Met behulp van synthetische biologie levende cellen Engineer die interface met programmeerbare Materials

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dit artikel presenteert een reeks protocollen voor het ontwikkelen van gemanipuleerde cellen en gefunctionaliseerde oppervlakken die het mogelijk maken synthetisch gemanipuleerde E. coli te beheersen en te manipuleren programmeerbare materiaal oppervlakken.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

We hebben een abiotische-biotische interface waarmee gemodificeerde cellen aan de materiaaleigenschappen van een gefunctionaliseerd oppervlaktebesturingseenheid ontwikkeld. Dit systeem bestaat, door twee modules: een synthetisch gemodificeerde stam van E. coli cellen en een gefunctionaliseerd materiaal interface. In dit document, we detail een protocol voor genetisch manipuleren geselecteerde gedrag in een stam van E. coli met behulp van moleculaire klonering strategieën. Eenmaal ontwikkeld, dit soort produceert hoge gehalten aan biotine bij blootstelling aan een chemische inductor. Daarnaast hebben we detail protocollen voor het maken van twee verschillende gefunctionaliseerde oppervlakken, waarvan elk kan inspelen op cel gesynthetiseerd biotine. Samengevat presenteren we een methode voor het maken van een gekoppelde, abiotische-biotische systeem waarmee gemanipuleerde cellen materiaalsamenstelling en montage controleren op niet-levende substraten.

Introduction

Hier melden wij procedures voor de ontwikkeling van een programmeerbare substraat kan reageren op een chemisch signaal van een gemodificeerde cellijn. 1 Wij doen dit door het creëren van een biotine-streptavidine-interface die reageert op biotine geproduceerd door synthetisch gemanipuleerde Escherichia coli (E. coli) cellen. Eerder hebben programmeerbare oppervlakken is ontworpen voor een breed scala aan toepassingen van toxine detectie 2 en point-of-care diagnostiek 3 defensie en veiligheid. 4 Terwijl programmeerbare oppervlakken bruikbaar als sensoren en actuatoren kunnen zijn, kunnen ze "slimmer" worden gemaakt door ze te begiftigen met het vermogen tot aanpassing aan verschillende milieuproblemen. Daarentegen, zelfs eenvoudige micro-organismen, zoals E. coli, inherente flexibiliteit en kunnen reageren op uitdagingen geavanceerde en vaak onverwachte oplossingen. Dit aanpassingsvermogen heeft ingeschakeld E.coli bevolking, bestuurd door hun complexe gen-netwerken, op een kosteneffectieve manier te zoeken middelen, 5 creëren producten met toegevoegde waarde, 6 en zelfs de macht micro-schaal robotica. 7 Door het koppelen van de adaptieve voordelen van levende cellen met behulp van programmeerbare oppervlakken, kunnen we een slimme substraat kan reageren op verschillende omgevingsomstandigheden maken.

Synthetische biologie onderzoekers nieuwe mogelijkheden gegeven om het gedrag van levende organismen programmeren. Door engineering van cellen om nieuw gen regulerende netwerken bevatten, kunnen onderzoekers cellen die een reeks van geprogrammeerde gedrag vertonen ontwerpen. 8, 9 voorbij basisonderzoek, kan dit gedrag worden gebruikt voor toepassingen zoals regelend materiaal montage en biologisch produceren van producten met toegevoegde waarde. 10 Hierin we detail hoe we gebruik gemaakt van de instrumenten van de synthetische biologie tot engineer een E. coli-stam die biotine synthetiseert na inductie. Deze stam werd ontwikkeld door gebruikmaking van restrictie-enzym kloneringswerkwijzen een plasmide, pKE1-lad-bioB monteren. Dit plasmide, wanneer getransformeerd in E. coli stam K-12 MG1655, begiftigt cellen met het vermogen om verhoogde niveaus van bioB, een enzym voor biotine synthese drukken. Wanneer getransformeerde cellen werden geïnduceerd met isopropyl β-D-1-thiogalactopyranoside (IPTG) en voorzien van een biotine precursor, desthiobiotine (DTB), werden verhoogde niveaus van biotine geproduceerd.

De bindingsinteractie biotine met streptavidine is een van de sterkste niet-covalente bindingen in de natuur. Als zodanig, de biotine-streptavidine interactie zowel goed gekarakteriseerd en zeer gebruikt in biotechnologie. 11 Binnen dit manuscript, presenteren we twee strategieën in dienst van de biotine-streptavidine interactie aan te voelen en op te sporen cel geproduceerd biotine met een gefunctionaliseerd oppervlak. Wijverwijzen naar deze contrasterende oppervlakken als "indirecte" en "direct" control regelingen. In de besturing indirecte cel geproduceerd biotine concurreert met biotine dat is geconjugeerd en geïmmobiliseerd op een polystyreen oppervlak voor streptavidine bindingsplaatsen. Bovendien wordt de streptavidine geconjugeerd met mierikswortelperoxidase (HRP). HRP wijzigt 3, 3 ', 5, 5'-tetramethylbenzidine (TMB), een optisch signaal, 12 dat kan worden gevolgd door kwantificeren van de spectrale absorptie (dwz optische dichtheid) bij 450 nm (OD 450) te produceren. Zo is de besturing indirect stelt onderzoekers in staat om cellen geproduceerd biotine te meten door het bewaken van de attentuation van de OD 450 signaal.

De directe besturing maakt gebruik van de streptavidine-biotine event door immobiliseren streptavidine rechtstreeks op een materiaaloppervlak en waardoor cellen geproduceerd biotine en gebiotinyleerde HRP om te concurreren voor streptavidine bindingsplaatsen. Nogmaals, derelatieve niveaus van cel geproduceerde biotine worden gevolgd door het meten van een OD 450 signaal.

Samengevat, de gemanipuleerde cellen en gefunctionaliseerde oppervlakken kunnen we de eigenschappen van een programmeerbare oppervlaktebesturingseenheid door het induceren netwerken in levende cellen. Met andere woorden, hebben we een systeem dat gebruik maakt van het aanpassingsvermogen van levende organismen en de betrouwbaarheid en de specificatie van een aangelegde materiaal-interface door het koppelen van deze systemen gemaakt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Media en Cultuur Voorbereiding

  1. Bereid lysogenie bouillon (LB) media door het mengen van 25 g LB poeder voorraad 1 L gedeïoniseerd (DI) water en autoclaveren de oplossing bij 121 ° C gedurende 20 min te steriliseren.
    1. Om LB-platen voor te bereiden, voeg 15 g agar (1,5%) tot de LB media voor de sterilisatie
    2. Bereid voorraad oplossingen van 1000x carbenicilline (CB) in DI water (50 mg / ml).
    3. Als voorbereiding LB-medium dat een antibioticum voor selectie van resistente transformanten omvat, wachten tot de temperatuur gesteriliseerd LB-medium lager is dan 60 ° C en voeg 1 pl antibioticavoorraadoplossingen voor elke 1 ml LB-medium.
  2. Voor M9 minimaal medium (tabel 1), bereid afzonderlijke voorraadoplossingen van de volgende: 5X M9 zouten (56,4 g / l), 1 M MgSO4, 1 M CaCl2, 20% glucose en 2% biotine-vrije casaminozuren.
    1. In een autoclaaf veilige fles, combineren 20 ml 5x M9 zouten, 200 &# 181, L 1 M MgSO4, 10 pl 1 M CaCl2, 2 ml 20% glucose, 1 ml 2% biotine-vrije casaminozuren en 76,8 ml DI water.
    2. Autoclaaf de oplossing bereid in stap 1.2.1 bij 121 ° C gedurende 20 min.
  3. Incubeer alle culturen bij 37 ° C onder schudden bij 400 rpm. Incubatie variëren afhankelijk van experiment en stam, maar duren meestal 8-12 uur.

2. Genereren van biotine producerende E. coli (Plasmid pKE1-lad-bioB)

OPMERKING: De genetische circuit bestaat uit twee delen: een lac-onderdrukker, aangedreven door een PL, tetO-1-promoter resulteert in constitutieve expressie door de afwezigheid van een tetR repressor eiwit, evenals een biotine expressiesysteem waarin de P trc-2 promoter gevolgd door een sterke ribosoom bindingsplaats (RBS) die de expressie van bioB. Alle klonen werd uitgevoerd in een commercieel, snel delende E. coli strain. Het uiteindelijke construct werd getransformeerd in E. coli MG1655WT te testen. Primers (Tabel 2) werden commercieel gekocht.

  1. Isoleer bioB-gen van E. coli genoom door het uitvoeren van hele cellen polymerasekettingreactie (PCR):
    1. Kweek E. coli MG 1655WT cellen overnacht bij 37 ° C.
    2. In een 0,2 ml PCR-buis, combineer 1 pl van de overnacht cultuur bereid in stap 2.1.1 met 9 ul van steriel DI water.
    3. Incubeer de buis bij 95 ° C gedurende 5 min in een thermocycler en geeft de reageerbuis een -80 ° C vriezer gedurende 10 minuten om de cellen te lyseren. Hierdoor kan genomisch DNA om te dienen als een PCR-matrijs.
    4. Ontdooi de oplossing en voeg (i) 2,5 pi van elk van de primers nBioB2-f1 en nBioB2-r, (ii) 5 pl 5x DNA polymerase buffer, (iii) 0,25 pl DNA polymerase, (iv) 0,5 uL dNTP mix en (v) 6,75 ui DI water voor een totaal reactievolume van 25 ul(Tabel 4).
    5. Sla de kant van (dat wil zeggen, flick) de buis om de inhoud te mengen. Vervolgens onmiddellijk spin down de buis snel (~ 2 s) te waarborgen het monster op de bodem van de buis.
    6. Plaats de buis in een PCR thermocycler en gebruik in tabel 3 beschreven, met één van 3 min bij 95 ° C aan het begin van het protocol programma.
    7. Bevestig succesvolle PCR middels gelelektroforese (1,0-1,2% agarose in DI water + ethidium bromide) in Tris base, azijnzuur en EDTA buffer (TAE). Het PCR-product moet 1070 basenparen (bp) lang.
    8. Gebruik commerciële kits volgens de instructies van de fabrikant voor DNA-fragmenten te extraheren uit gel uit stap 2.1.7.
  2. Isoleer de P trc-2 promotor en het lad operon uit het plasmide pKDL071 13 (met dank aan het lab van James Collins aan het MIT):
    1. Kweek E. coli-cellen bevattendede pKDL071 plasmide overnacht in LB + Cb bij 37 ° C.
    2. Extraheer het plasmide DNA van de cellen met behulp van een commercieel miniprep kit volgens instructies van de fabrikant. Het plasmide zal dienen als een PCR-matrijs.
    3. Volg de PCR-protocol van stap 2.1.4. tot en met 2.1.8. met de volgende wijzigingen:
    4. Vervang gelyseerde cellen met het plasmide extract in stap 2.2.2.
    5. Gebruik 2,5 pi elk van primers 1-f en 1-r lad cassette extractie. Anders, gebruik maken van 2,5 pi elk van primers nBioB1-f en nBioB1-r P TRC-2-extractie.
    6. Voer gelelektroforese (stap 2.1.7) bevestigen de PCR producten de lacI cassette P trc-2 promotorplaats. Ze moeten 1213 bp en 109 bp, respectievelijk.
  3. Met splitsing door overlappende extensie (SOE) PCR met de bioB cassette bouwen met P trc-2, een synthetische ribosoombindingsplaats (RBS) in primer nBioB2-f2 en de bioB tabel 3.
  4. Constructies Insert (P L, tetO-1 + lad en P TRC-2 + bioB) in het pKE1-MCS plasmidevector 13 backbone (met dank aan het lab van James Collins aan het MIT) door het verteren van de vector en steek met restrictie-enzymen:
    1. Extract genen onder gebruikmaking van restrictie-enzymen en gelelektroforese. Elke reactie bevat (i) 5 pl 10x reactiebuffer, (ii) 1 ui restrictie-enzym 1, (iii) 1 ui restrictie-enzym 2, (iv) ten minste 1 ug DNA, en (v) DI water breng het uiteindelijke volume op 50 pl (Tabel 5). Verteren enzymen AatII en EcoRI voor de lacI cassette en enzymen HindIII en Sacll de bioB cassette.
    2. Nadat de reacties worden geassembleerd snel vortex hen en kort gecentrifugeerd (~ 2 s) vóór incubatie gedurende 1 uur bij 37 ° C.
    3. Gedurendedigestie, elektroforese gels bereid volgens standaardprotocollen.
    4. Combineer verteerd DNA met gelelektroforese 6x laadbuffer.
    5. Gebruik een 2-log ladder naar de ligging van gewenste construct verifiëren, geknipt DNA-fragment uit de gel en gebruiken commerciële gel extractie kit volgens de instructies van de fabrikant voor DNA-fragmenten te extraheren uit de gel.
  5. Kwantificeren DNA met spectroscopie en bereken volumes 0: 1, 1: 1 en 3: 1 molaire verhouding van insertie tot vector met behulp van vergelijking 1:
    vergelijking 1 vergelijking 1
    In vergelijking 1, M is de verhouding van insertie tot vector (0, 1, of 3), X i de hoeveelheid insert DNA, bp i de lengte van het insert in basenparen, bp v de lengte van de vector in baseparen en X v de hoeveelheid vector (50 ng).
  6. Meng ligatiereactie door het combineren (i) 1 ui 10X ligasebuffer, (ii)1 pl T4 Ligase, (iii) 50 ng vector DNA, (iv) een massa insert DNA aan elke reactie, en (v) DI water tot 10 pi totaal reactievolume (Tabel 6).
  7. Incubeer bij kamertemperatuur (KT) gedurende 1 uur.
  8. Tijdens de ligatie incubatie in stap 2,7, bereid chemisch competente cellen.
    1. Portie 1 ml 's nachts culturen in 1,5 ml centrifugebuizen.
    2. Centrifugeer bij 16.200 xg gedurende 1 min.
    3. Decanteer supernatant en resuspendeer de pellet in 200 pl gekoelde (op ijs) 100 mM CaCl2. Resuspendeer de pellet door voorzichtig pipetteren. Doe niet vortex.
    4. Plaats de microcentrifugebuis op ijs gedurende 10 min.
    5. Centrifugeer Verwijder het supernatant, resuspendeer de pellet in 100 ul koud 100 mM CaCl 2 en plaats de buis op ijs weer.
    6. Centrifugeer de buis een laatste keer en resuspendeer de pellet in 50 ul gekoelde 100 mM CaCl2.
    7. Plaatsde buis op ijs en het gebruik van de chemisch competente cellen onmiddellijk.
  9. Voeg 5 ul van geligeerde DNA, bereid in stappen 2,6 en 2,7, aan elke buis competente cellen bereid in stap 2.8.
  10. Schud de buis kort door het slaan van de zijde (dwz flicking) de buizen en plaats de buizen op ijs gedurende 30 min.
  11. Heat shock de buizen gedurende 45 s bij 42 ° C en breng de buizen ijs gedurende 2 minuten.
  12. Pipet cellen op selectieve LB agar + antibiotica borden en de verspreiding van de cellen met behulp van glazen plating kralen.
  13. Incubeer de platen gedurende de nacht bij 37 ° C.
  14. De volgende ochtend, pick kolonies van insert-positieve platen (dat wil zeggen 1: 1 en 3: 1 platen). Pick 3 kolonies als de 0: 1 negatieve controle bord toont geen groei, of kies 5-8 kolonies als de 0: 1 plaat heeft een aantal groei. Gebruik het opgenomen koloniën enten 5 ml LB + antibiotica en groeien 8 uur bij 37 ° C onder roeren.
  15. Extraheer het plasmide-DNA uit de cellen met een miniprep kit volgens de instructies van de fabrikant. Voer een snijtest gebruikmaking van restrictie-enzymen (volgens dezelfde werkwijze beschreven in stap 2.4.1.).
  16. Identificeren cellen met succes constructen door het vergelijken van de lengte van de gedigereerde DNA-fragmenten met de verwachte resultaten van een correcte construct. Culturen succesvolle uitvoering plasmide constructen kunnen worden geconserveerd door gelijke delen cultuur met een oplossing van steriel-gefiltreerd, 40% glycerol (in DI water) en bevriezen van het mengsel bij -80 ° C.
    OPMERKING: Transformaties van plasmiden in andere stammen van E. coli (bijv MG1655WT) kan worden bewerkstelligd door de bovenstaande procedure om chemisch competente cellen.

3. Cell Karakterisering: Groei Curve en dosis-respons

  1. Grow gemanipuleerde stammen overnacht in LB media met een geschikte antibioticum.
  2. Voor groeicurven, voor te bereiden 50 ml minimaal M9 media met en zonder IPTG (van een 0,5 M stak) en / of DTB (van een 500 ug / ml stock) als volgt:
    1. Bereid 0 ng / mL DTB (0 pi op voorraad) / 0 mm IPTG (0 pi van voorraad).
    2. Bereid 200 ng / mL DTB (200 pi van voorraad) / 0 mm IPTG (0 pi van voorraad).
    3. Bereid 0 ng / mL DTB (0 pi op voorraad) / 0,5 mM IPTG (50 ul van voorraad).
    4. Bereid 200 ng / mL DTB (200 pi van voorraad) / 0,5 mM IPTG (50 ul van voorraad).
    5. Enten in kweek gedurende de nacht van 1: 100 in de hierboven vermelde media.
    6. In een 96-putjesplaat, 200 pl aliquot van cultuur in drievoud aan elk putje.
    7. Meet OD 600 elke 5 min gedurende 24 uur onder voortdurend schudden en incubatie bij 37 ° C in plaatlezer.
  3. Voor dosis-respons-studies, vervang de bioB gen in pKE1-lad-bioB met mCherry (een rood fluorescerend eiwit) voor real-time optische kwantificering.
  4. Voeg variërende hoeveelheden variërend van IPTG 0,1 mM tot 5 mM om expressie te inducerenin LB media.
  5. Enten in kweek gedurende de nacht bij een verdunning van 1: 100.
  6. Meet fluorescentie elke 30 min gedurende 15 uur.

4. induceren biotine productie van gemanipuleerde cellen en Supernatant Voorbereiding

  1. Grow pKE1-lad-bioB in de E. coli MG1655 stam overnacht in LB media.
  2. M9 media aangevuld met DTB van 30 tot 200 ng / mL.
  3. Voeg 0,5 mM IPTG aan biotine synthese induceren.
  4. Inoculeren aangevuld, biotine-vrij minimale M9 media met kweek gedurende de nacht bij 1: 100 verdunning.
  5. Na 24 uur groei, centrifuge cellen en verzamel de biotine-verrijkte supernatant.
  6. Meet-biotine verrijkt supernatant de indirecte controle en de directe controle gefunctionaliseerde oppervlakken. Gebruik het supernatant in plaats van biotine monster in stappen 5,23 en 6,12 respectievelijk.

5. Indirecte Controle Scheme Gefunctionaliseerde Oppervlaktebehandeling

  1. Bereid the volgende oplossingen.
    1. Bereid een SMCC oplossing bestaande uit 20 mg / ml succinimidyl trans-4- (maleimidylmethyl) cyclohexaan-1-carboxylaat (SMCC) in dimethylsulfoxide (DMSO).
    2. Bereid een SPDP oplossing bestaande uit 20 mg / ml succinimidyl-3- (2-pyridyldithio) propionaat (SPDP) in DMSO.
    3. Bereid 20 mg / ml LC-LC-biotine in DMSO.
    4. Bereid 10 mg / ml mierikswortelperoxidase (HRP) in fosfaatgebufferde zoutoplossing (PBS).
    5. Bereid 10 mg / ml streptavidine (SA) in PBS.
    6. Bereid 10 mg / ml runderserumalbumine (BSA) in PBS.
    7. Bereid 100 mM dithiothreitol (DTT) in DI-water.
    8. Bereid 5 mM ethylenediaminetetaacetic acid (EDTA) in PBS.
    9. Bereid 0,5% caseïne in PBS.
    10. Bereid 20% Tween 80 voorraad in DI water.
    11. Bereid 0,05% Tween 80 (van 20% aandelen) in PBS.
    12. Bereid 50 mm in DI-water natriumacetaat.
    13. Bereid 1% TMB in DMSO.
    14. Bereid 3% H 2 O 2 in DI water.
    15. Bereid 2 MH 2 SO 4 in DI water.
  2. Voeg 1,4 pi van de oplossing SPDP 20 ul SA oplossing.
  3. Incubeer de oplossing van 5,2 tot 1,5 uur bij kamertemperatuur, in aluminiumfolie gewikkeld om blootstelling aan licht te vermijden. Deze stap maakt de SPDP crosslinker om zich te binden aan SA via een aminogroep die een-pyridyldithio geactiveerd SA.
  4. Voeg 2,4 pi van de DDT oplossing aan de oplossing van stap 5,3 en incubeer gedurende 1 uur bij kamertemperatuur. Dit maakt een pyridine 2-thion splitsing resulteert in een sulfhydryl-SA geactiveerd.
  5. Voeg 7,5 ul SMCC oplossing van 72 gl HRP-oplossing en incubeer gedurende 1,5 uur bij kamertemperatuur, in aluminiumfolie gewikkeld om blootstelling aan licht te vermijden. Dit resulteert in een maleïmide geactiveerd HRP gebonden aan een aminogroep.
  6. Meng 17 pl LC-LC-biotine-oplossing met 200 ul BSA-oplossing en incubeer gedurende 1,5 uur bij kamertemperatuur, in aluminiumfolie gewikkeld om blootstelling aan licht te vermijden. Deze stap maakt het mogelijk om biotine conjugaat to BSA via een amidebinding.
  7. Breng de oplossingen van stappen 5.4, 5.5 en 5.6 van de centrifugale concentrators binnen spin-buizen te scheiden.
  8. Voor buizen met SA-SPDP, uit stap 5.4, centrifuge bij 10.000 xg totdat de buis volume bereikt 100 ul of 16 min. Vul de spinbuis 500 pi met PBS-EDTA.
    1. Herhaal stap 5,8 vijfmaal. Bewaar de voorraad bij 4 ° C.
  9. Voor buizen met HRP-SMCC, uit stap 5.5, centrifugeer bij 10.000 xg totdat het volume 25 ul bereikt of gedurende 16 min. Vul de spinbuis 500 pi met PBS.
    1. Herhaal stap 5,9 vijfmaal. Bewaar de voorraad bij 4 ° C.
  10. Voor buizen met BSA-biotine, uit stap 5.6, centrifugeer bij 10.000 xg totdat het volume 100 ul bereikt of gedurende 12 min. Vul de spinbuis 500 pi met PBS.
    1. Herhaal stap 5,10 viermaal.
    2. Centrifugeer bij 10.000 xg totdat het volume 100 pi bereiktof 12 min. Voeg 100 ul van PBS aan de buis. Bewaar de voorraad bij 4 ° C.
  11. Voeg 25 ul van 10 mg / ml HRP-oplossing met 25 ui 10 mg / ml SA-oplossing en bewaar bij 4 ° C overnacht. Hierdoor wordt de SA geconjugeerd met HRP wordt via een thio-etherbinding.
    1. Bereid een 1: 4 werkende oplossing met de oplossing 's nachts en op te slaan in 4 ° C koelkast. WINKEL overblijvende oplossing bij -20 ° C.
  12. Bereid twee oplossingen bestaande uit BSA-biotine (of BSA) in PBS door toevoeging van 10 gl BSA-biotine voorraad (of 10 gl BSA voorraad) aan 490 pi PBS.
  13. Voeg 100 ul van de oplossing uit stap 5,12 aan elk putje van een 96-well polystyreen platen.
  14. Incubeer de plaat bij 37 ° C gedurende 1 uur, omwikkeld met folie.
  15. Was de putjes van de plaat met 0,05% Tween 80.
    1. Voeg 200 ul van PBS 0,05% Tween-80 aan de putjes. Incubeer gedurende 2 minuten bij kamertemperatuur. Schenk de vloeistof.
    2. <li> Herhaal stap 5.15.1 drie keer.
  16. Voeg 200 ul van 0,5% caseïne oplossing in elk van de putjes in de 96-well plaat.
  17. Incubeer de plaat bij 37 ° C gedurende 1 uur.
  18. Herhaal stap 5,15 de putjes drie keer wassen.
  19. Bereid een oplossing door het mengen van 12 ml van 0,5% caseïne oplossing met 7,5 pi van 0,05% Tween 80.
  20. Verdun de SA-HRP voorraad 1: 10.000 met behulp van de oplossing bereid in stap 5.19.
  21. Voeg 80 ul van de oplossing bereid in stap 5,20 aan elk putje van een 96-wells plaat.
  22. Voeg 20 ul van het voorbereide monster biotine aan elk putje van de plaat polystyreen. De supernatant bereid in 4,6 kan worden gebruikt als biotine monster in deze stap.
  23. Incubeer de plaat bij 37 ° C gedurende 1 uur. Deze stap zorgt voor een competitieve binding tussen vrije biotine en immobiliseren BSA-biotine voor SA-HRP-bindende plaatsen.
  24. Herhaal stap 5,15 de putjes drie keer wassen.
  25. Meng 50 mM natriumacetaat, 1% TMB-oplossing,en 3% H 2 O 2 oplossing bij een 1000: 10: 1 verhouding (20 ml totaal volume).
  26. Voeg 200 ul van de oplossing uit stap 5,25 aan elk putje en laat zitten 15 minuten bij kamertemperatuur, bedekt met folie.
  27. Voeg 50 ul van 2 MH 2 SO 4 aan elk putje om de reactie te stoppen. Meet de OD 450 behulp van een plaat lezer.

6. Direct Control Scheme Gefunctionaliseerde Oppervlaktebehandeling

  1. Bereid de volgende oplossingen.
    1. Bereid 20 mg / ml LC-LC-biotine in DMSO.
    2. Bereid 10 mg / ml HRP in PBS.
    3. Bereid 0,17 pg / ml in PBS SA.
    4. Bereid 0,5% caseïne in PBS.
    5. Bereid 20% Tween 80 voorraad in DI water.
    6. Bereid 0,05% Tween 80 (van 20% aandelen) in PBS.
    7. Bereid 50 mm in DI-water natriumacetaat.
    8. Bereid 1% TMB in DMSO.
    9. Bereid 3% H 2 O 2 in DI-water.
    10. Bereid 2 MH 2 SO 4 water.
  2. Voeg 7,5 ul LC-LC-biotine 72 ul HRP en incubeer bij gedurende 1,5 uur bij kamertemperatuur, in aluminiumfolie gewikkeld om blootstelling aan licht te vermijden. Deze stap zorgt ervoor biotine geconjugeerd aan HRP via een amidebinding.
  3. Breng de oplossing van stap 6.2 een centrifugale concentrator in een spinbuis
    1. Centrifugeer de oplossing bij 10.000 xg totdat het volume 100 ul bereikt of gedurende 12 min. Vul de spinbuis 500 pi met PBS en herhaal de centrifugatie en PBS bovendien vier keer. Bewaar de voorraad bij 4 ° C.
  4. Voeg 100 ul van de oplossing van SA 6.1.3 aan elk putje in een 96-well polystyreen platen.
  5. Incubeer de plaat bij 37 ° C gedurende 1 uur, omwikkeld met folie.
  6. Was de putjes van de plaat met 0,05% Tween 80.
    1. Voeg 200 ul van 0,05% Tween 80 aan de putjes. Incubeer gedurende 2 minuten bij kamertemperatuur. Schenk de vloeistof.
    2. 6.6.1 driemaal herhalen.
  7. Voeg 200 ul van 0,5% caseïne oplossing in elk van de putjes in de 96-well plaat.
  8. Incubeer de plaat bij 37 ° C gedurende 1 uur.
  9. Herhaal stap 6,6 drie keer om de putjes te wassen.
  10. Verdun het biotine-HRP voorraad 1: 10.000 met oplossing bereid in stap 6.3.
  11. Voeg 80 ul van de oplossing bereid in stap 6,10 aan elk putje van een 96-wells plaat.
  12. Voeg 20 ul van het voorbereide monster biotine aan elk putje van de plaat polystyreen. De supernatant bereid in 4,6 kan worden gebruikt als biotine monster in deze stap.
  13. Incubeer de plaat bij 37 ° C gedurende 1 uur. Deze stap zorgt voor een competitieve binding tussen vrije biotine en biotine-HRP voor geïmmobiliseerde SA bindingsplaatsen.
  14. Herhaal stap 6.6 de putjes drie keer wassen.
  15. Meng 50 mM natriumacetaat, 1% TMB oplossing en 3% H 2 O 2 oplossing bij een 1000: 10: 1 verhouding (20 ml totaal volume).
  16. Voeg 200 ul van de oplossing uit stap 6.15 aan elk putje en incubeer gedurende 15 minuten bij kamertemperatuur, bedekt met folie.
  17. Voeg 50 ul van 2 MH 2 SO 4 oplossing in elk putje om de reactie te stoppen. Meet de OD 450 behulp van een plaat lezer.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Representatieve resultaten zijn weergegeven in de bijgaande vijf figuren. Eerst geven we het klonen grafisch (figuur 1), zodat de lezer visueel kan volgen de kritische stappen voor het creëren van synthetisch gemodificeerde E. coli-stam. Om de populatie dynamiek van de cellen te karakteriseren, bieden we een groeicurve (figuur 2) gegenereerd door de optische dichtheid bij 600 nm (OD 600) van de bevolking. Vervolgens tonen we hoe de regulerende genetische netwerk wordt geverifieerd door mCherry als proxy voor bioB (figuur 3), zodat we optisch meten van de relatieve hoeveelheid bioB die wordt veroorzaakt door de cellen na inductie met IPTG. Vervolgens presenteren we respons gegevens voor de indirecte-controle en de directe controle gefunctionaliseerde oppervlakken. Deze gegevensplots (Figuur 4) werden ontwikkeld met behulp gemeten oplossingen vrijebiotine de gefunctionaliseerde oppervlakken 'responsprofielen karakteriseren. Tenslotte presenteren we karakteristieke gegevens waaruit blijkt hoe de gemanipuleerde cellen worden geïnduceerd om biotine (figuur 5) te produceren, waarbij de gefunctionaliseerde oppervlakken wijzigen.

Figuur 1
Figuur 1: ontwerp en de bouw van Induceerbare, gemanipuleerde cellen. (A) Primers werden ontworpen om de bioB-gen te isoleren uit het E. coli genoom, die een cruciale enzym in het biotine synthese weg codeert. (B) P L, kan tetO-1 -lacI en P trc-2-sequenties worden geïsoleerd uit een plasmide dat een genetische tuimelschakelaar met overeenkomstige primers. (C) De geëxtraheerde bioB-gen en de twee fragmenten van de schakelaar kan dan worden gebruikt om het gen circuit te creëren. De toevoeging van IPTG kan dan indUCE de expressie van bioB, waardoor biotine synthese wanneer DTB wordt toegevoegd als een substraat voor bioB. (D) De geassembleerde plasmide werd getransformeerd in K12 MG1655 E. coli. Dit veroorzaakt de aanwezigheid van IPTG om de expressie van bioB, waardoor biotine synthese induceren van de gemodificeerde cellijn als DTB werd als een substraat. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2: Groei Curves voor gemanipuleerde cellen. De gemanipuleerde, induceerbare MG1655 wildtype cellen werden gekweekt en gecontroleerd in minimaal medium (dwz biotine-vrij M9 media), en minimaal medium aangevuld met DTB (200 ng / mL) en / of IPTG (0,5 mM). De grafieken tonen de OD 600 lezing, gemeten om de 5 mi n voor 24 uur. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3: Het testen van de Engineered Gene Network. De fluorescerende eiwit mCherry werd gebruikt in plaats van de bioB gen zodat we optisch de inductie profiel kan meten wanneer gemanipuleerde cellen werden geïnduceerd met IPTG. We contrast van de cellen geïnduceerd met IPTG (Red Diamonds) met de cellen niet geïnduceerd met IPTG (Blue Diamonds). Deze resultaten tonen de effectiviteit van de induceerbare genetische netwerk. Klik hier om een grotere versie van deze figuur te bekijken.

/55300/55300fig4.jpg "/>
Figuur 4: Controle van de gefunctionaliseerde Material Interface. Door blootstelling onze gefunctionaliseerd oppervlak variërende concentraties biotine, kunnen we de optische reactie door het meten van OD 450 absorptie te meten. Deze resultaten kunnen we een ijkkromme te genereren, die de concentratie van biotine aan de optische intensiteit van de respons. Hier presenteren we de biotine vs. lichtsignaal curves voor zowel indirecte (links) en direct (rechts) gefunctionaliseerd oppervlak regelingen. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 5
Figuur 5: gemanipuleerde cellen controlemateriaal Interface. Door gebruik te maken protocol secties 5 of 6, zijn we in staat om de producten van geïnduceerde, gemanipuleerde c gebruikenells chemisch wijzigen van de gefunctionaliseerde oppervlak. We kunnen deze reacties optisch controleren door het meten van OD 450. Bovendien met de kalibratiekromme in figuur 4, zijn de optische intensiteit van de reactie op de biotine in de concentratie verbinden. We presenteren hier de verschillende biotine concentraties gemeten door onze indirecte besturing gefunctionaliseerd oppervlak, wild-type cellen (wit), niet-geïnduceerde cellen die de pKE1-lad-bioB plasmide (oranje) en geïnduceerde cellen die de pKE1-lad-bioB plasmide (grijs). Klik hier om een grotere versie van deze figuur te bekijken.

Chemisch eindconcentratie Bedrag
5x M9 zouten 1x 20 ml
1 M MgSO4 2 mM 200 pl
1 M CaCl2 0,1 mM 10 pi
20% glucose 0,40% 2 mL
2% biotine-vrij casaminozuur 0,02% 1 mL
DI water N / A 76,8 ml

Tabel 1: M9 Media Recipe.

Naam primer Sequence Gebruik
1-f CCGCCGGAATTCTCCCTATCAGTGATAGAGATT lad cassette extractie
1-r CCGACGTCTCACTGCCCGCTTTCCAGTC lad cassette extractie
nBioB1-f CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P trc-2 extractie
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P trc-2 extractie
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG bioB extractie
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC bioB extractie
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC Synthetische RBS aanvulling

Tabel 2: Lijst van de primers.

Stap 1
Stap 2 Stap 3 stap 4 stap 5 stap 6 stap 7 stap 8 stap 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
00:30 00:10 00:30 01: 00 / kb 00:10 00:30 01: 00 / kb 02:00
Herhaal dit 12 keer 25 keer herhalen
-1 ° C / cyclus

Tabel 3: PCR Program.

Naam Volume
Cellysaat (template) 10 pi
Primer (elk) 0,625 pi (elk)
5x Q5 buffer 5 pi
Q5 Polymerase 0,25 pi
dNTP Mix 0,5 pl
DI water 6.75 pi

Tabel 4: Hele Cell PCR-reactie (25 ui).

Naam Volume
10x Reaction buffer 5 pi
enzyme 1 1 pi
enzyme 2 1 pi
template-DNA 1 ug
DI water 43 pi - volume van DNA

Tabel 5: restrictie-enzymdigestie reactie (50 ui).

Naam Volume
DNA 50 ug vector + X ug insert
10x ligasebuffer 1 pi
T4 Ligase 1 pi
DI water 8 pi - volume van DNA

Tabel 6: ligatiereactie (10 pi).

Naam Concentratie Notes
CaCl2 100 mM
Carbeniccilin 50 mg / ml (1000x)
DTB 50 ug / ml
IPTG 0,5 M
SMCC 20 mg / ml 2 mg in 100uL DMSO
SPDP 20 mg / ml 2 mg in 100uL DMSO
LC-LC-biotine 20 mg / ml 2 mg in 100uL DMSO
HRP 10 mg / ml in PBS
SA (indirect) 10 mg / ml in PBS
SA (direct) 0,17 ug / ml in PBS
BSA 20 mg / ml in PBS
DTT 100mM In DI water
EDTA 5 mM 18,6 mg in 10 ml PBS
caseïne 0,50% in PBS
Tween 80 20% In DI water
Tween 80 in PBS 0,05%
Natriumacetaat 50 mM In DI Water, aanpassen tot 5,1 pH met behulp van 3 M HCl
TMB 1% in DMSO
H 2 O 2 3% In DI water
H 2 SO 4 2 M In DI water

Tabel 7: Lijst van reagens Solutions.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

We hebben een nieuwe strategie voor het koppelen van gemodificeerde levende cellen met een gefunctionaliseerd materiaaloppervlak gepresenteerd. Dit werd bereikt door de ontwikkeling van een cellijn die in staat synthetiseren verhoogde biotine wanneer geïnduceerd met IPTG. De verhoogde niveaus van biotine kan dan worden gebruikt om het gefunctionaliseerde oppervlak wijzigen. De protocollen gedetailleerd hoe de E. coli cellijn ingenieur en hoe u twee verschillende gefunctionaliseerde oppervlakken te creëren.

Kritische stappen in dit protocol optreden gedurende de constructie van de gemodificeerde cellijn. Stroomafwaarts problemen, karakteriseren de gemanipuleerde cellijnen zowel groeicurven (figuur 2) en fluorescente respons (Figuur 3) voorkomen wordt aangemoedigd. Mocht procedurele problemen ontstaan, andere moleculaire klonering strategieën, zoals PCR en Gibson extractie samenstel 14 kan worden vervangen door stappen indien nodig. Voor optimale biotine yield van de gemanipuleerde cellijn, is het cruciaal om ervoor te zorgen dat een voldoende hoeveelheid DTB wordt verstrekt aan de cellen. In onze studies hebben we vastgesteld dat 200 ng / ml DTB veroorzaakte een aanzienlijke en statistisch significante verhoging van de productie biotine wanneer cellen werden geïnduceerd met IPTG. Daarnaast succesvolle vervoeging van BSA-biotine, SA-HRP en biotine-HRP is van cruciaal belang voor het effectief uitvoeren van en het toezicht op de indirecte en directe controle regelingen. Zorg onnodige blootstelling aan licht te vermijden en de conjugaten overnacht incuberen bij 4 ° C te zorgen voor een effectieve conjugaat wordt gevormd.

Ons protocol biedt voordelen boven alternatieve 15 vanwege zijn vermogen om kleine hoeveelheden biotine die biologisch van belang zijn (pg / ml schaal) te detecteren in vergelijking met commercieel verkrijgbare kits voor detectie biotine, zoals die gebaseerd op 4'-hydroxyazobenzene-2-carbonzuur competitieve binding strategieën. Hoewel het gebruik van de streptavidine biologischetin systeem is gebruikelijk in biotechnologie 16, 17, het vermogen van ons systeem om te reageren op kleine hoeveelheden biotine kunnen we direct link onze genetisch gemodificeerde cellijn met het gefunctionaliseerde oppervlak.

Een mogelijke beperking van ons protocol is de resulterende dynamische bereik van biotine detectie. In de directe en indirecte regelschema's, kunnen we biotine detecteren tussen 10 2 en 3 -10 10 -10 4 6 pg / ml (Figuur 4). Gelukkig is de lage bereik van de besturing indirect stelt ons in staat om gemakkelijk te detecteren biotine productie uit gemanipuleerde cellen. Echter, de strakke band van de indirecte controle dynamisch bereik beperkt de mogelijkheid om grote veranderingen (100-voudig) in biotine concentraties voelen. Het veranderen van het dynamische bereik voor zowel de indirecte en directe controle regelingen zouden aanvullende techniek nodig. Indien detectie van cellen te producerend biotine is een probleem bereiden verdunningen van biotine supernatant in stap 4,6 moet de onderzoeker mogelijk maken om het dynamisch bereik van de regeling indirecte controle (Figuur 5) te verkrijgen. We vonden dat een 1: 5 verdunning van de bovenstaande liet ons toe om het dynamische bereik van de regeling indirecte controle gerichter. Deze verdunning strategie indien nodig het dynamisch bereik rechtstreeks verwijderen verlichten.

De tweedelige, cel-materiaalsysteem hier gepresenteerde maakt gemodificeerde cellen aan de samenstelling van een gefunctionaliseerd oppervlak wijzigen. Dynamische, levende cellen hun chemische omgeving interpreteren als een genetische respons. Door deze techniek genetische respons aan biotine verhogen, kunnen we gemodificeerde levende cellen te voorzien van de mogelijkheid om de controle en een gefunctionaliseerd oppervlak te manipuleren. Door het volgen van de protocollen gepresenteerd, gemanipuleerde cellen kunnen als dynamische sensoren, geschikt voor het lezen, verwerken handelen, en registreren van de omgeving rond them via gefunctionaliseerde interfaces. Deze technologie zou kunnen gebieden variërend van moleculaire geneeskunde aan analytdetectiezone voor herstel van het milieu beïnvloeden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs dankbaar steun van award FA9550-13-1-0108 uit de Air Force Office van Wetenschappelijk Onderzoek van de Verenigde Staten te erkennen. De auteurs bovendien steun van award N00014-15-1-2502 erkennen van het Office of Naval Research van de Verenigde Staten, de financiering van het Instituut voor Technologie en kritische Applied Science aan de Virginia Polytechnic Institute and State University, en van de National Science Foundation Graduate Research Fellowship Program, award nummer 1.607.310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics