באמצעות ביולוגיה סינתטית מהנדס תאים חיים המתממשקות חומרים לתכנות

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

מאמר זה מציג סדרה של פרוטוקולים לפיתוח תאים מהונדסים ומשטחים פונקציונליים המאפשרים מהונדס חיידק סינטטי לשלוט ולטפל משטחי חומר לתכנות.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

פתחנו ממשק אביוטי-ביוטיים המאפשר תאים מהונדסים לשלוט בתכונות החומר של משטח פונקציונלי. מערכת זו נעשית על ידי יצירת שני מודולים: זן מהונדס סינטטי של תאי חיידק וממשק חומר פונקציונלי. בתוך נייר זה, אנו פרטנו פרוטוקול עבור גנטית הנדסת התנהגויות נבחרות בתוך זן של חיידק באמצעות אסטרטגיות שיבוט מולקולריות. לאחר שפותח, זן זה מייצר רמות גבוהות של ביוטין כאשר הם נחשפים inducer כימי. בנוסף, אנו פרוטוקולי פרט ליצירת שני משטחים פונקציונליים שונים, שכל אחת מהן מסוגלת להגיב ביוטין תא-מסונתז. יחדיו, אנו מציגים מתודולוגיה ליצירה צמודה, מערכת אביוטי-ביוטיים המאפשר מהונדסת תאים לשלוט רכב חומר והרכבה על מצעים דוממים.

Introduction

כאן אנו מדווחים בנהלי פיתוח מצע לתכנות מסוגל להגיב אות כימית מן קו תא מהונדס. 1 אנו עושים זאת על ידי יצירת ממשק streptavidin ביוטין שמגיב ביוטין מיוצר על ידי coli Escherichia המהונדס סינטטי (E. coli) תאים. בעבר, משטחים לתכנות כבר מהונדסים עבור מגוון רחב של יישומים מ זיהוי הרעלן 2 ונקודה של טיפול אבחון 3 עד הגנה וביטחון. 4 בעוד משטחים לתכנות יכולים להיות שימושיים כמו חיישנים ומפעיל, הם יכולים להיעשות "חכמים" על ידי להנחיל להם את היכולת להסתגל לאתגרים סביבתיים שונים. לעומת זאת, אפילו מיקרואורגניזמים פשוטים, כגון E. coli, יש הסתגלות טמונה ומסוגלים להגיב לאתגרים עם פתרונות מתוחכמים ולעתים קרובות בלתי צפויים. הסתגלות זו אפשרה E.אוכלוסיות coli, בשליטת רשתות גנים המורכבים שלהן, חסכונית לחפש משאבים, 5 ליצור מוצרים בעלי ערך מוסף, 6 ואפילו רובוטיקה כוח בקנה מידה מיקרו. 7 על ידי צימוד היתרונות אדפטיבית של תאי חיים עם שימוש משטחים לתכנות, נוכל ליצור מצע חכם מסוגל להגיב לתנאי סביבה שונים.

ביולוגיה סינתטית נתן החוקרים יכולות חדשות כדי לתכנת את ההתנהגות של היצורים החיים. באמצעות הנדסה לתאים להכיל רשתות רגולטוריות גן חדש, חוקרים יכולים לעצב תאים כי תערוכה מגוונת של התנהגויות מתוכנות. 8, 9 מעבר מחקר בסיסי, התנהגויות אלו עשויות לשמש ליישומים כגון שליטת הרכבת חומר ביולוגי לייצר מוצרים בעלי ערך מוסף. 10 בזאת, אנו בפירוט כיצד השתמשנו בכלים של ביולוגיה סינתטית כדי engineer זן החיידק כי מסנתז ביוטין על אינדוקציה. זן זה פותח באמצעות שיטות שיבוט אנזים הגבלה להרכיב פלסמיד, pKE1-לאצי-bioB. פלסמיד זה, כאשר הפך K-12 זן E. coli MG1655, מעניק לתאים עם יכולת להביע רמות גבוהות של bioB, אנזים חיוני לסינתזת ביוטין. כאשר תאים שהשתנו היו מושרים עם איזופרופיל β-D-1-thiogalactopyranoside (IPTG) ובתנאי עם מבשר ביוטין, desthiobiotin (DTB), רמות גבוהות של ביוטין יוצרו.

האינטראקציה המחייבת של ביוטין עם streptavidin היא אחת איגרות החוב הלא-קוולנטיים החזקים המצויים בטבע. ככזה, האינטראקציה streptavidin ביוטין הוא גם היטב מאופיין והעסיק מאוד בביוטכנולוגיה. 11 בתוך כתב היד הזה, אנו מציגים שתי אסטרטגיות העסקת אינטראקצית streptavidin ביוטין לחוש ולזהות ביוטין בייצור תאים עם משטח פונקציונלי. אָנוּמתייחסים משטחים מנוגדים אלה תוכניות שליטה "עקיפה" ו "ישירה". בתכנית השליטה העקיפה, ביוטין-מיוצר תא מתחרה עם ביוטין כי כבר מצומדות ו משותק על משטח קלקר streptavidin אתרי קישור. בנוסף, streptavidin הוא מצומדות עם peroxidase חזרת (HRP). HRP משנה 3, 3 ', 5, 5'-tetramethylbenzidine (TMB), להפקת אותות אופטיים, 12 אשר עשוי להיות במעקב על ידי לכימות ספיגת ספקטרלי (כלומר, צפיפות אופטית) ב -450 ננומטר (OD 450). לפיכך, את ערכת השליטה העקיפה מאפשרת לחוקרים למדוד ביוטין בייצור תאים על ידי ניטור attentuation של אות OD 450.

ערכת השליטה הישירה מנצלת את האירוע ביוטין-streptavidin על ידי streptavidin משתק ישירות משטח חומר ומאפשר ביוטין תא-פיק biotinylated HRP להתחרות על streptavidin אתרי קישור. שוב,רמות יחסיות של ביוטין בייצור התאים מנוטר על ידי מדידת אות OD 450.

יחדיו, התאים המהונדסים משטחים פונקציונליים מאפשרים לנו לשלוט על התכונות של משטח לתכנות על ידי גרימת רשתות בתאים חיים. במילים אחרות, יצרנו מערכת שמנצלת את יכולת ההתאמה של היצורים החיים ואת אמינות מפרט של ממשק חומר מהונדס ידי קישור המערכות הללו יחד.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. מדיה והכנה תרבות

  1. כן lysogeny מרק (LB) בתקשורת על ידי ערבוב 25 גרם של מניית אבקת LB עם 1 ליטר של deionized (DI) מי מעוקר הפתרון ב 121 מעלות צלזיוס במשך 20 דקות לעקר.
    1. כדי להכין צלחות LB, להוסיף 15 גרם אגר (1.5%) לתקשורת LB לפני עיקור
    2. הכינו מלאי של פתרונות 1,000x carbenicillin (Cb) במים DI (50 מ"ג / מ"ל).
    3. אם הכנת תקשורת LB הכוללת אנטיביוטיקה לבחירת transformants העמיד, לחכות עד לטמפרטורה של LB התקשורת המעוקרת היא מתחת ל -60 מעלות צלזיוס, ולאחר מכן להוסיף 1 μL של מניית אנטיביוטיקה לכל מיליליטר תקשורת של LB 1.
  2. עבור תקשורת המינימאלית M9 (טבלה 1), להכין פתרונות מניות נפרדים מהפעולות הבאות: מלחים 5X M9 (L / 56.4 גרם), 1 M 4 MgSO, 1 M CaCl 2, 20 גלוקוז%, וחומצות casamino 2% חינם ביוטין.
    1. בשנת בקבוק בטוח חיטוי, לשלב 20 מיליליטר של מלחים 5x M9, 200 &# 181; L של 1M MgSO 4, 10 μL של 1 2 M CaCl, 2 מ"ל של גלוקוז 20%, 1 מ"ל של 2% חומצות casamino ללא ביוטין, ו 76.8 מ"ל מים DI.
    2. חיטוי הפתרון מוכן בשלב 1.2.1 ב 121 מעלות צלזיוס במשך 20 דקות.
  3. דגירה כל התרבויות על 37 מעלות צלזיוס עם תסיסה ב 400 סל"ד. פעמי דגירה משתנות בהתאם ניסוי ומתח, אבל בדרך כלל להימשך בין 8 כדי 12 שעות.

2. הדור של E. ביוטין הפקת E. (פלסמיד pKE1-לאצי-bioB)

הערה: המעגל הגנטי מכיל שני חלקים: מדכא לאצי, מונע על ידי L P, TETO-1 האמרגן וכתוצאה מכך ביטוי המכונן בשל העדר של חלבון מדכא tetR, כמו גם מערכת ביטוי ביוטין המכיל את P TRC-2 אמרגן ואחריו אתר קישור הריבוזום חזק (RBS) נהיגת ביטוי bioB. כל שיבוט הוצא להורג בתוך stra coli מסחרי, המתחלקים במהירות E.ב. הפך הבונה הסופי לתוך E. coli MG1655WT לבדיקה. Primers (טבלה 2) נרכש מסחרי.

  1. לבודד גן bioB מן הגנום החיידק על ידי ביצוע תגובת שרשרת פולימראז כל תא (PCR):
    1. לגדול E. coli תאים MG 1655WT לילה בשעה 37 ° C.
    2. בתוך צינור 0.2 מ"ל PCR, לשלב 1 μL של תרבות לילה מוכן בשלב 2.1.1 עם 9 μL של מים די סטרילי.
    3. דגירה הצינור ב 95 מעלות צלזיוס למשך 5 דקות בתוך thermocycler ומיד להעביר את הצינור כדי במקפיא -80 מעלות צלזיוס במשך 10 דקות כדי lyse התאים. זה מאפשר הדנ"א הגנומי כדי לשמש כתבנית PCR.
    4. להפשיר את הפתרון ולהוסיף (i) 2.5 μL כל אחת פריימרים nBioB2-F1 ו nBioB2-r, (ii) 5 μL של חיץ פולימראז 5x DNA, (iii) 0.25 μL של DNA פולימרז, (iv) 0.5 μL של תמהיל dNTP , ו (v) 6.75 μL של מי DI עבור נפח תגובה כולל של 25 μL(לוח 4).
    5. מכה על דופן (כלומר, קפיצי) הצינור לערבב את תוכנו. לאחר מכן, מייד לסובב את הצינור במהירות (~ 2 ימים) על מנת להבטיח את המדגם הוא בתחתית של התחתית.
    6. מניח את הצינור ב thermocycler PCR ולהשתמש התכנית מתוארת בטבלה 3 עם צעד נוסף של 3 דקות ב 95 מעלות צלזיוס בתחילת הפרוטוקול.
    7. אשר ג'ל אלקטרופורזה באמצעות PCR מוצלח (1.0 - 1.2% agarose במים DI + ethidium ברומיד) ב טריס בסיס, חומצה אצטית, ו חיץ EDTA (TAE). מוצר PCR צריך להיות 1,070 basepairs (נ"ב) ארוך.
    8. השתמש ערכות מסחריות לפי הוראות היצרן כדי לחלץ קטעי דנ"א מן ג'ל משלב 2.1.7.
  2. לבודד את האמרגן P TRC-2 ואת אופרון לאצי מן הפלסמיד pKDL071 13 (באדיבות המעבדה של ג'יימס קולינס ב- MIT):
    1. לגדל תאי E. coli המכיליםהפלסמיד pKDL071 לילה LB + Cb על 37 מעלות צלזיוס.
    2. חלץ את ה- DNA פלסמיד מן התאים באמצעות ערכת miniprep מסחרית על פי הוראות היצרן. הפלסמיד ישמש כתבנית PCR.
    3. פעל על פי פרוטוקול ה- PCR מצעדים 2.1.4. כדי 2.1.8. בשינויים הבאים:
    4. חלף תאי lysed עם תמצית פלסמיד בשלב 2.2.2.
    5. השתמש 2.5 μL כל אחד פריימרים 1-F ו- 1-r להפקת קלטת לאצים. לחילופין, להשתמש 2.5 μL כל אחד פריימרים nBioB1-F ו- nBioB1-r להפקת P TRC-2.
    6. בצע ג'ל אלקטרופורזה (שלב 2.1.7) כדי לאשר את מוצרי ה- PCR הם קלטת לאצי ו- P אתר מקדם TRC-2. הם צריכים להיות 1213 נ"ב ו -109 נ"ב ארוכים, בהתאמה.
  3. השתמש שחבור ובהרחבה חפיפה (SOE) PCR לבנות את הקלטת bioB המכיל P TRC-2, אתר מחייב הריבוזום סינתטי (RBS) ב פריימר nBioB2-f2, ואת bioB בטבלה 3.
  4. בונה הכנס (P L, TETO-1 + לאצי ו- P TRC-2 + bioB) לתוך 13 עמוד השדרה וקטור הפלסמיד pKE1-MCS (באדיבות המעבדה של ג'יימס קולינס ב- MIT) על ידי לעכל את וקטור והכנס עם אנזימי הגבלה:
    1. חלץ גנים באמצעות אנזימי הגבלה ו ג'ל אלקטרופורזה. התגובה של כל מכיל (i) 5 μL של חיץ התגובה 10x, (ii) 1 μL של אנזים הגבלה 1, (iii) 1 μL של הגבלה האנזים 2, (iv) לפחות 1 מיקרוגרם של ה- DNA, ו (v) DI מים להביא את הנפח הסופי 50 μL (לוח 5). לעכל עם אנזימי AatII ו EcoRI עבור הקלטת לאצים ועם אנזימי HindIII ו SacII עבור קלטת bioB.
    2. לאחר התגובות מורכבות, במהירות מערבולת אותם צנטריפוגות בקצרה (~ 2 s) לפני הדגירה של 1 ש 'על 37 מעלות צלזיוס.
    3. בְּמַהֲלָךעיכול, להכין ג'ל אלקטרופורזה על פי פרוטוקולים סטנדרטיים.
    4. שלב ה- DNA מתעכל עם חיץ טעינת 6x ג'ל אלקטרופורזה.
    5. השתמש סולם 2-יומן כדי לאמת מיקום של מבנה רצוי, לחתוך קטע DNA מן הג'ל, ולהשתמש ערכות חילוץ ג'ל מסחריות לפי הוראות היצרן כדי לחלץ קטעי דנ"א מן הג'ל.
  5. לכמת DNA באמצעות ספקטרוסקופיית ולחשב כרכים עבור 0: 1, 1: 1, ו -3: 1 יחסים טוחנים של כנס וקטור באמצעות משוואה 1:
    משוואה 1 משוואה 1
    במשוואה 1, M הוא היחס של הכנס כדי וקטור (0, 1, או 3), אני X הוא כמות ה- DNA להוסיף, נ"ב אני הוא אורך את התותב זוגות בסיסים, נ נ"ב הוא אורך של וקטור ב basepairs, ו- V X הוא כמות וקטור (50 נ"ג).
  6. מערבבי תגובת קשירה ידי שילוב (i) 1 μL 10X אנזים הצפה, (ii)1 μL T4 האנזים, (iii) DNA וקטור 50 ng, (iv) מסה של DNA הכנס ספציפי לכל תגובה, ו- (v) מים די כדי 10 μL התגובה הכולל נפח (לוח 6).
  7. דגירה בטמפרטורת החדר (RT) במשך שעה 1.
  8. במהלך דגירת הקשירה בשלב 2.7, להכין תאים מוסמכים כימי.
    1. Aliquot 1 מ"ל של תרבויות לילה לתוך צינורות צנטריפוגות 1.5 מ"ל.
    2. צנטריפוגה ב 16,200 XG דקות 1.
    3. למזוג supernatant ו resuspend גלולה ב 200 μL של קר (על הקרח) 100 מ"מ CaCl 2. Resuspend את הכדור על ידי pipetting בעדינות. לא מערבולת.
    4. מניחים את הצינור microcentrifuge על קרח למשך 10 דקות.
    5. צנטריפוגה, להסיר את supernatant, resuspend גלולה ב 100 μL של 100 מקורר מ"מ CaCl 2, ולמקם את הצינור על הקרח שוב.
    6. צנטריפוגה הצינור בפעם האחרונה, resuspend גלולה ב 50 μL של 100 מקורר מ"מ CaCl 2.
    7. מקוםהצינור על קרח ולהשתמש התאים מוסמכים הכימי מייד.
  9. הוסף 5 μL של ה- DNA ligated, ערוכי צעדים 2.6 ו -2.7, על צינור אחד של תאים מוסמכים, מוכנים בשלב 2.8.
  10. להתסיס את הצינור בקצרה על ידי מכה בצד (כלומר מצליף) הצינורות ולאחר מכן למקם את הצינורות על קרח למשך 30 דקות.
  11. מחממים לזעזע צינורות במשך 45 שניות על 42 מעלות צלזיוס ולהחזיר את צינורות קרח במשך 2 דקות.
  12. תאי פיפטה על אגר LB סלקטיבי + צלחות אנטיביוטיות ולהפיץ את התאים באמצעות חרוזי זכוכית ציפוי.
  13. דגירת צלחות הלילה ב 37 מעלות צלזיוס.
  14. למחרת בבוקר, פיק מושבות מצלחות כנס חיובי (כלומר, 1: 1 ו -3: 1 צלחות). פיק 3 מושבות אם 0: צלחת הביקורת השלילית 1 לא מראה צמיחה, או לבחור 5-8 מושבות אם 0: צלחת 1 יש כמה צמיחה. השתמש מושבות הרים לחסן 5 מ"ל LB + אנטיביוטי ולגדול במשך 8 שעות ב 37 מעלות צלזיוס עם תסיסה.
  15. חלץ את ה- DNA פלסמיד מן התאים באמצעות miniprערכת EP, בעקבות הוראות היצרן. בצע חתך בדיקה באמצעות אנזימי הגבלה (בעקבות אותו הנוהל המפורט בשלב 2.4.1.).
  16. לזהות תאים עם בונה מוצלחת ידי השוואת אורך קטעי דנ"א מתעכלים עם התוצאות הצפויות מן הקונסטרוקציה נכונה. תרבויות נושאת בונת פלסמיד מוצלחת עשויות להישמר על ידי ערבוב תרבות בחלקים שווים עם תמיסה של גליצרול סטרילי, מסונן, 40% (במי DI) והקפאת התערובת ב -80 מעלות צלזיוס.
    הערה: טרנספורמציות של פלסמידים לתוך זני E. coli אחרים (כלומר, MG1655WT) ניתן להשיג על ידי ביצוע ההליך הנ"ל להכנת תאים מוסמכים כימי.

3. תא אפיון: עקומת צמיחה ו מנת תגובה

  1. לגדול זנים מהונדסים לילה בתקשורת LB עם אנטיביוטיקה מתאימה.
  2. עבור עקומות גדילה, להכין 50 מ"ל של התקשורת M9 מינימלי עם ובלי IPTG (מתוך 0.5 M יםטוק) ו / או DTB (ממלאי 500 מיקרוגרם / מ"ל) כדלקמן:
    1. הכן 0 ng / mL DTB (0 μL של המניה) / 0 מ"מ IPTG (0 μL של המניה).
    2. הכן 200 ng / mL DTB (200 μL של המניה) / 0 מ"מ IPTG (0 μL של המניה).
    3. הכן 0 ng / mL DTB (0 μL של המניה) / 0.5 מ"מ IPTG (50 μL של המניה).
    4. הכן 200 ng / mL DTB (200 μL של המניה) / 0.5 מ"מ IPTG (50 μL של המניה).
    5. לחסן עם התרבות לילה בשעה 1: 100 בתקשורת שצוין לעיל.
    6. צלחת 96-היטב, aliquot 200 μL של התרבות, בשלושה עותקים, זה טוב.
    7. מדוד OD 600 כל 5 דקות במשך 24 שעות עם רעד דגירה רציפים ב 37 מעלות צלזיוס קוראת צלחת.
  3. עבור מחקרי מנת תגובה, להחליף את גן bioB ב pKE1-לאצים-bioB עם mCherry (חלבון פלואורסצנטי אדום) כימות אופטי בזמן האמת.
  4. להוסיף כמויות משתנות של IPTG החל 0.1 מ"מ עד 5 מ"מ כדי לגרום ביטויבתקשורת LB.
  5. לחסן עם תרבות הלילה בדילול של 1: 100.
  6. מדוד קרינה כל 30 דקות במשך 15 שעות.

4. גרימה ביוטין ייצור מתאי מהונדסים והכנת Supernatant

  1. לגדול pKE1-לאצי-bioB בזן העכברים MG1655 E. coli לילה בתקשורת LB.
  2. מוסף תקשורת M9 עם DTB הנע בין 30 כדי 200 ng / mL.
  3. הוסף 0.5 מ"מ IPTG לגרום סינתזה ביוטין.
  4. לחסן שתושלם, תקשורת M9 מינימאלית ללא ביוטין עם תרבות לילה בשעת 1: 100 דילול.
  5. לאחר 24 שעות של צמיחה, תאים צנטריפוגות לאסוף את supernatant מועשר ביוטין.
  6. מדוד supernatant מועשר ביוטין עם השליטה העקיפה ואת משטחים פונקציונליים השליטה הישירה. השתמש supernatant במקום של המדגם ביוטין בצעדים 5.23 ואת 6.12, בהתאמה.

5. הכנת תכנית פונקציונלית משטח שליטה עקיפה

  1. כן הדואר בא פתרונות.
    1. הכן פתרון SMCC המורכב 20 מ"ג / מ"ל ​​של succinimidyl טרנס-4- (maleimidylmethyl) cyclohexane-1-carboxylate (SMCC) ב sulfoxide דימתיל (DMSO).
    2. הכן פתרון SPDP המורכב 20 מ"ג / מ"ל ​​של succinimidyl 3- (2-pyridyldithio) propionate (SPDP) ב DMSO.
    3. הכן 20 מ"ג / מ"ל ​​LC-LC-ביוטין ב DMSO.
    4. הכן 10 מ"ג / מ"ל ​​peroxidase חזרת (HRP) ב בופר פוספט (PBS).
    5. הכן 10 מ"ג / מ"ל ​​streptavidin (SA) ב PBS.
    6. הכן 10 מ"ג / מ"ל ​​בסרום שור אלבומין (BSA) ב- PBS.
    7. הכן 100 מ"מ dithiothreitol (DTT) במים DI.
    8. כן 5 מ"מ חומצת ethylenediaminetetaacetic (EDTA) ב- PBS.
    9. כן קזאין 0.5% ב- PBS.
    10. הכן 20% Tween 80 מניות במי DI.
    11. כן 0.05% 80 Tween (מ -20% מניות) ב- PBS.
    12. הכן 50 מ"מ של נתרן אצטט במים DI.
    13. כן 1% TMB ב DMSO.
    14. כן 3% H 2 O 2 iמים די n.
    15. כן 2 MH 2 4 SO במי DI.
  2. להוסיף 1.4 μL של פתרון SPDP 20 פתרון μL SA.
  3. דגירת הפתרון מ -5.2 ל -1.5 שעות ב RT, עטוף בנייר אלומיניום, כדי להימנע מחשיפה לאור. צעד זה מאפשר crosslinker SPDP אג"ח ל SA באמצעות קבוצת האמין ויצרה SA מופעל pyridyldithio.
  4. להוסיף 2.4 μL של פתרון DDT לפתרון משלב 5.3 ו דגירה של 1 ש 'ב RT. זה מאפשר מחשוף פירידין 2-thione, וכתוצאה מכך SA המופעל sulfhydryl.
  5. להוסיף 7.5 פתרון μL SMCC 72 פתרון μL HRP דגירה במשך 1.5 שעות ב RT, עטוף בנייר אלומיניום, כדי להימנע מחשיפה לאור. התוצאה היא HRP maleimide המופעל כבול קבוצת אמינו.
  6. מערבבים 17 פתרון μL LC-LC-ביוטין עם 200 פתרון μL BSA ו דגירה של 1.5 שעות ב RT, עטוף בנייר אלומיניום, כדי להימנע מחשיפה לאור. שלב זה מאפשר ביוטין המצומד tBSA o באמצעות אג"ח אמיד.
  7. מעבירים את פתרונות מצעדים 5.4, 5.5 ו -5.6 להפריד ריכוז צנטריפוגלי בתוך צינורות ספין.
  8. עבור צינורות המכילים SA-SPDP, משלב 5.4, צנטריפוגות ב XG 10,000 עד נפח הצינור מגיע ל -100 μL או במשך 16 דקות. מלאו את צינור ספין 500 μL עם PBS-EDTA.
    1. 5.8 חמש פעמים חזור על שלב. אחסן את המניה ב 4 מעלות צלזיוס.
  9. עבור צינורות המכילים HRP-SMCC, משלב 5.5, צנטריפוגות ב XG 10,000 עד נפח מגיע 25 μL או במשך 16 דקות. מלאו את צינור ספין 500 μL עם PBS.
    1. 5.9 חמש פעמים חזור על שלב. אחסן את המניה ב 4 מעלות צלזיוס.
  10. עבור צינורות המכילים BSA ביוטין, משלב 5.6, צנטריפוגות ב XG 10,000 עד נפח מגיע ל -100 μL או במשך 12 דקות. מלאו את צינור ספין 500 μL עם PBS.
    1. 5.10 ארבע פעמים חזור על שלב.
    2. צנטריפוגה ב XG 10,000 עד נפח מגיע ל -100 μLאו במשך 12 דקות. הוספת 100 μL של PBS על הצינור. אחסן את המניה ב 4 מעלות צלזיוס.
  11. הוסף 25 μL של פתרון HRP 10 מ"ג / מ"ל עם 25 μL של 10 מ"ג / פתרון SA מ"ל ולאחסן ב 4 מעלות צלזיוס למשך הלילה. זה גורם SA להפוך מצומדות עם HRP באמצעות אג"ח thioether.
    1. כן 1: פתרון עובד 4 עם הפתרון ולאחסן לילה 4 ° C במקרר. פתרון הנותרים חנות ב -20 מעלות צלזיוס.
  12. כן שני פתרונות מורכבים BSA-ביוטין (או BSA) ב- PBS, על ידי הוספת 10 μL של מניית BSA ביוטין (או 10 מניות μL BSA) 490 μL של PBS.
  13. הוספת 100 μL של הפתרון משלב 5.12 היטב בכל צלחת קלקר 96-היטב.
  14. דגירה את הצלחת על 37 מעלות צלזיוס במשך שעה 1, עטופה בנייר כסף.
  15. שטוף את הבארות צלחת עם 0.05% Tween 80.
    1. הוספת 200 μL של 0.05% PBS-Tween 80 בארות. דגירה של 2 דקות ב RT. למזוג את הנוזל.
    2. <li> חזור על שלב 5.15.1 שלוש פעמים.
  16. הוספת 200 μL של פתרון קזאין 0.5% לכל אחת מן הבארות בצלחת 96-היטב.
  17. דגירה את הצלחת על 37 מעלות צלזיוס במשך שעה 1.
  18. חזור על שלב 5.15 לשטוף את הבארות שלוש פעמים.
  19. הכן פתרון על ידי ערבוב 12 מ"ל של תמיסת קזאין 0.5% עם 7.5 μL של 0.05% Tween 80.
  20. לדלל את מניות SA-HRP 1: 10,000 באמצעות הפתרון מוכן בשלב 5.19.
  21. הוסף 80 μL של פתרון מוכן בשלב 5.20 היטב בכל צלחת 96-היטב.
  22. הוסף 20 μL של המדגם ביוטין המוכן היטב בכל צלחת הקלקר. את supernatant ערוך 4.6 יכול לשמש מדגם ביוטין בשלב זה.
  23. דגירה את הצלחת על 37 מעלות צלזיוס במשך שעה 1. צעד זה מאפשר תחרותי מחייב בין ביוטין בחינם לשתק BSA ביוטין עבור אתרי הקישור SA-HRP.
  24. חזור על שלב 5.15 לשטוף את הבארות שלוש פעמים.
  25. מערבבים 50 מ"מ פתרון נתרן אצטט, פתרון 1% TMB,ו -3% H 2 O 2 פתרון בכל 1,000: 10: יחס 1 (20 נפח הכולל מיליליטר).
  26. הוספת 200 μL של הפתרון משלב 5.25 היטב כל ולאפשר לשבת במשך 15 דקות ב RT, מכוסה בנייר כסף.
  27. הוסף 50 μL של 2 MH 2 SO 4 היטב כל כדי לעצור את התגובה. מדוד OD 450 באמצעות קורא צלחת.

6. הכנת פני שטח הפונקציונלית Scheme שליטה ישירה

  1. הכן את הפתרונות הבאים.
    1. הכן 20 מ"ג / מ"ל ​​LC-LC-ביוטין ב DMSO.
    2. הכן 10 מ"ג / מ"ל ​​HRP ב PBS.
    3. כן 0.17 מיקרוגרם / מיליליטר SA ב PBS.
    4. כן קזאין 0.5% ב- PBS.
    5. הכן 20% Tween 80 מניות במי DI.
    6. כן 0.05% 80 Tween (מ -20% מניות) ב- PBS.
    7. הכן 50 מ"מ של נתרן אצטט במים DI.
    8. כן 1% TMB ב DMSO.
    9. כן 3% H 2 O 2 במי DI.
    10. כן 2 MH 2 SO 4 DI.
  2. להוסיף 7.5 μL LC-LC-ביוטין 72 μL HRP לדגור על 1.5 שעות ב RT, עטוף בנייר אלומיניום, כדי להימנע מחשיפה לאור. צעד זה גורם ביוטין המצומד כדי HRP באמצעות אג"ח אמיד.
  3. מעבירים את הפתרון משלב 6.2 על concentrator צנטריפוגלי בתוך צינור ספין
    1. צנטריפוגה הפתרון ב XG 10,000 עד נפח מגיע ל -100 μL או במשך 12 דקות. מלאו את צינור ספין 500 μL עם PBS וחזור על צנטריפוגה בנוסף PBS ארבע פעמים. אחסן את המניה ב 4 מעלות צלזיוס.
  4. מוסיפים את 100 μL של פתרון SA מ 6.1.3 היטב כל בתוך צלחת קלקר 96-היטב.
  5. דגירה את הצלחת על 37 מעלות צלזיוס במשך שעה 1, עטופה בנייר כסף.
  6. שטוף את הבארות צלחת עם 0.05% Tween 80.
    1. הוספת 200 μL של 0.05% Tween 80 בארות. דגירה של 2 דקות ב RT. למזוג את הנוזל.
    2. חזור 6.6.1 שלוש פעמים.
  7. הוספת 200 μL של פתרון קזאין 0.5% לכל אחת מן הבארות בצלחת 96-היטב.
  8. דגירה את הצלחת על 37 מעלות צלזיוס במשך שעה 1.
  9. צעד 6.6 חזור שלוש פעמים כדי לשטוף את הבארות.
  10. לדלל את המניות ביוטין-HRP 1: 10,000 באמצעות פתרון מוכן בשלב 6.3.
  11. הוסף 80 μL של פתרון מוכן בשלב 6.10 היטב בכל צלחת 96-היטב.
  12. הוסף 20 μL של המדגם ביוטין המוכן היטב בכל צלחת הקלקר. את supernatant ערוך 4.6 יכול לשמש מדגם ביוטין בשלב זה.
  13. דגירה את הצלחת על 37 מעלות צלזיוס במשך שעה 1. צעד זה מאפשר תחרותי מחייב בין ביוטין בחינם ביוטין-HRP עבור אתרי קישור SA משותקות.
  14. חזור על שלב 6.6 כדי לשטוף את הבארות שלוש פעמים.
  15. מערבבים 50 פתרון נתרן אצטט מ"מ, פתרון 1% TMB, ו -3% H 2 O 2 פתרון בכל 1,000: 10: יחס 1 (20 הנפח הכולל מ"ל).
  16. הוספת 200 μL של הפתרון משלב 6.15 זה טוב דגירה במשך 15 דקות ב RT, מכוסה בנייר כסף.
  17. הוסף 50 μL של 2 MH 2 SO 4 פתרון זה טוב כדי לעצור את התגובה. מדוד OD 450 באמצעות קורא צלחת.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

תוצאות נציגים מוצגות חמש דמויות המצורפות. ראשית, אנו מציגים את תהליך השיבוט גרפי (איור 1), כך שהקורא יכול חזותי בצע את השלבים הקריטיים ליצירת זן החיידק המהונדס הסינטטי. על מנת לאפיין את הדינמיקה באוכלוסייה של התאים, אנו מספקים עקומת צמיחה (איור 2) שנוצרה על ידי מדידת הצפיפות האופטית ב 600 ננומטר (OD 600) של האוכלוסייה. לאחר מכן, אנו מראים כיצד לרשת גן בקרה מאומתת, באמצעות mCherry כמדד bioB (איור 3), מה שמאפשר לנו למדוד אופטית לכמות היחסית של bioB הצריכה להיווצר על ידי התא על אינדוקציה עם IPTG. בשלב בא, אנו מציגים נתונים בתגובה על הבקרה-העקיפה משטחים פונקציונליים ישירה שליטים. מגרשי נתונים אלה (איור 4) שפותחו באמצעות פתרונות נמדדים של חינםביוטין לאפיין את הפרופילים לתשובת המשטחים הפונקציונליים. לבסוף, אנו מציגים נתונים מאפיינים מראים כיצד התאים המהונדסים הם המושרה לייצר ביוטין (איור 5), ובכך שינוי המשטחים הפונקציונליים.

איור 1
איור 1: עיצוב ובנייה של מושרת, תאים מהונדסים. Primers (א) נועד לבודד את גן bioB מן הגנום E. coli, אשר מקודד אנזים חיוני במסלול הסינתזה ביוטין. (ב) L P, TETO-1 ו -lacI P רצפי TRC-2 יכולים להיות מבודדים פלסמיד המכיל מתג למתג גנטי עם פריימרים מקבילים. (C) גן bioB החילוץ ושני הקטעים מתוך במתג לאחר מכן ניתן להשתמש כדי ליצור את מעגל הגן. התוספת של IPTG אז יכול indתחיקת הבעת bioB וסינתזה ביוטין ובכך כאשר DTB מתווסף כמו מצע עבור bioB. (ד) הפלסמיד התאספו הפך K-12 MG1655 E. coli. זה גרם בנוכחות IPTG להשרות את הביטוי של bioB וסינתזה ביוטין ובכך ידי שורת תאים מהונדסים כאשר DTB סופק כמצע. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2: עקומות גדילה עבור תאים מהונדסים. המהונדס, מושרת MG1655 wild-type התאים בגרו פיקוח תקשורת מינימאלית (כלומר, ביוטין ללא מדיה M9), כמו גם תקשורת מינימאלית השלימה עם DTB (200 ng / mL) ו / או IPTG (0.5 מ"מ). המגרשים להראות קריאה OD 600, נמדד כל 5 ק"מ n במשך 24 שעות. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3: בדיקת רשת Engineered ג'ין. חלבון פלואורסצנטי mCherry שימש במקום bioB גן כדי שנוכל אופטי יכול למדוד את פרופיל האינדוקציה כאשר תאים מהונדסים היו מושרים עם IPTG. אנו בניגוד לתאים מושרים עם IPTG (יהלומים אדומים) עם התאים לא מושרה עם IPTG (יהלומים כחולים). תוצאות אלו מראות את היעילות של רשת הגנים המושרית. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

/55300/55300fig4.jpg "/>
איור 4: אימות של ממשק החומר הפונקציונלי. על ידי חשיפת המשטח הפונקציונלי שלנו ריכוזים שונים של ביוטין, אנו מסוגלים למדוד את התגובה האופטית על ידי מדידת OD 450 ספיגים. תוצאות אלו מאפשרות לנו ליצור עקומת כיול, המקשרות את הריכוז של ביוטין לעוצמת האופטית של התגובה. כאן, אנו מציגים ביוטין לעומת עקומות אות אופטיות היא עקיף (משמאל) וישיר (מימין) תוכניות המשטח פונקציונליים. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 5
איור 5: תאים מהונדסים שליטה ממשק חומר. על ידי ניצול סעיפי פרוטוקול 5 או 6, אנו מסוגלים להשתמש במוצרים של מושרה, ג מהונדסאמות כדי לשנות את פני השטח הפונקציונליים כימיות. אנחנו יכולים לעקוב אחרי התגובות האלה אופטיות ידי מדידת OD 450. יתר על כן, באמצעות עקומת הכיול שפותחה באיור 4, אנו יכולים לקשר את העוצמת האופטית של התגובה ביוטין בתוך הריכוז. אנו מציגים כאן את הריכוזים ביוטין השונים, שהיא נמדדות על ידי המשטח פונקציונלי ערכת השליטה העקיפה שלנו, עבור wild-type תאים (לבן), תאי uninduced המכילים את הפלסמיד pKE1-לאצים-bioB (כתום), ותאי מושרה המכילים את pKE1-לאצים-bioB פלסמיד (אפור). אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

כִּימִי ריכוז סופי כמות
מלחי 5x M9 1x 20 מ"ל
1 M MgSO 4 2 מ"מ 200 μL
1 M CaCl 2 0.1 מ"מ 10 μL
גלוקוז 20% 0.40% 2 מ"ל
2% חומצה Casamino ללא ביוטין 0.02% 1 מ"ל
מי DI N / A 76.8 מ"ל

טבלה 1: מתכון מדיה M9.

שֵׁם רצף פריימר נוֹהָג
1-f CCGCCGGAATTCTCCCTATCAGTGATAGAGATT מיצוי קלטת לאצים
1-r CCGACGTCTCACTGCCCGCTTTCCAGTC מיצוי קלטת לאצים
nBioB1-f CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT מיצוי P TRC-2
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT מיצוי P TRC-2
nBioB2-F1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG מיצוי bioB
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC מיצוי bioB
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC בנוסף RBS סינתטי

טבלה 2: רשימת פריימרים.

> שלב 1
שלב 2 שלב 3 שלב 4 שלב 5 שלב 6 שלב 7 שלב 8 שלב 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
00:30 00:10 00:30 01: 00 / kb 00:10 00:30 01: 00 / kb 02:00
חזור 12 פעמים חזור 25 פעמים
-1 ° C / מחזור

er.within-page = "1"> טבלה 3: תוכנית ה- PCR.

שֵׁם כֶּרֶך
Cell Lysate (תבנית) 10 μL
פריימר (ליחידה) 0.625 μL (ליחידה)
חיץ Q5 5x 5 μL
פולימראז Q5 0.25 μL
dNTP Mix 0.5 μL
מי DI 6.75 μL

לוח 4: שלמות תא תגובת PCR (25 μL).

שֵׁם כֶּרֶך
10 x חיץ תגובה 5 μL
אנזים 1 1 μL
אנזים 2 1 μL
DNA תבנית 1 מיקרוגרם
מי DI 43 μL - נפח של ה- DNA

לוח 5: הגבלת תגובת עיכול האנזים (50 μL).

שֵׁם כֶּרֶך
DNA 50 מיקרוגרם וקטור + X מיקרוגרם הכנס
10x אנזים הצפה 1 μL
T4 אנזים 1 μL
מי DI 8 μL - נפח של ה- DNA

יפ-together.within-page = "1"> לוח 6: תגובת קשירה (10 μL).

שֵׁם ריכוז הערות
CaCl 2 100 מ"מ
Carbeniccilin 50 מ"ג / מ"ל ​​(1000x)
DTB 50 מיקרוגרם / מ"ל
IPTG 0.5 M
SMCC 20 מ"ג / מ"ל 2 מ"ג לתוך 100uL DMSO
SPDP 20 מ"ג / מ"ל 2 מ"ג לתוך 100uL DMSO
LC-LC-ביוטין 20 מ"ג / מ"ל 2 מ"ג לתוך 100uL DMSO
HRP 10 מ"ג / מ"ל ב PBS
SA (בעקיפין) 10 מ"ג / מ"ל ב PBS
SA (ישיר) 0.17 מיקרוגרם / מ"ל ב PBS
BSA 20 מ"ג / מ"ל ב PBS
DTT 100mm ב DI מים
EDTA 5 מ"מ 18.6 מ"ג ל -10 מ"ל PBS
קזאין 0.50% ב PBS
Tween 80 20% ב DI מים
Tween 80 ב PBS 0.05%
אצטט נתרן 50 מ"מ במים DI, התאם ל -5.1 pH באמצעות 3 M HCl
TMB 1% ב DMSO
H 2 O 2 3% ב DI מים
H 2 SO 4 2 M ב DI מים

page = "1"> לוח 7: רשימת פתרונות המגיבים.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

הצגנו אסטרטגיה חדשה עבור התממשקות תאים מהונדסים חיים עם משטח חומר פונקציונלי. הדבר זה הושג על ידי פיתוח קו תא מסוגל לסנתז רמות גבוהות של ביוטין כאשר מושרה עם IPTG. הרמות הגבוהות של ביוטין יכולות לשמש כדי לשנות את פני השטח הפונקציונליים. הפרוטוקולים המפורטים כיצד להנדס את שורת תאי E. coli וכיצד ליצור שני משטחים פונקציונליים שונים.

צעדים קריטיים בפרוטוקול זה להתרחש לאורך כל הבנייה של הקו הסלולרי המהונדס. כדי למנוע בעיות במורד הזרם, המאפיינת את זני תאים מהונדסים עם שתי עקומות גדילה (איור 2) ותגובה ניאון (איור 3) מומלץ. האם בעיות פרוצדורליות להתעורר, אסטרטגיות שיבוט מולקולרי אחרות, כגון מיצוי PCR וגיבסון הרכבת 14, עשויות להיות תחליף צעדים במידת צורך. עבור אופטימיזציה של ביוטין Yield של הקו הסלולרי המהונדס, זה חיוני כדי להבטיח כי כמות מספקת של DTB מסופקת על התאים. במחקרים שלנו, מצאנו כי 200 ng / mL DTB שהושר גידול משמעותי סטטיסטית משמעותי בייצור ביוטין כאשר תאים היו מושרים עם IPTG. בנוסף, נטייה מוצלחת של BSA-ביוטין, SA-HRP, ו ביוטין-HRP היא חיונית לביצוע ביעילות וניטור תוכניות שליטה העקיפה וישירות. תשמור על עצמך כדי להימנע מחשיפה מיותרת לאור ולאפשר conjugates כדי לדגור לילה ב 4 ° C כדי להבטיח המצומד יעיל נוצר.

הפרוטוקול שלנו מציע יתרונות על פני שיטות חלופיות 15 בשל יכולתה לזהות כמויות קטנות של ביוטין שרלוונטיים ביולוגי (בסולם pg / mL) לעומת ערכות זיהוי ביוטין זמינות מסחרי, כגון אלו המבוססים על 4'-hydroxyazobenzene-2-קרבוקסיליות חומצה אסטרטגיות מחייב תחרותיות. למרות באמצעות ביו-streptavidinמערכת פח נפוצה בביוטכנולוגיה 16, 17, היכולת של המערכת שלנו להגיב כמויות קטנות של ביוטין מאפשרת לנו לקשר שורת התאים שלנו ישירות המהונדסת הגנטי עם המשטח הפונקציונלי.

הגבלת פוטנציאל אחד הפרוטוקול שלנו היא הטווח דינמי כתוצאה של זיהוי ביוטין. ב תוכניות שליטה עקיפה וישירה, אנו מסוגלים לזהות ביוטין בין 10 2 -10 3 ו -10 4 -10 6 pg / mL, בהתאמה (איור 4). למרבה המזל, בטווח הנמוך של ערכת השליטה העקיפה מאפשר לנו לזהות בקלות ייצור ביוטין מתאי מהונדסים. עם זאת, הלהקה החזקה של הטווח הדינמי שליטה העקיפה מגבילה את יכולתו לחוש שינויים גדולים (פי 100) בריכוזים ביוטין. לשנות את הטווח הדינמי הוא תוכניות שליטה העקיפות וישירות ידרוש הנדסה נוספת. עם זאת, אם זיהוי של תאים לייצרד ביוטין הינה סוגיה, הכנת דילולים של supernatant ביוטין בשלב 4.6 צריך לאפשר לחוקר למקד את הטווח הדינמי של ערכת שליטה עקיפה (איור 5). מצאנו כי דילול 1: 5 של supernatant אפשר לנו למקד את הטווח הדינמי של ערכת השליטה העקיפה ביעילות. אסטרטגית דילול זה אמורה להקל על הצורך לשנות את הטווח הדינמי ישירות.

מערכת הבת שני חלקים, תא-חומר המובא כאן מאפשרת מהונדסת תאים כדי לשנות את ההרכב של משטח פונקציונלי. תאים דינמיים, חיים יכולים לפרש הסביבה הכימית שלהם כדי לייצר תגובה גנטית. באמצעות הנדסה גנטית בתגובה זו כדי להגדיל את הייצור ביוטין, נוכל להעניק תאי חיים מהונדסים עם היכולת לשלוט ולתפעל משטח פונקציונלי. על ידי ביצוע הפרוטוקולים שהוצגו, תאים מהונדסים מסוגלים לפעול חיישנים דינמיים כמו, יכולת לקרוא, עיבוד, הקלטת התנאים סביב הem דרך ממשקים פונקציונליים. טכנולוגיה זו יכולה להשפיע בתחומים הנעים בין רפואה מולקולרית לגילוי אנליטי עבור תיקון הסביבה.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

החוקרים אין לי מה לחשוף.

Acknowledgments

המחברים בתודה להכיר תמיכה בפרס FA9550-13-1-0108 מלשכת חיל האוויר של המחקר המדעי של ארה"ב. המחברים גם מכירים תמיכה מן הפרס N00014-15-1-2502 מן משרד המחקר של הצי של ארה"ב, מימון מהמכון לטכנולוגיה קריטית ומדע יישומי במכון הפוליטכני וירג'יניה סטייט, ומן מחקר לתארים מתקדמים הקרן הלאומית למדע אחוות תוכנית, מספר הפרסים 1,607,310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics