet volstaan. Voeg 1 μL 10X lysisbuffer toe aan elk monster.
  2. Vortex de DNA kralen gedurende 30 s en voeg 50 μL DNA kralen aan elk monster toe. Meng grondig door pipettering en draai ze kortom bij 2.000 xg gedurende 10 s. Incubeer de buizen bij RT gedurende 8 minuten.
  3. Plaats de buizen op het magnetische scheidingsapparaat gedurende 5 minuten. Pipet de supernatant voorzichtig om en omlaag twee keer en laat de monsters 2 minuten zitten. Terwijl de monsters op het magnetische apparaat zijn, verwijder de supernatant en weggooi.
  4. Voeg 150 μL vers gemaakte 80% EtOH toe aan elk monster en laat ze 30 minuten bij kamertemperatuur zitten. Verwijder de EtOH en herhaal de EtOH-wassen een keer.
  5. Draai de monsters kort en plaats deze gedurende 1 minuut op de magnetische scheider. Verwijder eventuele resterende EtOH en laat de monsters gedurende 5 minuten drogen.
  6. Zodra de kraalpelletje niet langer glanzend lijkt, maar voordat de scheuren beginnen te verschijnen, verwijder de buis uit de magnetische scheider en voeg 17 μL elueringsbuffer toe. Pipet omhoog en omlaag om de kralen volledig te resuspenderen.
  7. Incubeer de geresuspendeerde monsters bij RT gedurende 2 minuten.
  8. Draai de monsters kort om alle vloeistof op de bodem te verzamelen en plaats ze op de magnetische scheider gedurende 2 minuten. Breng 15 μL helder supernatant over op een 1,5 ml RNase-vrije buis en hou deze op bij -20 ° C.
  9. Onderzoek de kwaliteit en grootte van de cDNA-bibliotheek met een hoge gevoeligheid bioanalysatorchip met gebruik van 1 μL cDNA. De ideale grootte van een cDNA-bibliotheek is 0,3-2 Kb, met een concentratie van ten minste 10 ng / μl ( Figuur 2 ).
    OPMERKING: U kunt ervoor kiezen om PCR te gebruiken als een manier om monsters te screenen om de expressie van bekende markers te waarborgen alvorens met monster preparation.

9. Bepaal concentraties en tagment cDNA (20 min)

  1. Voordat u begint, breng het assay-reagens, verdunningsbuffer en -standen gedurende 30 minuten aan RT. Bereid een mastermix met 1 μl assay reagens en 199 μl verdunningsbuffer per reactie op. Aliquot 199 μL van dit mengsel in 500 μl assaybuizen. Voeg 1 μL monster toe en meng het grondig.
  2. Aliquot 190 μL master mix op buis 1 & 2. Voeg 10 μL standaard 1 toe aan buis 1 en 10 μL standaard 2 tot buis 2. Vortex alle monsterbuizen en standaardbuizen gedurende 5 s; Incuberen bij kamertemperatuur gedurende 3 minuten.
  3. Bepaal de concentratie van monsters met een hooggevoelige fluorometer. Zorg ervoor dat de juiste steekproef is ingevoerd door de optie "Bereken voorraadoplossing" te selecteren en "1 μL" te markeren. Verdun elk monster in een aparte 1,5 ml buis tot een uiteindelijke concentratie van 0,2 ng / μl in RNase-vrije H20.
    NOTITIE:Overwegende dat de instructies van de fabrikant suggereren dat men met 1 ng / μL totaal DNA moet beginnen, we een kleiner uitgangspunt hebben gebruikt en ook het protocol heeft aangepast om rekening te houden met dit amendement.
  4. In nieuwe 0,2 ml PCR buizen, pipet 2,5 μL buffer 2. Voeg 1,25 μL cDNA toe aan de juiste buis voor een totaal van 250 pg. Voeg ten slotte 1,25 μL tagmentatiemengsel aan elke tube en pipet grondig toe om te mengen; De transposase binnen de tagmentatiemix zal het DNA in korte strengen fragmenteren en de adapters aan elk uiteinde van elke streng annealiseren, voor later gebruik door het sequentieringsinstrument.
    OPMERKING: De volumes die gebruikt worden voor de tagering en indexkoppeling zijn een fractie van de hoeveelheid die door de instructies van de fabrikant wordt voorgesteld. Dit zorgt niet alleen voor het behoud van reagentia, maar heeft ook in onze ervaring consequent geproduceerde monsters geproduceerd.
  5. Centrifugeer de buizen op een micro-centrifuge gedurende 1 minuut.
  6. Plaats de buizenIn een voorverwarmde thermocycler met het volgende programma: 55 ° C gedurende 10 minuten en een houder bij 10 ° C.
    OPMERKING: De lengte van deze incubatie is 10 minuten, in tegenstelling tot de voorgestelde 5 minuten van de instructies van de fabrikant.
  7. Onmiddellijk nadat dit programma is voltooid, verwijder de buizen en voeg 1,25 μL tagmentatie neutraliserende buffer toe aan elk. Pipet goed om gedurende 5 minuten bij RT te mengen en te incuberen. Voltooi deze stap snel, aangezien de transposase actief blijft totdat de buffer het enzym neutraliseert en de reactie stopt.

10. Koppeling en zuivering van de index (1 uur)

OPMERKING: Voordat u begint, breng de DNA kralen en resuspensiebuffer bij kamertemperatuur gedurende tenminste 30 minuten. Besluit welke indexen voor elk van de monsters moeten worden gebruikt.

OPMERKING: Deze indexen worden gehecht aan de respectievelijke 5'- en 3'-uiteinden van het gefragmenteerde DNA voor de identificatie van monsters die volgend op sequentiebepaling volgen. Zorg ervoor dat er geen twee zijnPairings zijn hetzelfde voor monsters die samen kunnen worden gesorteerd. Als voorbeeld 1 bijvoorbeeld index 1 en oranje 1 gebruikt, moet monster 2 witte 1 en oranje 2 of wit 2 en oranje 2 gebruiken, maar nooit dezelfde combinatie van indices. Deze kit bevat 4 verschillende witte en 6 verschillende oranje indices. Met alle verschillende mogelijke combinaties kunnen maximaal 24 monsters worden gecombineerd in één sequencerbaan. Hoewel we meestal alleen 10 monsters in een baan samenvoegen, zou men ook de kit kunnen gebruiken die 24 indexen bevat, waardoor het mogelijk zou zijn 96 monsters in een enkele rijbaan te coderen, indien gewenst.

  1. Voeg bij elke buis 1,25 μL van de linker index en 1,25 μL van de juiste index voor dat specifieke monster toe. Voeg 3,75 μL PCR master mix en pipet goed toe om te mengen.
  2. Centrifuge gedurende 1 minuut in een micro-centrifuge van de countertop.
  3. Plaats de buizen in een voorverwarmde thermocycler met het volgende programma: 72 ° C gedurende 3 minuten; 95 ° C gedurende 30 s; 12 cycli van 9576 ° C gedurende 10 s, 50 ° C gedurende 30 s en 72 ° C gedurende 1 minuut; 72 ° C gedurende 5 minuten; En een greep bij 4 ° C.
    OPMERKING: De eerste 95 ° C stap is gewijzigd van 98 ° C, die door de fabrikant's instructies werd voorgesteld. Ook werden de fietsdetails aangepast, zodat de temperaturen en tijdslengtes voor de optimale tagering van onze monsters toonden. De laatste 72 ° C incubatie werd ook toegevoegd aan ons protocol en werd niet opgenomen in de instructies van de fabrikant.
  4. Draai de buizen kort om de inhoud aan de onderkant te verzamelen. Vortex de DNA kralen gedurende 30 s, en voeg vervolgens 30 μL aan elke buis toe en meng grondig door pipettering.
  5. Incubeer de monsters bij RT gedurende 5 minuten.
  6. Plaats de monsters op een magnetische afscheider gedurende 2 minuten. Pipetteer de supernatant twee keer om en omlaag en incubeer de monsters gedurende 1 minuut.
  7. Verwijder en verwijder de heldere supernatant. Voeg 150 μl 80% EtOH aan elk monster toe en verwijder. Herhaal de EtOH eenmaal.
  8. Sta toeE monsters om 10 minuten te drogen. Controleer af en toe of er een EtOH op de bodem van de buizen is verzameld en verwijder indien nodig.
  9. Zodra er een kraak in de DNA-korrelpelletje verschijnt, verwijder het monster uit de magnetische scheider en voeg 27,5 μL resuspensiebuffer toe om de pellet te hydrateren. Zorg ervoor dat de pellet volledig geresuspendeerd is en daarna 2 minuten bij kamertemperatuur inkuberen.
    OPMERKING: Het volume dat wordt gebruikt voor de resuspensiebuffer is aangepast om rekening te houden met de kleinere hoeveelheid uitgangsmateriaal in ons protocol en verschilt van het voorgestelde volume in de instructies van de fabrikant.
  10. Plaats de buizen op de magnetische scheider gedurende 2 minuten. Breng 25 μl helder supernatant over in een RNase-vrije buis en houd bij -20 ° C op.
    OPMERKING: Ga niet verder met de instructies van de fabrikant om de normalisatie van de bibliotheek te voltooien. De monsters worden succesvol opgesteld na deze stap en zijn bereid voor sequencing zoals dat is.
  11. Analyseer de tAgmentatie van de monsters met behulp van een bioanalysatorchip en 1 μl van elk monster.
    OPMERKING: De analyse van smeren zal eerder worden uitgevoerd; CDNA moet nu gedetecteerd worden bij een groottebereik van 0,2-1 Kb ( figuur 3 ). Smeren onder dit punt vertegenwoordigen waarschijnlijk de afbraak van monsters, terwijl grotere smeren suggereert dat de tekening onvolledig is.

11. Pooling van monsters (10 min)

  1. Verkrijg concentraties van tagmentatiemonsters met de hoge gevoeligheidsfluorometer van eerder en bepaal de concentratie in nM.
    OPMERKING: Deze berekening kan worden berekend met behulp van een internet conversie tool en vertrouwt op de gemiddelde fragmentlengte van het bioanalyzer trace. Om de gemiddelde fragmentlengte te bepalen, observeer het trace voor elk monster afzonderlijk en bepaal de grootte van het gemiddelde DNA-fragment. Dit kan ook worden berekend bij het onderzoeken van het bioanalyzer trace door het bereik van de smeer te markeren en te onderzoekenE molariteit berekend door het programma.
  2. Combineer monsters zodanig dat het zwembad dezelfde concentratie van elk monster bevat. Verdun geen monsters; Het zwembad moet zo verdund zijn als het laagste geconcentreerde monster en zou ideaal een totale concentratie van tenminste 15 nM hebben.
  3. Bewaar de samengevoegde monsters bij -20 ° C voorafgaand aan sequencing; Het wordt aangetoond dat monsters binnen 1 week na pooling sequencing ondergaan. Voltooid, 100 bp sequencing uitvoeren met een HiSeq platform.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Celtypes worden gemakkelijk ingedeeld na de kleurstofinjectie

Figuur 1 toont een voorbeeld van een GFP + RGC voor en na fluorescerende tracer vulling. Deze cel werd geïdentificeerd op basis van zijn expressie van GFP in de transgene lijn ( Figuur 1A ). Een strakke afdichting werd gevormd met een fijne, getrokken glaselektrode op de som van deze cel. Om het subtype te karakteriseren, werd de fluorescerende kleurstof in de soma geïnjecteerd en werd alle bijbehorende processen gevuld ( Figuur 1B ). De classificatie als een M4 ipRGC werd geactiveerd door de waarneming dat deze cel een zeer grote soma heeft en dat zijn processen eindigen in de ON sublamina van de innerlijke plexiforme laag ( Figuur 1C ). Als illustratie van verschillen in stratificatie die kunnen worden onderscheiden in een geïsoleerde retinaire voorbereiding, hebben we M1 (OFF-stratifyinG), M3 (geadministratieerd) en M4 (ON-stratificatie) ipRGC's met een fluorescerende tracer, bevestigen ze en verrichten confocal beeldvorming van de ON en OFF sublijnaan ( Figuur 1D ). Deze visualisatie van de dendrieten via confocale beeldvorming lijkt zeer op hoe de dendrieten in onbeschouwd in vitro weefsel kijken wanneer cellen gevuld zijn met een fluorescerende tracer (Schmidt en Kofuji 2009, 2010 en 2011).

CDNA bibliotheken uit enkele cellen

Het gebruik van een Oligo d (T) primer zorgt voor de selectieve reverse transcriptie en amplificatie van mRNA. Na het genereren en amplificeren van de cDNA-bibliotheken uit elke cel werden bioanalysatorchips gebruikt om de kwaliteit en grootte van de bibliotheken te beoordelen. De resultaten van deze analyse tonen aan dat de ideale cDNA-uitstrijkjes 0,5-2 Kb in een goed monster zijn ( Figuur 2A ). Sommige monsters tonen een paar bands of smears onder het 300 bp punt, sugDat deze bibliotheken van slechte kwaliteit zijn (zie tabel 1 voor het oplossen van problemen). Een voorbeeld van een goede kwaliteit bioanalyzer trace toont weinig of geen DNA-banden onder 300bp en een robuuste uitstraling tussen 500bp en 2Kb (Figuur 2B). Lege controlebanen dienen respectievelijk onderste en bovenste markers op respectievelijk 35 en 10380 bp te tonen, evenals een stabiele basislijn die niet fluktueert. Verschillende bibliotheken kunnen kwaliteitsdata produceren, zoals blijkt uit zowel figuur 2B als 2C , die uitstekende leesdieptes en hoge mappingskoersen veroorzaakt. Alleen die monsters met sterke cDNA-bibliotheken van de verwachte grootte zouden doorgaan naar tagmentation (zie tabel 1 voor het oplossen van problemen).

Low-input tagmentation bereidt hoogwaardige monsters voor sequencing

Dit protocol is geoptimaliseerd voor tagmentatie met een kleine hoeveelheid startmateriaal l. Slechts 250 pg werkt het best voor een succesvolle tagmentatie, aangezien de lagere hoeveelheden niet goed worden versterkt en hogere hoeveelheden niet volledig zullen fragmenteren. Na het voltooien van de tagmentatie en PCR amplificatie / monster opruiming werden de monsters opnieuw geanalyseerd op een bioanalysatorchip. De ideale cDNA-uitstrijkjes op dit punt zouden 0,2-1 Kb moeten zijn ( Figuur 3A ). Het spoor moet glad en gelijkmatig verdeeld zijn tussen die twee maten ( figuur 3B ); Dit spoor komt overeen met het monster in baan 1. Figuur 3C toont een onvolledige tagmentatie, die makkelijk kan worden opgelost (zie tabel 1 voor probleemoplossing). We hebben data analyse op de monsters uitgevoerd en ontdekt dat dit protocol monsters heeft met uitstekende leesdieptes, die vaak overtreffen van 12 miljoen lezingen per monster; Gemiddelden van 69,1% mapping; En meer dan 5000 uitgedrukte genen.

/55229fig1.jpg "/>
Figuur 1: Identificatie van RGC-typen op basis van GFP-expressie bij melanopsine-expressie van ipRGC's en op morfologische eigenschappen. ( A ) De ganglion-cellaag van het netvlies, zichtbaar met behulp van IR-DIC in de full-mount retina voorbereiding. ( B ) Hetzelfde preparaat visualiseerde zich in epifluorescentie (~ 480 nm) om GFP-expressie-ganglioncellen te identificeren. ( C ) Een GFP-expressieve cel gericht op patch-clamp opname en gevuld met een fluorescerende tracer. De cel kan worden geïdentificeerd als een M4 ipRGC op basis van zijn zeer grote soma grootte en ON-stratificerende dendrieten 25 , 26 . ( D ) Confocal beeld van ipRGC dendriten die in de ON- en / of OFF-sublina van de IPL (M1) worden weergegeven, in de ON sublamina van de IPL (M4) en in zowel de ON en OFF sublijna van de IPL (M3). IR-DIC: infrarood differentiaal interferentie contrast..jove.com / files / ftp_upload / 55229 / 55229fig1large.jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2: Analyse van cDNA-bibliotheekkwaliteit met een Bioanalyzer Trace. ( A) Bioanalyzer uitvoervoorbeeld voor meerdere monsters die omgekeerd zijn getranscribeerd, versterkt en gezuiverd. Lanes 1-3 tonen de ideale DNA-smeren, met de meerderheid van DNA groter dan 300 bp. Bibliotheken met smeren in dit assortiment hebben consistente uitstekende sequentiegegevens gegeven, waarbij gemiddeld 5,683 genen per cel uitgedrukt worden. Laan 4 staat voor een monster die niet succesvol is verwerkt en produceerde dus geen cDNA. De succesvolle controle lane heeft een constante basislijn en twee schone pieken bij 35 en 10.380 bp. ( B ) Voorbeeld van een succesvol bioanalyzer trace met een hoge intensiteit cDNA rond 2 Kb. Dit s Meren komt overeen met het monster in baan 1. ( C ) Voorbeeld van een succesvol bioanalyzer trace met het cDNA gecentreerd rond 500 bp. Dit trace komt overeen met het monster in baan 3. Klik hier om een ​​grotere versie van deze figuur te zien.

Figuur 3
Figuur 3: Gemarkeerde monsters tonen robuuste smeren tussen 0,2 en 2 Kb. ( A ) Een representatief voorbeeld bioanalyzer output na tagmentatie, amplificatie, en PCR opruimen. ( B ) Trace van een succesvol getekmenteerd monster dat overeenkomt met baan 1 in (A). ( C ) Voorbeeld van het spoor voor een monster met onvolledige tagmentatie, duidelijk door de piekintensiteit rond 1 Kb."> Klik hier om een ​​grotere versie van deze figuur te zien.

2 "> Verdun monster tot concentratie van 0,4 ng / μl en herhaling tagmentatie
Probleem Mogelijke oorzaak Oplossing
Stap 3.3) Kan GΩ seal niet vormen Oppervlak van de cel is niet schoon genoeg Reinig verder met positieve druk
Stap 3.3) De cel lijkt te ontlopen / doodgaan Bereid een nieuwe pipet op en doe een nieuwe cel aan
Stap 3.4) Kan de terminale locatie van dendrieten niet bepalen Alexafluor heeft niet genoeg tijd gehad om door de cel te diffunderen of de concentratie van Alexafluor is niet hoog genoeg Controleer of de winst en de belichtingstijd op de camera hoog genoeg zijn. Wacht nog eens 5 minuten voor het visualiseren van dendrieten. Als dendrieten nog niet zichtbaar zijn, bereid de oplossing op met een hogere Alexafluorconcentratie.
Stap 4.1) Kan niet alle cytoplasma aspireren
Stap 5.5) Supernatant is na 8 minuten niet duidelijk Pepet de hele oplossing twee keer zachtjes, terwijl u nog steeds op magnetische scheider zit, en laat nog 5 minuten zitten
Stap 5.5) Pellet verspreidt tijdens pipettering De steekproef is te ver van de magneet Houd buizen op magnetisch scheidingsapparaat tijdens alle pipettering. Verwijder de oplossing en laat kralen 5 minuten opnieuw pillen
Stap 5.7) Na 5 minuten verschijnen de monsters nog steeds glanzend Maximum hoeveelheid EtOH is niet verwijderd Controleer monsters tijdens het drogen. Gebruik elke 2 minuten een P10 pipet en verwijder alle EtOH onderaan de buis
Stap 8.9) Pellet had scheuren voor rehydrering Laat het monster toewassenTarief voor in totaal 4 minuten, in plaats van 2 (stap 8.10)
Stap 8.11) Kleine hoeveelheid kraal werd opgegraven met supernatant Verwijder het gehele monster terug in de buis en plaats gedurende 1 min op magnetische scheider; Pipet omhoog en zorg ervoor dat pellet niet voorkomt
Stap 8.12) DNA-smeren zijn inconsistent en de fluorescentie schaal verandert voortdurend Te hoge DNA-concentratie voor een HS-chip Controleer de concentratie van het monster en verdun tussen 1 - 10 ng / μL. Rerun bioanalyzer
Stap 8.12) Lage molecuulgewicht smeer RNA-afbraak Zorg ervoor dat de cel onmiddellijk na de inzameling wordt gevriesd. Verwijder deze cDNA-bibliotheek
Stap 8.12) Fluctuerende markering basislijn in controle lane Verontreiniging of oud reagens Discard DNA-merker en gebruik nieuwe buis voor Bioanalyzer run
Stap 8.12) Geen DNA smeer Niet-uitzetting van de cel Trek nieuwe naalden met een iets grotere punt
RNA Bead Failure Zorg ervoor dat kralen volledig zijn gesuspendeerd voor gebruik en laat monsters incuberen voordat ze op een magnetische scheider worden geplaatst
Stap 8.12) Zwakke DNA-smeer Niet genoeg versterking Gebruik meer PCR cycli
Stap 8.12) DNA uitstralen buiten het bereik van 500bp-2Kb DNA-smeden onder 0,5 en hoger dan 2 Kb zijn waarschijnlijk besmetting. Verwijder het monster
Stap 8.12) Spikes op regelmatige afstand op DNA-spoor Verontreiniging van het monster Draag altijd verse handschoenen en maak nieuwe ethanol voor spoelwater; Filtertips dienen te allen tijde te worden gebruikt
Stap 9.3) Kan concentratie van monster op fluorometer niet detecteren Monsters onder detectieniveau hebben te weinig DNA voor tagmentatie en kunnen niet worden gebruikt
Stap 10.10) De monsters zijn na 10 minuten niet droog Ga verder met overtollig EtOH Laat de monsters langer duren, controleer ze elke minuut
Stap 10.13) Smeer schuin naar 2Kb Onvolledige fragmentatie Re-verdund monster naar een concentratie van 0,15 ng / μL, in plaats van 0,2 ng / μL; Herhaling tagmentation
Stap 10.13) Smeer schuin naar 200bp Te weinig DNA-invoer Verdun monster minder, probeer een concentratie van 0,4 ng / μL; Herhaling tagmentation
Tagmentatie reactie te lang Verminder de reactietijd van de tagmentatie tot 8 minuten
Stap 10.13) Zwakke uitstrijkjes Onjuiste versterking van DNA
Stap 11.2) De maximale verkrijgbare poolconcentratie ligt onder 5 nM Identificeer welke sample (s) aanzienlijk lage concentraties en herhalingstaken hebben met nieuwe verdunning

Tabel 1: Oplossingen en suggesties voor potentiële hindernissen in het protocol. Deze tabel bevat mogelijke problemen die zich voordoen tijdens dit protocol en de stappen waarop men hen kan ontmoeten. Deze tabel bevat mogelijke oorzaken voor veel van deze problemen, evenals oplossingen die kunnen helpen bij het oplossen van problemen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ons protocol toont door middel van een snelle en makkelijk te gebruiken gids een methode om enkele cellen van geïdentificeerde morfologische klassen voor hoogwaardige sequencing op te stellen, met weinig letsel aan het monster. In het huidige manuscript worden intrinsiek lichtgevoelige retinale ganglioncellen morfologisch gekenmerkt, geïsoleerd en bereid voor RNA-Seq. Cellulaire spanning kan optreden tijdens retinale behandeling; Om deze reden vervangen we elk stuk weefsel na maximaal 4 uur gebruik. We kunnen de toestand van de cellen beoordelen door gebruik te maken van de elektrofysiologische rig om van deze cellen te registreren en hun reacties te monitoren, waardoor we ervoor zorgen dat de cellen van goede gezondheid zijn. Ons protocol is toegestaan ​​voor de opwekking van succesvolle cDNA-bibliotheken uit 15 van de 23 geteste proeven, waardoor een succesfrequentie van 65% is verkregen. Bovendien was de kwaliteit van onze sequencing data uitstekend, omdat het gemiddelde aantal genen uitgedrukt door onze cellen varieerde van 2.316-10.353, met een gemiddelde van 5.683Genen die registreren met een niet-nul FPKM waarde. Deze cijfers zijn vergelijkbaar met uitgedrukte gencijfers die gevonden worden door andere studies van neuronen 5 , waaruit blijkt dat onze gegevens ook van goede kwaliteit zijn.

Hoewel we succes hebben gehad met dit protocol voor deze specifieke neuronen, moet opgemerkt worden dat kleine wijzigingen van deze techniek kunnen worden toegepast voor een aantal verschillende toepassingen. Met behulp van Fluorescentie-geactiveerde Cell Sorter (FACS) in een afzonderlijk muismodel hebben we geïsoleerde kleine populaties cellen (1.000 -25.000) gemarkeerd met een GFP marker uit het centrale zenuwstelsel. Het RNA uit deze populaties werd geïsoleerd en 1 μL (bij of iets minder dan 12 ng / μl) van dit RNA werd gebruikt om de omgekeerde transcriptie in stap 6.1 te beginnen. De enige aanpassing die na deze stap aan het protocol moet worden aangebracht, vindt plaats in stap 7.4, op welk moment kan men kiezen voor minder PCR cycli. We hebben 19 cycli gebruikt in gevallen waarin de eerste steekproef g bevatReater dan 10.000 cellen en hebben vastgesteld dat dit cDNA-bibliotheken van goede kwaliteit produceert. Bijvoorbeeld werden celmonsters bereid uit een FACSorted populatie en het aantal genen dat uitgedrukt was varieerde van 12.340-14.052, met een gemiddelde van 13.265 genen met een niet-nul FPKM waarde. Deze techniek kan worden toegepast op diverse muismodellen waarvoor een fluorescerende reporter aanwezig is. Door dit amendement kunnen onderzoekers eventueel een celpopulatie bestuderen waarvoor een fluorescerende reportermuis beschikbaar is, die studies verleggen langs het gebied van neuronale diversiteit.

Een tweede aanpassing kan worden gemaakt aan profielcellen op basis van functionaliteit in plaats van alleen morfologie. Dit project is gebaseerd op een transgene model, maar deze techniek kan worden toegepast op neuronen zonder bekende moleculaire identifiers. Bijvoorbeeld, er zijn meer dan 30 functionele subtypen van retinale ganglioncellen die momenteel zijn geïdentificeerd 27 , waarvan zeer weinig unieke markers hebben. Zoals deze techniekVertrouwt al op een elektrofysiologie-rig voor de celvulling, men kan patchclamping gebruiken om het functionele responsprofiel van elke cel te identificeren op basis van het spikpatroon. Met behulp van lichtopgenomen spike opnames kan de classificatie van retinale neuronen worden bepaald voorafgaand aan celisolatie. Deze techniek werkt op retinale ganglioncellen, maar het kan uitgebreid worden om andere retinale neuronen te onderzoeken. Er dient echter op te worden gewezen dat als dit protocol gebruikt wordt om retinale bipolaire of amacriene cellen in de binnenste nucleaire laag te typen, moet men voorzichtig zijn om constante positieve druk op de punt van de elektrode te verschaffen om te voorkomen dat cellen contacteren als de Elektrode passeert door de ganglion cel laag en innerlijke plexiforme laag. Voor retinale neuronen binnen de binnenste nucleaire laag zou het voorbereiden van retinale secties voorafgaand aan cellulaire opnamen waarschijnlijk het beste werken om de vervuiling consequent te voorkomen. Elke cel zou worden geïsoleerd en bereid zoals hierna beschreven volgens de claSsification step. Verder stellen we het gebruik van dit protocol voor de studie van neuronen voor, maar deze techniek kan toegepast worden op elk celtype dat morfologisch kan worden gekenmerkt of geïsoleerd door middel van een transgenisch model.

Deze techniek kan ook worden aangepast om te werken met eerder bereide cDNA bibliotheken, zoals we in het verleden hebben gegenereerd voor microarray hybridisatie 28 . Met een apart voorbereide bibliotheek begint men met cDNA-hoeveelheden in het bereik van 50-150 ng en start het protocol in stap 8.4; Hogere en lagere concentraties zijn niet geprobeerd, hoewel ze ook kunnen werken. Zuivering van het cDNA met DNA-kralen zou eerst plaatsvinden, gevolgd door tagmentatie en PCR-amplificatie. We hebben deze aanpassing getest met cDNA uit bibliotheekpreparaten, zoals die voor microarray hybridisatie 29 , en hebben succesvol geproduceerde bibliotheken voor RNA-Seq geproduceerd.

VinBondgenoot, dit protocol kan gebruikt worden bij het beoordelen van het succes van een bepaalde inductie van celpopulaties van geïnduceerde Pluripotent Stamcellen (iPSCs). De drijvende kracht achter de differentiatie van deze herprogrammeerde pluripotentcellen is gebaseerd op een begrip van de transcriptiefactoren die leiden tot het ontwikkelen van celtypen van elkaar. Het rijden van iPSC's naar specifieke cellusten is een nieuwe methode voor het bestuderen van neuronale diversiteit, omdat het kan worden gebruikt om selectieve cellen te genereren. Dit protocol kan worden aangepast om de kwaliteit van de diversiteit tussen gedifferentieerde cellen uit dit model te beoordelen. Zoals eerder vermeld, zijn er meer dan 30 functionele subtypen van retinale ganglioncellen, en veel inspanningen zijn gedaan om functionele RGC's van iPSCs te genereren. De identificatie van markers voor subtypen van RGC's - in ons geval, ipRGCs - laat de onderzoeker toe om het succes van hun protocol te evalueren bij het produceren van verschillende subtypes van RGC's. De evaluatie van celtypesOnder deze neuronen zou baat hebben bij dit protocol en kan ook dienen als hulpmiddel voor het vervolgonderzoek van subtypespecifieke markers, aangezien dit model systeem gemakkelijk beschikbaar is.

In het huidige manuscript beschrijven we een eenvoudige techniek voor de isolatie en bereiding van enkele cellen voor transcriptomische analyse. Bovendien wijzen we op manieren om het protocol te bewerken, zodat deze techniek kan worden gebruikt voor een groot aantal experimenten met een scala aan doelen in het achterhoofd. Het hier beschreven protocol werd aangepast uit een protocol beschreven door Trombetta et al. 24 als een aanpassing van de aanbevolen kit instructies voor low-input RNA-Seq. De belangrijkste verschillen liggen in celisolatie en verschillende volumetrische veranderingen die we hebben gekozen om het beste bij de behoeften van dit project te kunnen passen. Het is belangrijk om te benadrukken dat de belangrijkste stap in dit protocol de isolatie van cellen uit het netvliesweefsel is. Dit is het punt in het protocol durinG welke de meeste fouten kunnen optreden, en het moet met de meest voorzichtige aandacht worden uitgevoerd. Elke hoeveelheid verontreiniging kan resulteren in onbruikbare monsters, terwijl het verlies van cytoplasma een ernstige uitputting van mRNA moleculen kan veroorzaken. Deze stap moet met zorg en door hetzelfde individu van experiment uitgevoerd worden om te experimenteren om ervoor te zorgen dat de monsters precies zijn behandeld.

Samengevat beschrijft dit protocol een techniek voor de classificatie, isolatie en bereiding van cellen voor hoogwaardige RNA-Seq. Dit is een efficiënte, relatief goedkope manier om de kwaliteit van de gegevens van eencellen te optimaliseren. Deze techniek is veelzijdig en kan minimaal gewijzigd worden voor toepassing op diverse studies.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

We willen graag Jennifer Bair en Einat Snir, evenals de Universiteit van Iowa Institute for Human Genetics, erkennen voor hun hulp bij het voorbereiden en verwerken van monsters.

Materials

Name Company Catalog Number Comments
Ames' Medium Sigma Aldrich A1420-10X1L
Sodium Bicarbonate Sigma Aldrich S8875
K-gluconate Spectrum Chemical PO178
EGTA Sigma Aldrich E4378
HEPES Sigma Aldrich H3375
Diethyl pyrocarbonate (DEPC) Sigma Aldrich D5758
Alexa Fluor 594 Hydrazide Invitrogen A10442
Collagenase Worthington Biochemical  LS005273
Hyaluronidase Worthington Biochemical  LS002592
Petri dish (35 mm diameter) Thermo Fisher Scientific 153066
Ophthalmologic scissors Fine Science Tools 15000-00
#5 Forceps Fine Science Tools 11252-30
Microplate Shaker Fisher Scientific 13-687-708
Glass Micropipette Sutter BF120-69-10
Micropipette Puller Sutter P-1000 horizontal pipette puller
1 mL syringe Fisher Scientific 14-823-2F
Flexible tubing Fisher Scientific 14-171
TCL lysis buffer Qiagen 1031576 Lysis Buffer 1
β-mercaptoethanol Sigma Aldrich M3148
RNase-free Water Qiagen 129112
0.2 mL PCR tubes Eppendorf 30124359
Ethyl Alcohol, Pure Sigma Aldrich E7023 Ethanol
Analog Vortex Mixer Thermo Fisher Scientific 02215365 Vortex
Mini Centrifuge Thermo Fisher Scientific 05-090-100
Agencourt RNAClean XP Beads Beckman Coulter A63987 RNA magnetic beads
MagnaBlot II Magnetic Separator Promega V8351 Magnetic stand
1.5 mL MCT Graduated Tubes Thermo Fisher Scientific 05-408-129
Smart-Seq v4 Ultra Low Input RNA Kit Clontech 634888 Reagents for Reverse Transcription and PCR Amplification
10x Lysis Buffer Lysis Buffer 2
5x Ultra Low First-strand Buffer Buffer 1
3' SMART-Seq CDS Primer II A Primer II
SMART-Seq v4 Oligonucleotide Oligonucleotide
SMARTScribe Rverse Transcriptase Reverse Transcriptase (RT)
2x SeqAmp PCR Buffer PCR Buffer
PCR Primer II A PCR Primer
SeqAmp DNA Polymerase DNA Polymerase
Mastercycler pro S Eppendorf 950030020 Thermocycler
Agencourt AMPure XP Beads Beckman Coulter A63881 DNA magnetic beads
2100 Bioanalyzer Agilent Technologies G2939AA
HS Bioanalyzer Chips & Reagents Agilent Technologies 5067-4626
Qubit HS Assay Kit Thermo Fisher Scientific Q32851 For the calculation of sample concentrations
Qubit Assay Tubes Thermo Fisher Scientific Q32856
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866
Nextera XT DNA Sample Preparation Kit Illumina FC-131-1024 Reagents for Tagmentation and Index Coupling
TD Buffer Buffer 2
ATM Tagmentation Mix
NT Buffer Tagmentation Neutralizing Buffer
NPM PCR Master Mix
Nextera XT Index Kit Illumina FC-131-1001 Indices for Tagmentation
N501 White 1
N502 White 2
N701 Orange 1
N702 Orange 2
HiSeq 2500 Illumina SY-401-2501 For completing sequencing of samples

DOWNLOAD MATERIALS LIST

References

  1. Austin, C., Cepko, C. L. Specification of Cell Fate in the Vertebrate Retina. Neural Cell Specif. 3, 139-143 (1995).
  2. Masland, R. H. The Neuronal Organization of the Retina. Neuron. 76, (2), 266-280 (2012).
  3. Rodieck, R. The First Steps in Seeing. Sinauer Associates, Inc. Sunderland, MA. (1998).
  4. Chiu, I. M., et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife. 3, e04660 (2014).
  5. Tasic, B., et al. Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci. 19, (2), 335-346 (2016).
  6. Trapnell, C. Defining cell types and states with single-cell genomics. Genome Res. 25, (10), 1491-1498 (2015).
  7. Zeisel, A., et al. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science. 347, (6226), 1138-1142 (2015).
  8. Schmidt, T. M., Do, M. T. H., Dacey, D., Lucas, R., Hattar, S., Matynia, A. Melanopsin-Positive Intrinsically Photosensitive Retinal Ganglion Cells: From Form to Function. J. Neurosci. 31, (45), 16094-16101 (2011).
  9. Eberwine, J., Miyashiro, K., Kacharmina, J. E., Job, C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc. Natl. Acad. Sci. 98, (13), 7080-7085 (2001).
  10. Darmanis, S., et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl. Acad. Sci. 112, (23), 7285-7290 (2015).
  11. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  12. Usoskin, D., et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, (1), 145-153 (2015).
  13. Poulin, J. F., Zou, J., Drouin-Ouellet, J., Kim, K. Y. A., Cicchetti, F., Awatramani, R. B. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell. Rep. 9, (3), 930-943 (2014).
  14. Gross, A., Schoendube, J., Zimmermann, S., Steeb, M., Zengerle, R., Koltay, P. Technologies for Single-Cell Isolation. Int. J. Mol. Sci. 16, 16897-16919 (2015).
  15. Lovatt, D., et al. Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue. Nat Methods. 11, (2), 190-196 (2014).
  16. Qiu, S., et al. Single-neuron RNA-Seq: Technical feasibility and reproducibility. Front. Genet. 3, (124), 1-8 (2012).
  17. Subkhankulova, T., Yano, K., Robinson, H. P. C., Livesey, F. J. Grouping and classifying electrophysiologically-defined classes of neocortical neurons by single cell, whole-genome expression profiling. Front. Mol. Neurosci. 3, (10), 1-11 (2010).
  18. Fuzik, J., et al. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat. Biotechnol. 34, (2), 175-183 (2016).
  19. Schmidt, T. M., Kofuji, P. An isolated retinal preparation to record light response from genetically labeled retinal ganglion cells. J. Vis. Exp. (47), e2367 (2011).
  20. Schmidt, T. M., Kofuji, P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci. 29, (2), 476-482 (2009).
  21. Schmidt, T. M., Kofuji, P. Structure and Function of Bistratified Intrinsically Photosensitive Retinal Ganglion Cells in the Mouse. J Comp Neurol. 519, (8), 1492-1504 (2011).
  22. Schmidt, T. M., Kofuji, P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci. 30, (48), 16262-16271 (2010).
  23. Clontech Laboratories I. SMARTerTM Ultra Low RNA Kit for Illumina® Sequencing. (2013).
  24. Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K., Regev, A. Preparation of single-cell RNA-Seq libraries for next generation sequencing. Curr. Protoc. Mol. Biol. 4, (22), 1-17 (2014).
  25. Ecker, J. L., et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: Cellular diversity and role in pattern vision. Neuron. 67, (1), 49-60 (2010).
  26. Schmidt, T. M., et al. A Role for Melanopsin in Alpha Retinal Ganglion Cells and Contrast Detection. Neuron. 82, (4), 781-788 (2014).
  27. Sanes, J. R., Masland, R. H. The Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification. Annu. Rev. Neurosci. 38, 221-246 (2014).
  28. Goetz, J. J., Trimarchi, J. M. Single-cell Profiling of Developing and Mature Retinal Neurons. J. Vis. Exp. e3824 (2012).
  29. Trimarchi, J. M., et al. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. J. Comp. Neurol. 502, 1047-1065 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics