Dissection von Larval Zebrabärbling Gonadal Tissue

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Hier präsentieren wir ein Protokoll für Gonadengewebe der Larven Zebrabärbling Isolierung, die Untersuchungen von Zebrabärbling Geschlechtsdifferenzierung und Wartung erleichtert.

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Obwohl wilde Zebrafische ZZ / Z-Chromosom besitzen, haben domestizierten Zebrabärbling das Geschlechtschromosom verloren. Sie nutzen eine polygene Geschlechtsbestimmung System, in dem mehrere Gene verteilt über das gesamte Genom kollektiv die Geschlechtsidentitäten einzelner Fische bestimmen. Derzeit beteiligt sich die Gene Gonadenentwicklung bei der Regulierung und wie sie bleiben schwer arbeiten. Normalerweise Gonadengewebe zu isolieren, ist der erste Schritt der Geschlechtsentwicklungsprozesse zu untersuchen. Hier stellen wir ein Verfahren Gonadengewebe von 17 dpf (Tage nach der Befruchtung) und 25 dpf Zebrabärblingembryonen zu isolieren. Das isolierte Gonadengewebe kann anschließend durch Morphologie und Genexpressionsanalysen untersucht werden.

Introduction

Das wichtigste weibliche Geschlecht Determinante bei Wild Zebrabärbling Chromosom 4 in dem domestizierten Zebrabärbling (dh gemeinsame Laborstämme) 1 verloren oder verändert werden . Stattdessen haben sie eine polygene System Geschlechtsbestimmung durch Umweltfaktoren wie Temperatur begleitet, Hypoxie, Nahrungsverfügbarkeit und Bevölkerungsdichte. Die detaillierten Mechanismen der Zebrabärbling Geschlechtsentwicklung sind nicht vollständig verstanden. Grundsätzliche Fragen wie bei Zebrabärbling Geschlechtsbestimmung stattfindet, was das primäre Geschlechtsbestimmungssignal (s) ist / sind, und die Gene regulieren , der erste Schritt der Transformation Gonade bleibt 2 beantwortet werden, 3.

Im Prozess der Zebrabärbling Geschlechtsentwicklung wurden mehrere wichtige Etappen anerkannt. In der frühen Phase der Entwicklung, ausgehend von 4 HPF (Stunden nach der Befruchtung) Ur-Keimzellen (PGC) unterzieht Spezifikation, die Migration zu Genitalleiste undProliferation. PGC Zahlen und gegenseitige Wechselwirkungen zwischen den Keimzellen und somatischen Zellen sind wichtig für die Gonade Differenzierung 4. Bei 13 dpf (Tage nach der Befruchtung), sind die Gonaden in dem undifferenzierten Stadium. Mit dem 17 dpf, entwickeln die Gonaden in bi-Potential Ovarien in beiden zukünftigen Frauen und Männern. Der Apoptose-abhängiger Übergang von Ovar zu Hoden bei 21 bis 25 dpf beginnen und für mehrere Wochen andauern kann. Von 35 dpf, hat das Geschlecht der Gonaden bestimmt worden , und geschlechtsspezifische Gameten Produktion ist im Gang in beiden Ovarien und Hoden 5, 6, 7.

Bis heute diverse Kandidaten-Gene und Mechanismen der Geschlechtsbestimmung vorgeschlagen worden. Proteomics und Transkriptom - Analyse haben viele Gene mit geschlechtsdimorphischen Ausdruck und diese Gene wurden verwendet , um zu studieren Geschlechtsdifferenzierung in Zebrabärbling 8 isoliert, 9, 10. Zum Beispiel in larvalen Zebrabärbling wird das cyp19a1a Gen im Ovar spezifisch exprimiert , nicht aber in den Hoden 11, 12. Zusätzlich wird AMH Gene schwach in den Ovarialfollikel Granulosa - Zellen exprimiert, aber stark in Testis Sertoli - Zellen 13. Im Gegensatz dazu wird vasa - Gen in den Keimzellen des weiblichen und männlichen Zebrafisches, so dass es eine geeignete Gonade Marker 14, 15 kontinuierlich ausgedrückt.

Gonaden - Genexpressionsniveau zu untersuchen ist kritisch , den molekularen Mechanismus der Geschlechtsbestimmung und Differenzierung vor allem in der Bipotential-Ovar Stufe 3, 9 zu verstehen. Jedoch erschwert die geringe Größe der larvalen Zebrabärbling und entsprechend kleiner Gonaden die Isolierung von gonadal Gewebe für die weitere molekulare Analyse. Frühere Studien verwendet sezierten gesamten Rumpfbereich zwischen Opercula und anal Pore 16. Diese Zubereitung, obwohl enthält Gonaden, besteht aus mehreren Geweben und Organen. Alternativ können transgene Tiere mit GFP Gonade spezifische Expression, wie vasa: 17, 18 EGFP wurden Gonadengewebe Trennung über Fluoreszenz - aktivierte Zellsortierung (FACS) und Laser - Capture - Mikrodissektion verwendet. Aber ihre weit verbreitete Anwendung ist begrenzt. Hier beschreiben wir ein einfaches Verfahren Gonadengewebe von Larven Zebrabärbling zu isolieren, auf 17 dpf und 25 dpf. Wir zeigen die Lage der Gonaden mit Bezug auf andere Organe und zu isolieren, die morphologisch intakten Gonaden aus den umgebenden Geweben. Wir zeigen weiter die Gonade spezifische Gene wie vasa und cyp19a1a sind in den isolierten Gonaden hochexprimierten verglichen mit dem Stamm Gewebe durch quantitative PCR (qPCR-Analyse). Dieses Protokoll ermöglicht die Identifizierung, Isolierung, Reinigung und RNA - Amplifikation von Gonaden - spezifische Gene von larvalen Zebrabärbling, wodurch nachfolgende molekulare Analyse von Gonadengewebe 19 ermöglicht.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Zebrafisch-Experimente wurden von der Fudan University Institutional Animal Care und Use Committee genehmigt. Zebrafisch wurde angehoben und gezüchtet nach Standardverfahren 20.

1. Vorbereitungen

  1. Kultivieren 17 dpf und 25 dpf larvalen Zebrabärbling
    1. Transfer 2 männliche und 2 weibliche erwachsene Zebrabärbling (gesund, 3 bis 6 Monate alt, Labor AB-Stamm) an einer Kreuzung Tank am späten Nachmittag vor der Kreuzung Tag. Trennen Sie die Männchen und Weibchen mit einer Barriere. Am nächsten Morgen, aktualisieren Sie die Tankwasser und entfernen Sie die Barriere, damit sie sich paaren. Sammeln Eier in 100 mm Petrischalen mit 1 bis 2 h nach der Befruchtung.
    2. Halten Sie etwa 40 Embryonen in einer 100-mm-Platte mit 40 ml Embryo Medium (EM) bei 28,5 ° C während der frühen Entwicklungsphase (4 Tage) und aktualisieren Sie die EM zweimal am Tag. Übertragen Larven auf 1 l-Tanks (40 Larven auf 300 ml Wasser-System) und Futtermittel mit Live-Rotatorien (Vollpension, zweimal täglich) nach 5 dpf.Feed-Live-Artemia statt rotifer Diät nach 10 dpf. Übertragen , um die Fische in rezirkulierenden Wassersystem bei 14 dpf 21.
    3. Erhöhen larvalen Zebrabärbling im rezirkulierenden Wassersystem bis 17 dpf oder 25 dpf. Sicherstellen, dass der Hell / Dunkel-Zyklus ist 14/10 h und die pH-Wert des Systemwassers beträgt etwa 7,2. Messen Sie die Körperlänge von 17 dpf (5,5 bis 6,8 mm) und 25 dpf (8 bis 11 mm) 22 Larven.
  2. Bereiten 2% Agarplatten für die Dissektion.
    1. In 4 g Agar zu 200 ml sterilem Wasser. Das Gemisch wird in einem Mikrowellenofen, bis sie transparent macht.
    2. Man kühlt die Agarlösung für etwa 15 min, dann gieße es in 60 mm Durchmesser Petrischalen (etwa 1/3 des Volumens der Platte). Lagern Sie die verfestigten Agar-Platten bei 4 ° C.

2. Protokoll 1: Präparieren Sie die Keimdrüsengewebe von 17 und 25 dpf Larvae

  1. In zerstoßenem Eis in den Tank 17 dpf Larven zu betäuben. übertragen Sie dieanästhesiert Larven in einen 100 mm gekühlt Petrischal mit 30 ml kalter Ringer-Lösung. Halten Sie den inkubiert Fisch in der Lösung des gekühlten Ringers für mindestens 15 min vollständig die Larven zu betäuben.
  2. Übertragen Sie die Larven zu einer vorgekühlten Agar-Platte mit einem kleinen Plastiklöffel. Tauchen Sie den gesamten Fischkörper in 10 ml gekühlt Ringer-Lösung und sanft liegt auf der Seite.
  3. Führen Sie die folgenden Operationen im Rahmen der Vision Feld 25X Stereomikroskop. Spannen Sie den Fisch Stamm mit einer Pinzette zur Stabilisierung. Rip den Bauch in Längsrichtung vom Anus zum Herzen mit einem anderen Pinzette. Entfernen sanft die Haut und Muskeln auf der einen Seite des Körpers, um die inneren Organe zu belichten.
  4. Entfernen Sie die Masse der Organe ventral die Schwimmblase vorsichtig. Vermeiden Sie die auf die Schwimmblase angebracht Gonaden zu beschädigen.
  5. Schneiden Sie die Verbindung zwischen der Schwimmblase und vorderen Körpern. Ziehen Sie die gesamte Schwimmblase und Gonadengewebe vorsichtig heraus.
    HINWEIS: In den meisten Fällens, das Gonadengewebe bei 17 dpf enthält Epithelgewebe und protonephridium umgibt. Sie sind nicht leicht voneinander getrennt, aber bei 25 dpf leicht getrennt werden können. Die Gonaden sind auch mit dem Anus verbunden. Eine Kreuzung mit der linken und rechten Gonade zueinander sichtbar sein wird deutlich an den Anus verbunden.
  6. Verwenden einer Pinzette vorsichtig die Gonadengewebe aus der Schwimmblase zu trennen und die umliegenden Fettgewebe aufzuräumen.
  7. Unmittelbar überträgt die isolierten Gonadengewebe auf ein vorgekühlte 1,5 ml-Zentrifugenröhrchen, das 200 & mgr; l Ringer-Lösung. Halten Sie das Röhrchen auf Eis, bis alle Gonadengewebe von den Larven getrennt sind.
  8. Seziert die Gonaden von 25 dpf Larven wie in den Schritten von 2,1 bis 2,7.

3. Protokoll 2: Analysieren Gene Expression der isolierten Gonadengewebe

  1. Extrahieren der Gesamt-RNA aus den Geweben der Larven Gonaden.
    1. Übertragen Sie die isolierten Gonadengewebe auf ein neues RNase-free 1.5 ml-Röhrchen und Ringer-Lösung entfernen. Je 100 & mgr; l Lyse-Lösung. Vortex, bis das Gewebe vollständig aufgelöst.
    2. Führen Sie die Gesamt-RNA-Extraktionsverfahren gemäß den Anweisungen des Herstellers.
    3. In 1/10 Volumen 10x DNase I-Puffer und 1 ul DNase I zu der RNA-Lösung und vorsichtig mischen. bei 37 ° C für 20 min inkubieren.
    4. In 1/10 Volumen DNase Inaktivierung Reagenz zu der RNA-Lösung. bei 70 ° C für 10 min inkubieren. Messen Sie die Konzentration des Gesamt-RNA mit einem Spektralphotometer. Lagerung bei -20 ° C.
  2. Führen des ersten Strangs der cDNA-Synthese
    1. Verwenden eines Oligo (dT) Primer -Linker Erststrang-cDNA-Synthese durchzuführen, dem Protokoll des Herstellers folgend. In 1 bis 2 & mgr; g RNA zu einem Gesamtreaktionsvolumen auf 20 ul.
    2. Inkubieren der Reaktionslösung für 90 min bei 45 ° C. Beenden Sie die Reaktion durch Erhitzen auf 70 ° C für 5 min.
    3. 1 & mgr; l RNase H zu der cDNA solution die restlichen RNA zu entfernen. Vorsichtig mischen und Zentrifuge für 10 s bei ~ 13.000 x g. bei 37 ° C für 20 min inkubieren. In 20 ul Nuklease freiem Wasser. Lagern bei -70 ° C.
  3. Führen fluoreszierende quantitative PCR
    1. Führen qPCR auf einem Cycler-System mit einem Fluoreszenzfarbstoff. Verwenden Sie die folgenden PCR-Zyklusbedingungen: 35 Zyklen bei 95 ° C für 15 s, Tm-5 ° C für 15 s, 68 ° C für 30 s. Primersequenzen wie folgt verwenden: AMH (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), Vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) und β-Actin (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dissektionen der Gonaden wurden auf AB-Stamm Larven Zebrabärbling durchgeführt. Abbildung 1 zeigt typischen Gonadengewebe larvaler Zebrabärbling bei 17 dpf und 25 dpf. Zuerst wird die Haut und Muskeln von einer Seite des Bauches geschnitten, um die inneren Organe zu belichten. die Masse der inneren Organe, bleibt die Schwimmblase zusammen mit den Gonaden im Kofferraum nach dem Entfernen. Die Gonaden wurde auf der ventralen Seite der Schwimmblase angebracht (Pfeil in 1B '). Mit 17 dpf waren die Gonaden in der bi-Potential Ovar Bühne. Die isolierte Gonade enthielt den linken und den rechten Gonade und war durchscheinend (1C). In den meisten Fällen wurde es von Epithelgewebe und protonephridium (Pfeil in 1C) umgeben ist . Bei 25 dpf der Gonaden wurde oft von Fettgewebe (1D) gewickelt. An dieser Entwicklung stAlter, entweder groß oder klein gonad beobachtet werden. Die unreife Ovars ist groß , wie die Entwicklung der sekundären Oozyten und Follikelzellen erhöhen die Gonade Volumen (Figur 1E). Die unreife testis ist klein , weil die Degeneration und Apoptose der larvalen Eierstock- (1F).

Um die molekularen Eigenschaften der isolierten Gonadengewebe zu analysieren, untersuchten wir erste Genexpressionsniveaus von AMH, cyp19a1a, nanos3 und Vasa, vier Gonade Marker in Zebrabärbling, durch qPCR. Die Gesamt-RNA wurde aus larvalen Gonadengewebe extrahiert (n = 35), die eine RNA Isolation Kit. Außerdem entfernten wir den Kopf und den Schwanz von 17 dpf Larve, und verwendet, um den Stamm Gewebe (zwischen der Struktur des Herzens und der analen Pore) RNA als Kontrollgruppe (n = 15) zu extrahieren. Der Stamm Gewebe enthielt Haut, Muskel, Knochen (Wirbel und Rippen), Schwimmblase, Niere und Gonaden. Oligo dT-primed cDNA wurde für qPCR verwendet. Das Ergebnis zeigte , qPCR Erhöhungen AMH, cyp19a1a, nanos3 und Vasa - Expressionsniveau in 17 dpf isoliert Gonadengewebe um etwa 397, 342, 45 und 170-fach, bzw. (Abbildung 2).

Abbildung 1
Abbildung 1 : Mikrophotographien von typischen Gonadengewebe in Larval Zebrabärbling bei 17 dpf und 25 dpf. (A) Zerreißen die Haut und Muskeln von einer Seite des Bauches der inneren Organe unter einem 25X Stereomikroskop zu belichten. (B) Nachdem die Masse der inneren Organe zu entfernen, die Schwimmblase und die Gonade bleiben an den Rumpf angebracht ist . (B ') Amplified Ansicht des roten Feldes in Feld B die relative Position der Schwimmblase und die Gonaden zu zeigen. Die Gonaden wird durch den Pfeil angezeigt. (C) Iso Gonadengewebe bei 17 dpf umgerechnet. Die schwarzen Gewebe in dem Bild (Pfeile) sind die Endothelgewebe und protonephridium zu Gonade befestigt. (DE) Eine große Gonade vor und nach Fettgewebes Entfernung bei 25 dpf. (F) Eine kleine Gonade bei 25 dpf. Maßstabsbalken: 200 & mgr; m. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Normierte Genexpressionsniveau von amh, cyp19ala, nanos3 und Vasa in dem Trunk und Isolieren Gonaden bei 17 dpf. Anzahl der Versuchstiere: Kontrollgruppe, n = 15; Gonaden-Gruppe, n = 35. Die trunk Gewebe in der Kontrollgruppe sind, ohne den Kopf und den Schwanz-Strukturen. Gonade Gruppe bezieht sich auf den isolierten Gonadengewebe./files/ftp_upload/55294/55294fig2large.jpg“target =‚_ blank‘> Bitte hier klicken, um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Der Zebrabärbling hat ein leistungsfähiges Modell worden und ist in der Entwicklung und krankheitsbezogenen Forschung intensiv genutzt. Die Verfahren zur Isolierung von Organen bei erwachsenen Zebrafisch wie Gehirn, Herz, Gonaden und Niere wurden gut dokumentiert , 23, 24, 25. Aufgrund der geringen Größe und dynamische Umgestaltung der Gonadengewebe im Larven Zebrabärbling, Isolierung von Gonadengewebe ist eine anspruchsvolle Aufgabe. Frühere Studien ganze seziert Stamm Gewebe oder transgenes Vasa verwendet: EGFP basierte Zellsortierung und Lasermikrodissektion die Larven Gonaden 26 zu untersuchen. Die Modifikationen des Chromosoms 4 während der Domestikation machen die Geschlechtsbestimmung ein Geheimnis in dem domestizierten Zebrabärbling. Unsere Methode kann hier beschrieben eine relativ saubere und frühen gonad Vorbereitungen zur weiteren morphologischen und molekularen Untersuchungen, die hilfreich sein kann, den geschlechtsbestimmenden mech zu erkundennismen.

Es ist nicht leicht zu frühen Entwicklungsstadien der Entwicklung Gonaden von anderen Strukturen zu trennen. Unsere Methode beschreibt, wie die Zerlegung durchzuführen. Um erfolgreich dieses Protokoll durchführen, müssen einige wichtige Schritte zu verzeichnen. Erstens ist die Wachstumsbedingungen der Larven Zebrabärbling kritisch Ausbeute erwarteten Ergebnisse. Die Gonaden Entwicklung der Larven Zebrabärbling ist ein sehr dynamischer Prozess. Die Größe und das Aussehen von Gonadengewebe werden von den Entwicklungsstadien der Tiere 27 bestimmt. Es ist wichtig, verschiedene Chargen von Zebrabärbling in standardisiertem Zustand zu halten. Die Faktoren, die das Wachstum der Larven sind die Bevölkerungsdichte, Dauer der Hell- und Dunkelzyklen, die Verfügbarkeit von Nahrungsmitteln und Futterpläne beeinflussen können. Die Standard - Längenmessung von Fischlarven können als Leitfaden verwendet werden 22 , um den Wachstumszustand der Tiere zu bestimmen. Ein zweiter wichtiger Faktor für eine erfolgreiche Gonadengewebe IsolatIon ist ein gutes Verständnis der relativen Position und morphologischer Unterschiede zwischen den Gonaden und dem umgebenden Gewebe. Weil der Gonade der ventralen Seite der Schwimmblase befindet, ist es zweckmäßig, zunächst die Gonaden zu isolieren zusammen mit der Schwimmblase. Darüber hinaus wird das distale Ende der Gonaden fest an dem distalen Ende des Darms befestigt. So hat man vorsichtig sein, wenn an den distalen Enden des Darms von der Gonaden zu entfernen. Für nachfolgende Genexpressionsanalyse ist es wichtig, vorgekühlte Medien und Agar-Platte zu verwenden, und das gesamte Verfahren schnell durchführen.

Ein ähnliches Verfahren wurde erfolgreich von RF Ketting et al verwendet worden. 28. Sie wendeten die Gonaden Isolationsverfahren zur Untersuchung der Funktion von piRNAs und den PIWI Weg in 3 Wochen alten Larven. Hier haben wir seziert Gonadengewebe von Zebrabärblingembryonen bereits 17 dpf die molekulare Identität und Genexpressionsprofil des develo zu erkundenping Zebrabärbling Gonaden. Zukünftige molekulare Analysen des früheren isolierten Gonadengewebe können die Transkriptom, Methylom und Histon-Acetylierung Muster zu bestimmen, durchgeführt werden, um die Mechanismen aufzuklären zugrunde liegenden Geschlechtsentwicklung im Zebrafisch.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine finanziellen Interessen haben.

Acknowledgments

Wir danken C Zhang für Fisch Pflege. Diese Arbeit wurde von der National Natural Science Foundation of China (31171074, 31371099 und 31571067 bis GP) und durch das Pujiang Talent Project (09PJ1401900 zu GP) unterstützt.

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics