La disección de las larvas de pez cebra de tejidos gonadales

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 1 hour trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Aquí, se presenta un protocolo para el aislamiento de tejido gonadal de larvas de pez cebra, que facilitará las investigaciones de la diferenciación sexual de pez cebra y el mantenimiento.

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Aunque el pez cebra salvaje poseen un sistema de determinación del sexo / ZW ZZ, pez cebra domesticado han perdido el cromosoma sexual. Ellos utilizan un sistema de determinación del sexo poligénica, donde varios genes distribuidos en todo el genoma determinar colectivamente las identidades sexuales de peces individuales. Actualmente, los genes implicados en la regulación del desarrollo de las gónadas y cómo funcionan siendo difícil de alcanzar. Normalmente, el aislamiento de tejido gonadal es el primer paso para examinar los procesos de desarrollo de sexo. A continuación, presentamos un procedimiento para aislar el tejido gonadal de 17 dpf (días después de la fertilización) y 25 dpf larvas de pez cebra. El tejido gonadal aislado puede ser examinada posteriormente por la morfología y la expresión de genes de perfiles.

Introduction

El principal determinante del sexo femenino en salvaje cromosoma pez cebra 4 se pierde o se modifica en el pez cebra domesticado (es decir, las cepas de laboratorio comunes) 1. En cambio, tienen un sistema de determinación del sexo poligénica acompañado por factores ambientales como la temperatura, la hipoxia, la disponibilidad de alimentos y la densidad de población. Los mecanismos detallados del desarrollo sexual del pez cebra no se entienden completamente. Las preguntas fundamentales tales como cuando se produce la determinación del sexo de pez cebra, lo que es la señal de la determinación del sexo primario (s) / son, y que los genes regulan la primera etapa de transformación gónada siguen sin respuesta 2, 3.

En el proceso del desarrollo sexual de pez cebra, varias etapas importantes han sido reconocidos. En la etapa temprana de desarrollo, a partir de 4 hpf (horas después de la fecundación) germinales células primordiales (PGCs) someterse especificación, la migración a cresta genital yproliferación. Números PGC y las interacciones recíprocas entre las células germinales y las células somáticas son importantes para la diferenciación de las gónadas 4. A los 13 dpf (días después de la fertilización), las gónadas están en la etapa indiferenciada. Por 17 dpf, las gónadas se desarrollan en los ovarios bi-potenciales en las hembras y los machos futuras. La transición apoptosis dependiente de ovario al testículo comienzan a las 21 a 25 dpf y puede continuar durante varias semanas. Por 35 dpf, el sexo de la gónada se ha determinado y la producción de gametos específico del sexo está en marcha en ambos ovarios y testículos 5, 6, 7.

Hasta la fecha, se han propuesto diversos genes y mecanismos de determinación del sexo candidatos. Proteómica y análisis transcriptomic han aislado muchos genes con expresión dimorfismo sexual y estos genes se han utilizado para estudiar la diferenciación sexual en el pez cebra 8, 9, 10. Por ejemplo, en larvas de pez cebra, el gen cyp19a1a se expresa específicamente en el ovario pero no en el testículo 11, 12. Además, el gen AMH se expresa débilmente en las células del folículo de la granulosa de ovarios, pero fuertemente en los testículos células de Sertoli 13. En contraste, el gen vasa se expresa continuamente en las células germinales de ambos pez cebra hembra y macho, por lo que es un marcador gónada adecuado 14, 15.

Investigando gonadales niveles de expresión génica es fundamental para comprender el mecanismo molecular de la determinación del sexo y diferenciación especialmente en la etapa de ovario bi-potencial 3, 9. Sin embargo, el pequeño tamaño de larvas de pez cebra y correspondientemente pequeñas gónadas complicar el aislamiento de gónadal de tejido para análisis molecular más. Estudios previos utilizados diseccionaron región del tronco entero entre los opérculos y poro anal 16. Esta preparación, aunque gónadas contienen, consiste en múltiples tejidos y órganos. Alternativamente, los animales transgénicos con la expresión de GFP-gónada específica tales como vasa: EGFP se utilizaron para el aislamiento de tejido gonadal a través de células activadas por fluorescencia (FACS) y captura por láser micro-disección 17, 18. Sin embargo, su aplicación generalizada es limitado. A continuación, describimos un procedimiento simple para aislar el tejido gonadal de larvas de pez cebra a las 17 dpf y 25 dpf. Se demuestra la posición de las gónadas con respecto a otros órganos y aislar las gónadas morfológicamente intactas de los tejidos circundantes. Además, muestran los genes-gónadas específicos tales como vasa y cyp19a1a son altamente expresado en las gónadas aisladas en comparación con el tejido del tronco a través de PCR cuantitativa (qPCR) análisis. El presente protocolo permite la identificación, aislamiento, purificación de ARN y amplificación de genes específicos gonadales de larvas de pez cebra, permitiendo de este modo posterior análisis molecular de tejido gonadal 19.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

experimentos de pez cebra fueron aprobados por el Comité Institucional de Cuidado y Uso de Animales de la Universidad de Fudan. El pez cebra se plantearon y criado de acuerdo con procedimientos estándar de 20.

1. Preparativos

  1. Cultivar 17 dpf y 25 dpf larvas de pez cebra
    1. Transfer 2 hombres y 2 mujeres adultos de pez cebra (sana, de 3 a 6 meses de edad, de laboratorio AB strain) a un tanque de cruce en la tarde antes del día de travesía. Separar los machos y las hembras con una barrera. A la mañana siguiente, refrescar el agua del tanque y eliminar la barrera para que puedan aparearse. Recoger los huevos en 100 mm placas de Petri de 1 a 2 horas después de la fertilización.
    2. Mantener aproximadamente 40 embriones en una placa de 100 mm con 40 ml de medio de embrión (EM) a 28,5 ° C durante el período de desarrollo de la primera (4 días) y actualizar la EM dos veces al día. Transferencia de las larvas a 1 tanques de L (40 larvas a 300 ml de agua del sistema) y alimentar con rotíferos vivos (suministro completo, dos veces al día) después de 5 dpf.Alimentar artemia viva en lugar de la dieta de rotíferos después de 10 dpf. Transferir el pescado en recirculante sistema de agua a 14 dpf 21.
    3. Elevar larvas de pez cebra en el sistema de recirculación de agua hasta 17 dpf o 25 dpf. Asegúrese de que el ciclo de luz / oscuridad es 14/10 h y pH valor de agua del sistema es de aproximadamente 7,2. Medir la longitud corporal de 17 dpf (5.5 hasta 6.8 mm) y 25 dpf (8 a 11 mm) larvas 22.
  2. Preparar 2% placas de agar para la disección.
    1. Añadir 4 g de agar a 200 ml de agua estéril. Calentar la mezcla en un horno microondas hasta que se vuelve transparente.
    2. Se enfría la solución de agar durante aproximadamente 15 min, luego se vierte en 60 mm de diámetro placas de Petri (aproximadamente 1/3 de volumen de la placa). Almacenar las placas de agar solidificado a 4 ° C.

2. Protocolo 1: diseccionar el tejido gonadal de 17 y 25 dpf larvas

  1. Añadir hielo picado en el tanque para anestesiar a 17 larvas dpf. la transferencia de lalarvas anestesiado a un 100 mm refrigerados placa de Petri con una solución de 30 ml de Ringer frío. Mantener el pescado se incubaron en la solución de Ringer enfriada durante al menos 15 min para anestesiar completamente las larvas.
  2. Transferir las larvas a una placa de agar previamente enfriada con una pequeña cuchara de plástico. Sumergir todo el cuerpo de los peces en 10 ml refrigerados solución de Ringer y suavemente ponerla en su lado.
  3. Realizar las siguientes operaciones bajo el campo de visión del microscopio estereoscópico 25X. Sujetar el cuerpo del pez con pinzas para la estabilización. Rip el abdomen longitudinalmente desde el ano hasta el corazón con otro par de pinzas. eliminar suavemente la piel y los músculos de un lado del cuerpo para exponer los órganos internos.
  4. Retire la masa de órganos ventrales a la vejiga natatoria con cuidado. Evitar daños en la gónada unido a la vejiga natatoria.
  5. Cortar la conexión entre la vejiga natatoria y la parte anterior del cuerpo. Tire de toda la vejiga natatoria y el tejido gonadal suavemente.
    NOTA: En la mayoría de casoss, el tejido gonadal en 17 dpf contiene tejido circundante epitelial y protonephridium. Ellos no se separan fácilmente unos de otros, pero a 25 dpf que se pueden separar fácilmente. La gónada también está conectado con el ano. Una unión con las gónadas izquierda y derecha conectadas entre sí en el ano será claramente visible.
  6. Use pinzas para separar cuidadosamente el tejido gonadal de la vejiga natatoria y limpiar los tejidos adiposos de los alrededores.
  7. Transferir inmediatamente el tejido gonadal aislado a un tubo de centrífuga preenfriado 1,5 ml que contenía la solución de 200 l Ringer. Mantenga el tubo en hielo hasta que todos los tejidos gonadales se separan de las larvas.
  8. Diseccionar las gónadas de 25 dpf larvas como se describe en los pasos 2.1 - 2.7.

3. Protocolo 2: analizar la expresión génica de los tejidos gonadales aislados

  1. Extraer el ARN total de los tejidos gonadales larvales.
    1. La transferencia de los tejidos gonadales aislados a un nuevo libre de RNasa 1.5 ml tubo y remover la solución de Ringer. Añadir 100 l solución de lisis. Vortex hasta que los tejidos están completamente lisadas.
    2. Realice el procedimiento de extracción de RNA total de acuerdo con las instrucciones del fabricante.
    3. Añadir 1/10 volumen de 10x DNasa I buffer y 1 l de DNasa I a la solución de ARN y mezclar suavemente. Incubar durante 20 min a 37 ° C.
    4. Añadir reactivo DNasa inactivación 1/10 de volumen a la solución de ARN. Incubar durante 10 min a 70 ° C. Medir la concentración del ARN total usando un espectrofotómetro. Almacenar a -20 ° C.
  2. Realizar la síntesis de ADNc de primera cadena
    1. Utilice un oligo (dT) primer enlazador para llevar a cabo la síntesis de primera cadena de ADNc siguiendo el protocolo del fabricante. Añadir 1 a 2 g de ARN hasta un volumen total de reacción de 20! L.
    2. Incubar la solución de reacción durante 90 min a 45 ° C. Terminar la reacción por calentamiento a 70 ° C durante 5 min.
    3. Añadir 1 l de RNasa H a la cDNA tanlución para eliminar el ARN residual. Mezclar suavemente y centrifugar durante 10 s a ~ 13.000 x g. Incubar durante 20 min a 37 ° C. Añadir 20 l de agua libre de nucleasa. Almacenar a -70 ° C.
  3. Realizar PCR cuantitativa fluorescente
    1. Realizar qPCR en un sistema ciclador con un colorante fluorescente. Use las siguientes condiciones de ciclado de PCR: 35 ciclos a 95 ° C durante 15 s, Tm-5 ° C durante 15 s, 68 ° C durante 30 s. Utilice secuencias de los cebadores de la siguiente manera: AMH (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) y β-actina (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Las disecciones de las gónadas se realizaron en AB strain larvas de pez cebra. La figura 1 muestra de tejido gonadal típico de larvas de pez cebra a las 17 dpf y 25 dpf. En primer lugar, la piel y los músculos de un lado del abdomen se corta para exponer los órganos internos. Después de retirar la masa de los órganos internos, la vejiga natatoria, junto con la gónada permanecen en el maletero. La gónada estaba unido a la parte ventral de vejiga natatoria (flecha en la Figura 1B '). A los 17 dpf, la gónada estaba en la etapa de ovario bi-potencial. La gónada aislado contenía la izquierda y la gónada derecha y era translúcida (Figura 1C). En la mayoría de los casos, que estaba rodeado por tejido epitelial y protonephridium (flecha en la Figura 1C). En 25 dpf la gónada fue a menudo envuelto por los tejidos adiposos (Figura 1D). En este desarrollo stla edad, se puede observar las gónadas ya sea grande o pequeño. El ovario inmaduro es grande como el desarrollo de los ovocitos secundarios, y las células del folículo aumentar el volumen de las gónadas (Figura 1E). El testículo inmaduro es pequeño debido a la degeneración y apoptosis del ovario larval (Figura 1F).

Para analizar las propiedades moleculares de los tejidos gonadales aislados, examinamos primero de genes niveles de expresión de AMH, cyp19a1a, nanos3 y vasa, cuatro marcadores de las gónadas en el pez cebra, por qPCR. ARN total fue extraído a partir de tejidos de larvas gonadales (n = 35) utilizando un kit de aislamiento de ARN. Además, hemos eliminado la cabeza y la cola de 17 dpf larva, y utilizamos el tejido tronco (entre la estructura del corazón y de poro anal) para extraer el ARN como el grupo de control (n = 15). El tejido tronco incluye la piel, músculo, hueso (vértebras y costillas), vejiga natatoria, riñón y gónadas. Oligo dT-primed cDNA se utilizó para la qPCR. El resultado qPCR mostraron aumentos en los niveles de AMH, cyp19a1a, nanos3 y de expresión de los vasos en 17 tejido gonadal dpf aislado en aproximadamente 397, 342, 45 y 170 veces, respectivamente (Figura 2).

Figura 1
Figura 1. microfotografías de típicos tejidos gonadales en larvas de pez cebra en 17 dpf y 25 dpf. (A) Extraer la piel y los músculos de un lado del abdomen para exponer los órganos internos bajo un microscopio estéreo de 25X. (B) Después de retirar la masa de los órganos internos, la vejiga natatoria y la gónada permanecen unidos al tronco. (B ') vista de la caja roja amplificado en el panel B para mostrar la posición relativa de la vejiga natatoria y la gónada. La gónada se indica por la flecha. (C) Iso lated tejido gonadal en 17 dpf. Los tejidos negros en la imagen (flechas) son el tejido endotelial y protonephridium unido a las gónadas. (DE) Un gran gónada antes y después de la eliminación del tejido adiposo en 25 dpf. (F) Un pequeño gónada a 25 dpf. Barras de escala: 200 m. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. niveles de expresión génica normalizadas de AMH, cyp19ala, nanos3 y vasa en los troncos y las gónadas aisló al 17 dpf. Número de animales utilizados: grupo de control, n = 15; grupo gónada, n = 35. Los tejidos del tronco en el grupo de control son sin la cabeza y las estructuras de la cola. grupo Gónada se refiere a los tejidos gonadales aisladas./files/ftp_upload/55294/55294fig2large.jpg" target = '_ blank'> Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

El pez cebra se ha convertido en un modelo de gran alcance y se utiliza ampliamente en el desarrollo y la investigación relacionada con la enfermedad. Los métodos para el aislamiento de los órganos en el pez cebra adultos, tales como cerebro, corazón, gónadas, y el riñón, se han documentado bien 23, 24, 25. Debido al pequeño tamaño y remodelación dinámica de los tejidos gonadales en el larvas de pez cebra, el aislamiento de tejido gonadal es una tarea difícil. Estudios previos utilizan enteros diseccionado los tejidos del tronco o vasa transgénico: a base de células EGFP clasificación y microdisección por láser para examinar las gónadas larvales 26. Las modificaciones del cromosoma 4 durante la domesticación hace que la determinación del sexo un misterio en el pez cebra domesticado. Nuestro método descrito aquí puede proporcionar preparaciones gónadas relativamente limpias y principios para otros exámenes morfológicos y moleculares, que puede ser útil para explorar el mech determinante del sexomeca-.

No es fácil separar la gónada en desarrollo de otras estructuras en las primeras etapas de desarrollo. Nuestro método se describe cómo realizar la disección. Para realizar con éxito este protocolo, algunos pasos críticos deben tenerse en cuenta. En primer lugar, la condición de crecimiento de larvas de pez cebra es crítico para los resultados de rendimiento esperado. El desarrollo gonadal de larvas de pez cebra es un proceso muy dinámico. El tamaño y la apariencia de los tejidos gonadales están determinados por las etapas de desarrollo de los animales 27. Es importante mantener diferentes lotes de pez cebra en condiciones estandarizadas. Los factores que pueden influir en el crecimiento de las larvas incluyen la densidad de población, la duración de ciclos de luz y oscuridad, la disponibilidad de alimentos y los horarios de alimentación. La medición de la longitud estándar de las larvas de peces puede ser utilizado como una guía para determinar el estado de crecimiento de los animales 22. Un segundo factor crítico para el éxito de isolat tejido gonadalde iones es una buena comprensión de la posición relativa y las diferencias morfológicas entre las gónadas y los tejidos circundantes. Debido a la gónada se encuentra en el lado ventral de la vejiga natatoria, es conveniente aislar inicialmente las gónadas junto con la vejiga natatoria. Además, el extremo distal de las gónadas está estrechamente unido al extremo distal del intestino. Así que uno tiene que tener cuidado al retirar la tripa de la gónada en los extremos distales. Para el análisis de la expresión génica posterior, es esencial utilizar medios pre-refrigerados y la placa de agar, y llevar a cabo todo el procedimiento rápidamente.

Un método similar con éxito ha sido utilizado por RF Ketting et al. 28. Ellos aplicaron el método de aislamiento de las gónadas para la investigación de la función de piRNAs y la vía PIWI en larvas de 3 semanas de edad. Aquí, hemos diseccionado tejido gonadal de larvas de pez cebra tan temprano como 17 dpf para explorar el perfil de expresión de identidad y el gen molecular de la Develode ping gónadas del pez cebra. análisis moleculares futuras del tejido gonadal aislado anteriormente se pueden realizar para determinar los patrones de transcriptoma, metiloma y acetilación de histonas para dilucidar los mecanismos subyacentes desarrollo sexual en el pez cebra.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no tienen intereses financieros en competencia.

Acknowledgments

Agradecemos a C Zhang para el cuidado de los peces. Este trabajo fue apoyado por la Fundación Nacional de Ciencias Naturales de China (31171074, 31371099 y 31571067 a GP) y por el Proyecto Talento Pujiang (09PJ1401900 a GP).

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics