Unter Verwendung der synthetischen Biologie lebenden Zellen zu entwickeln, die Schnittstelle mit programmierbarer Materialien

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dieser Beitrag stellt eine Reihe von Protokollen für die gentechnisch veränderten Zellen entwickeln und funktionalisierte Oberflächen , die synthetisch konstruierte E. coli steuern können , und programmierbare Materialoberflächen zu manipulieren.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Wir haben einen abiotischen-biotischen Schnittstelle entwickelt, die gentechnisch veränderten Zellen erlaubt es, die Materialeigenschaften eines funktionalisierten Oberfläche zu steuern. Eine synthetisch konstruierte Stamm von E. coli Zellen und eine funktionalisierte Materialoberfläche: Dieses System wird durch die Schaffung von zwei Modulen. Innerhalb dieses Papier wir detailliert ein Protokoll für die gentechnische Veränderung von ausgewählten Verhalten in einem Stamm von E. coli unter Verwendung von molekularem Klonierungsstrategien. Einmal entwickelt, produziert dieser Stamm erhöhte Mengen an Biotin, wenn sie einer chemischen Induktors ausgesetzt. Zusätzlich wir detaillierter Protokolle zur Schaffung von zwei unterschiedlichen funktionalisierten Oberflächen, von denen jede Lage zu Zelle synthetisierte Biotin zu reagieren. Zusammengenommen stellen wir eine Methodik ein verknüpftes, abiotische-biotische System für die Erstellung, die Zellen zu steuern, Materialzusammensetzung und die Montage auf nicht lebenden Substraten entwickelt, ermöglicht.

Introduction

Hier berichten wir über die Verfahren für eine programmierbare Substrat zu entwickeln, das von einer konstruierten Zelllinie ein chemisches Signal reagiert. 1 Wir tun dies durch eine Biotin-Streptavidin - Schnittstelle zu schaffen, die von synthetisch engineered Escherichia coli (E. coli) Zellen erzeugt an Biotin reagiert. Zuvor programmierbare Oberflächen wurden für eine Vielzahl von Anwendungen von Toxinnachweis 2 und Point-of-Care - Diagnostik 3 Verteidigung und Sicherheit entwickelt. 4 Während programmierbare Oberflächen können nützlich als Sensoren und Aktoren sein, können sie gemacht "intelligenter" werden , indem sie mit der Fähigkeit zur Anpassung an verschiedene Umweltprobleme ausstatten. Im Gegensatz dazu sogar einfache Mikroorganismen, wie E. coli, weisen inhärente Anpassungsfähigkeit und sind in der Lage Challenges mit ausgeklügelter und oft unerwartete Lösungen reagieren. Diese Anpassungsfähigkeit ermöglicht hat E.coli - Populationen durch ihre komplexe Gen - Netzwerke gesteuert, kosteneffektiv Ressourcen suchen, 5 Mehrwert-Produkte erstellen, 6 und sogar Strommikromaßstab Robotik. 7 Durch die Kopplung der adaptive Vorteile von Zellen mit der Verwendung von programmierbaren Oberflächen leben, können wir ein Smart Substrat fähig der Reaktion auf unterschiedliche Umweltbedingungen zu schaffen.

Synthetische Biologie hat sich die Forscher neue Fähigkeiten gegeben, das Verhalten von Lebewesen zu programmieren. Durch Zellen Engineering neue Gen regulatorische Netzwerke enthalten, können die Forscher Zellen entwickeln, die eine Reihe von programmierten Verhalten zeigen. 8, 9 Jenseits der Grundlagenforschung, diese Verhaltensweisen für Anwendungen wie Material Montage Steuern und biologisch produzierenden Mehrwert-Produkte werden können. 10 Hierin wir ausführlich , wie wir die Werkzeuge der synthetischen Biologie verwendet , um eningenieur ein E. coli - Stamm, der Biotin bei Induktion synthetisiert. Dieser Stamm wurde unter Verwendung von Restriktionsenzym-Klonierungsverfahren entwickelt ein Plasmid, pKE1-lacI-bioB zu montieren. Dieses Plasmid, wenn es in E. coli - Stamm K-12 MG1655 transformiert, ausstattet Zellen mit der Fähigkeit , erhöhte Mengen an bioB, ein essentielles Enzym für die Biotin - Synthese zu exprimieren. Wenn transformierte Zellen mit Isopropyl-β-D-1-thiogalactopyranosid (IPTG) und mit einem Biotin-Vorläufer Desthiobiotin (DTB) induziert wurden, wurden erhöhte Spiegel an Biotin hergestellt.

Biotin der Bindungs-Wechselwirkung mit Streptavidin ist einer der stärksten nicht-kovalenten Bindungen in der Natur gefunden. Als solches ist das Biotin-Streptavidin-Wechselwirkung sowohl gut charakterisiertes und hoch in der Biotechnologie eingesetzt. 11 In diesem Manuskript, stellen wir zwei Strategien , um die Biotin-Streptavidin - Wechselwirkung unter Verwendung von zell hergestellt Biotin mit einer funktionalisierten Oberfläche zu erfassen und zu erkennen. Wirbeziehen sich auf diese kontrastierenden Oberflächen als "indirekte" und "direkt" Steuerungsschemata. Bei der indirekten Steuerschema, Zelle produzierte Biotin konkurriert mit Biotin, die für Streptavidin-Bindungsstellen auf einer Polystyroloberfläche konjugiert und immobilisiert wurde. Zusätzlich wird das Streptavidin mit Meerrettich-Peroxidase (HRP) konjugiert. HRP modifiziert 3, 3 ', 5, 5'-Tetramethylbenzidin (TMB), ein optisches Signal 12 zu erzeugen , die durch Quantifizierung der spektralen Extinktion (dh, optische Dichte) bei 450 nm (OD 450) überwacht werden kann. Somit erlaubt die indirekte Steuerschema Forscher durch die Überwachung der Abschwächung des OD 450 Signalzelle produzierten Biotin zu messen.

Die direkte Steuerungsschema nutzt die Streptavidin-Biotin-Ereignis durch Streptavidin direkt auf eine Materialoberfläche zu immobilisieren und ermöglicht Zelle produzierten Biotin und biotinylierte HRP für Streptavidin-Bindungsstellen zu konkurrieren. Wiederum ist dasrelativen Mengen an zell erzeugt Biotin sind durch Messen einer OD 450 - Signal überwacht.

Zusammengenommen sind die gentechnisch veränderten Zellen und funktionalisierten Oberflächen erlauben, die Eigenschaften eines programmierbaren Oberfläche zu steuern, indem Netzwerke in lebenden Zellen zu induzieren. Mit anderen Worten, haben wir ein System geschaffen, das gemeinsam durch die Verknüpfung dieser Systeme Vorteil der Anpassungsfähigkeit von lebenden Organismen und die Zuverlässigkeit und die Spezifikation einer engineered Materialgrenzfläche stattfindet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Medien und Kultur Vorbereitung

  1. Bereiten Sie LB-Medium (LB) Medien von 25 g LB Pulver stock Mischen mit 1 l entionisiertem (DI) Wasser und Autoklavieren der Lösung bei 121 ° C für 20 Minuten zu sterilisieren.
    1. LB-Platten, fügen Sie 15 g Agar (1,5%) auf die LB-Medien vor der Sterilisation Zur Vorbereitung
    2. Stocklösungen von 1,000x Carbenicillin (Cb) in DI-Wasser (50 mg / ml).
    3. Wenn die Vorbereitung LB-Medien, die ein Antibiotikum zur Selektion von resistenten Trans enthält, warten Sie, bis die sterilisierten LB-Medien, die Temperatur unter 60 ° C ist, und fügen Sie dann 1 ul Antibiotikum Lager für je 1 ml LB-Medien.
  2. Für M9 - Minimalmedium (Tabelle 1), bereiten getrennte Stammlösungen der folgenden: 5X M9 - Salze (56,4 g / l), 1 M MgSO 4, 1 M CaCl 2, 20% Glucose und 2% Biotin freien Casaminosäuren.
    1. In einem Autoklaven sicher Flasche, kombinieren 20 ml 5x M9-Salze, 200 &# 181; l 1 M MgSO 4, 10 & mgr; l 1 M CaCl 2, 2 ml 20% Glucose, 1 ml 2% biotinfreie Casaminosäuren und 76,8 ml DI - Wasser.
    2. Autoklaviert die in Schritt 1.2.1 bei 121 ° C hergestellten Lösung für 20 min.
  3. Inkubieren alle Kulturen bei 37 ° C unter Rühren bei 400 Upm. Inkubationszeiten variieren je nach Experiment und Dehnung, aber in der Regel 8 bis 12 h dauern.

2. Erzeugung von Biotin produzierende E. coli (Plasmid pKE1-lacI-bioB)

HINWEIS: Die genetische Schaltung enthält zwei Teile: ein lacI - Repressors, angetrieben durch einen P L, tetO-1 - Promotor in konstitutive Expression resultierende aufgrund der Abwesenheit eines tetR - Repressorprotein, sowie ein Biotin - Expressionssystem , enthaltend die P trc-2 Promotor durch eine starke Ribosomenbindungsstelle gefolgt (rbs) die Expression von bioB. Alle Klonierung erfolgte in einem handelsüblichen, sich schnell teilende E. coli ausgeführt strain. Das endgültige Konstrukt wurde in E. coli MG1655WT zum Testen transformiert. Primer (Tabelle 2) wurden im Handel erworben.

  1. Isolieren bioB - Gen aus E. coli - Genom durch Ganzzell - Polymerasekettenreaktion durchführt (PCR):
    1. Wachsen E. coli MG 1655WT Zellen über Nacht bei 37 ° C.
    2. In einem Röhrchen 0,2 ml PCR kombinieren 1 & mgr; l der Übernachtkultur in Schritt hergestellten 2.1.1 mit 9 ul sterilem deionisiertem Wasser.
    3. Inkubieren der Röhrchen bei 95 ° C für 5 min in einem Thermocycler und sofort das Rohr bis zu -80 ° C Gefrierschrank für 10 min übertragen, um die Zellen zu lysieren. Auf diese Weise können genomische DNA als PCR-Matrize zu dienen.
    4. Aufzutauen, die Lösung und füge (i) 2,5 & mgr; l von jedem der Primer nBioB2-f1 und nBioB2-R, (ii) 5 & mgr; l 5x DNA Polymerasepuffer, (iii) 0,25 & mgr; l DNA-Polymerase, (iv) 0,5 & mgr; l dNTP-Mix (v), und 6,75 & mgr; l DI-Wasser für eine Gesamtreaktionsvolumen von 25 & mgr; l(Tabelle 4).
    5. Schlagen Sie die Seite (dh Flick) das Rohr seinen Inhalt zu mischen. Als nächstes sofort drehe das Rohr schnell (~ 2 s) die Probe ist an der Unterseite des Rohres zu gewährleisten, nach unten.
    6. Das Röhrchen wird in einem PCR - Thermocycler und verwenden das Programm beschrieben in Tabelle 3 mit einem weiteren Schritt von 3 min bei 95 ° C zu Beginn des Protokolls.
    7. Bestätigen des erfolgreichen PCR unter Verwendung von Gel-Elektrophorese (1,0 bis 1,2% Agarose in DI-Wasser + Ethidiumbromid) in Tris-Base, Essigsäure und EDTA-Puffer (TAE). Das PCR-Produkt sollte 1.070 Basenpaare (bp) lang sein.
    8. Verwenden kommerzielle Kits den Anweisungen des Herstellers gemäß DNA-Fragmente aus Gel aus Schritt 2.1.7 extrahieren.
  2. Isolieren Sie die P trc-2 - Promotor und das lacI - Operon aus dem Plasmid pKDL071 13 ( mit freundlicher Genehmigung des Labors von James Collins am MIT):
    1. Wachsen E. coli - Zellen , enthaltenddas pKDL071 Plasmid über Nacht in LB + Cb bei 37 ° C.
    2. Extrahieren der Plasmid-DNA aus den Zellen Kommerzielle Miniprep Kit nach den Anweisungen des Herstellers. Das Plasmid wird als PCR-Matrize dienen.
    3. Folgen Sie dem PCR-Protokoll aus den Schritten 2.1.4. 2.1.8. mit folgenden Änderungen:
    4. Ersetzen Sie lysierten Zellen mit dem Plasmid-Extrakt in Schritt 2.2.2.
    5. Verwenden Sie 2,5 ul von jedem der Primer 1-f und 1-r für lacI Kassette Extraktion. Alternativ können Sie 2,5 ul von jedem der Primer nBioB1-f und nBioB1-r für P trc-2 - Extraktion.
    6. Führen Sie Gelelektrophorese (Schritt 2.1.7) die PCR - Produkte der lacI Kassette und P trc-2 - Promotorstelle sind zu bestätigen. Sie sollen 1213 bp und 109 bp lang sind.
  3. Verwenden Sie Spleißen durch überlappende Verlängerung (SOE) PCR die bioB Kassette zu bauen enthält P trc-2, eine synthetische Ribosomen - Bindungsstelle (RBS) in Primer nBioB2-f2 und die bioB Tabelle 3 gefunden.
  4. Insert - Konstrukte (P L, tetO-1 + lacI und P trc-2 + bioB) in das pKE1-MCS - Plasmidvektor 13 Rückgrat ( mit freundlicher Genehmigung des Labors von James Collins am MIT) durch den Vektor zu verdauen , und legen Sie mit Restriktionsenzymen:
    1. Extrahieren Sie Gene unter Verwendung von Restriktionsenzymen und Gelelektrophorese. Jede Reaktion enthält (i) 5 ul 10x Reaktionspuffer, (ii) 1 ul Restriktionsenzym-1, (iii) 1 ul Restriktionsenzym 2, (iv) mindestens 1 & mgr; g DNA, und (v) DI Wasser bringen um das Endvolumen auf 50 & mgr; l (Tabelle 5). Digest mit Enzymen AatII und EcoRI für die lacI Kassette und mit Enzymen HindIII und SacII für die bioB Kassette.
    2. Nachdem die Reaktionen zusammengebaut werden, vortexen sie schnell und kurz zentrifugieren (~ 2 s) vor der Inkubation für 1 h bei 37 ° C.
    3. WährendVerdau herzustellen Gelen für die Elektrophorese nach Standardprotokollen.
    4. Kombinieren Sie verdaute DNA mit Gelelektrophorese 6x Ladepuffer.
    5. Verwenden, um eine 2-log ladder Lage von gewünschten Konstrukts zu verifizieren, DNA-Fragment aus dem Gel ausgeschnitten, und kommerzielle Kits Gel Extraction Verwendung nach den Anweisungen des Herstellers DNA-Fragmente aus dem Gel zu extrahieren.
  5. Quantifizierung von DNA-Spektroskopie und berechnen Volumina für 0: 1, 1: 1 und 3: 1-Molverhältnisse von Insert zu Vektor unter Verwendung der Gleichung 1:
    Gleichung 1 Gleichung 1
    In Gleichung 1, M das Verhältnis von Insert zu Vektor (0, 1, oder 3), X i die Menge der Insert - DNA, Kp i ist die Länge des Einsatzes in Basenpaaren ist bp v die Länge des Vektors in Basenpaaren, und X v ist die Menge an Vektor (50 ng).
  6. Mischungs Ligierungsreaktion durch Vereinigen (i) 1 & mgr; l 10fach Ligasepuffer, (ii)1 ul T4 Ligase, (iii) 50 ng Vektor - DNA, (iv) eine Masse von Insert - DNA spezifisch für jede Reaktion und (v) DI Wasser auf 10 & mgr; l Gesamtreaktionsvolumen (Tabelle 6).
  7. Inkubieren bei Raumtemperatur (RT) für 1 h.
  8. Während der Ligatur Inkubation in Schritt 2.7, bereiten chemisch kompetente Zellen.
    1. Aliquot 1 ml über Nacht Kulturen in 1,5 ml Zentrifugenröhrchen.
    2. Zentrifuge bei 16.200 g für 1 min.
    3. Dekantiert den Überstand und das Pellet in 200 & mgr; l gekühltem (auf Eis) 100 mM CaCl 2. Das Pellet durch vorsichtiges Pipettieren. Nicht mit dem Vortex.
    4. Setzen Sie den Mikrozentrifugenröhrchen auf Eis für 10 min.
    5. Zentrifuge, entfernen Sie den Überstand, das Pellet in 100 ul gekühltes 100 mM CaCl 2, und legen Sie den Schlauch auf dem Eis wieder.
    6. Zentrifugieren Sie die Röhrchen ein letztes Mal und das Pellet in 50 ul gekühltes 100 mM CaCl 2.
    7. Ortdie Röhrchen auf Eis und nutzen Sie die chemisch kompetente Zellen sofort.
  9. Werden 5 ul der ligierten DNA, hergestellt in den Schritten 2.6 und 2.7, in jedes Röhrchen von kompetenten Zellen, hergestellt in Schritt 2.8.
  10. Man schüttelt das Rohr kurz durch die Seite fällt (dh Schnippen) die Rohre und legen Sie dann die Röhrchen auf Eis für 30 min.
  11. Hitzeschock die Rohre für 45 s bei 42 ° C und geben die Rohre zu Eis für 2 min.
  12. Pipette Zellen auf selektive LB-Agar + antibiotische Platten und verteilt die Zellen unter Verwendung von Glas Plattierung Perlen.
  13. Inkubieren der Platten über Nacht bei 37 ° C.
  14. Am nächsten Morgen holen Kolonien von Insert-positiven Platten (dh 1: 1 und 3: 1 - Platten). Pick 3 Kolonien, wenn die 0: 1 Negativkontrollplatte kein Wachstum zeigt, oder 5-8 Kolonien auszuwählen, wenn die 0: 1-Platte ein gewisses Wachstum hat. Verwenden Sie die aufgenommenen Kolonien zu impfen 5 ml LB + Antibiotikum und wachsen 8 h bei 37 ° C unter Rühren.
  15. Extrahieren der Plasmid-DNA aus den Zellen unter Verwendung eines miniprep-Kit nach den Anweisungen des Herstellers. Führen Sie einen Testschnitt unter Verwendung von Restriktionsenzymen (nach dem gleichen Verfahren detailliert in Schritt 2.4.1.).
  16. Identifizieren Zellen mit Konstrukten erfolgreich, indem die Länge der verdauten DNA-Fragmente mit den Ergebnissen zu vergleichen von einem korrekten Konstrukt erwartet. Kulturen Durchführung erfolgreicher Plasmidkonstrukte können durch Mischen von gleichen Teilen Kultur mit einer Lösung sterilfiltriert, 40% Glycerin (in VE-Wasser), und Einfrieren der Mischung bei -80 ° C aufbewahrt werden.
    HINWEIS: Transformationen von Plasmiden in anderen E. coli - Stämmen (dh MG1655WT) kann für die Herstellung von chemisch kompetente Zellen durch Befolgen des obigen Verfahrens durchgeführt werden.

3. Zellcharakterisierung: Wachstumskurve und Dosis-Wirkungs

  1. Wachsen entwickelt Stämme über Nacht in LB-Medium mit einem geeigneten Antibiotikum.
  2. Für Wachstumskurven, bereiten 50 ml minimal M9 - Medium mit und ohne IPTG (von 0,5 M stock) und / oder DTB (von 500 ug / ml Stamm) wie folgt:
    1. Bereiten 0 ng / mL DTB (0 ul Stamm) / 0 mM IPTG (0 ul Stamm).
    2. Bereiten Sie 200 ng / mL DTB (200 ul Stamm) / 0 mM IPTG (0 ul Stamm).
    3. Bereiten 0 ng / mL DTB (0 ul Stamm) / 0,5 mM IPTG (50 & mgr; l Lager).
    4. Bereiten Sie 200 ng / mL DTB (200 ul Stamm) / 0,5 mM IPTG (50 & mgr; l Lager).
    5. Beimpfen mit Übernachtkultur bei 1: 100 in den Medien oben angegeben.
    6. In einer 96-Well-Platte, aliquoten 200 ul der Kultur, in dreifacher Ausfertigung, in jede Vertiefung.
    7. Messung der OD 600 alle 5 min über 24 h unter kontinuierlichem Schütteln und Inkubation bei 37 ° C in Plattenlesegerät.
  3. Für Dosis - Wirkungs - Studien, ersetzen Sie das bioB Gen in pKE1-lacI-bioB mit mCherry (ein rot fluoreszierendes Protein) für die Echtzeit optische Quantifizierung.
  4. Hinzufügen Mengen von IPTG Variation im Bereich von 0,1 mM bis 5 mM Expression zu induzierenin LB-Medien.
  5. Impfen mit Nacht-Kultur in einer Verdünnung von 1: 100.
  6. Messen Sie Fluoreszenz alle 30 Minuten für 15 h.

4. Induzierende Biotin Produktion von gentechnisch veränderten Zellen und Supernatant Vorbereitung

  1. Wachsen pKE1-lacI-bioB in den E. coli MG1655 Stamm über Nacht in LB - Medien.
  2. Ergänzung M9 Medium mit DTB Bereich von 30 bis 200 ng / mL.
  3. Mit 0,5 mM IPTG Biotinsynthese zu induzieren.
  4. Impfen ergänzt, Biotin freie minimal M9-Medium mit Nacht-Kultur bei 1: 100 Verdünnung.
  5. Nach 24 h des Wachstums, der Überstand Zentrifugenzellen und sammeln das Biotin-angereichert ist.
  6. Messen Sie Biotin angereicherte Überstand mit der indirekten Kontrolle und der direkten Kontrolle funktionalisierten Oberflächen. Verwenden Sie den Überstand anstelle des Biotins Probe in Schritten 5.23 und 6.12, respectively.

5. Indirekte Steuerschema Funktionalisierte Oberflächenvorbereitung

  1. bereiten Sie the folgende Lösungen.
    1. Bereiten einer SMCC-Lösung bestehend aus 20 mg / ml Succinimidyl trans-4- (maleimidylmethyl) cyclohexan-1-carboxylat (SMCC) in Dimethylsulfoxid (DMSO).
    2. Bereiten einer SPDP-Lösung bestehend aus 20 mg / mL von Succinimidyl 3- (2-pyridyldithio) propionat (SPDP) in DMSO.
    3. Es werden 20 mg / ml LC-LC-Biotin in DMSO.
    4. Herstellung von 10 mg / ml Meerrettich-Peroxidase (HRP) in phosphatgepufferter Salzlösung (PBS).
    5. Herstellung von 10 mg / ml Streptavidin (SA) in PBS.
    6. Herstellung von 10 mg / ml Rinderserumalbumin (BSA) in PBS.
    7. Bereiten 100 mM Dithiothreitol (DTT) in DI-Wasser.
    8. Bereiten Sie 5 mM ethylenediaminetetaacetic (EDTA) in PBS.
    9. Bereiten Sie 0,5% Casein in PBS.
    10. Es werden 20% Tween 80 Lager in DI-Wasser.
    11. Bereiten 0,05% Tween 80 (von 20% Lager) in PBS.
    12. Vorbereitung 50 mM Natriumacetat in DI Wasser.
    13. Bereiten Sie 1% TMB in DMSO.
    14. Vorbereitung 3% H 2 O 2 in DI-Wasser.
    15. Bereiten Sie 2 MH 2 SO 4 in DI - Wasser.
  2. In 1,4 ul der SPDP Lösung auf 20 & mgr; l SA-Lösung.
  3. Inkubieren der Lösung von 5,2 1,5 h bei RT, in Aluminiumfolie eingewickelt Lichteinwirkung zu vermeiden. Dieser Schritt erlaubt es dem SPDP Vernetzer SA über eine Aminogruppe zu binden, um einen pyridyldithio aktivierte SA bilden.
  4. Fügen 2,4 ul der DDT-Lösung zu der Lösung aus Schritt 5.3 und Inkubation für 1 h bei RT. Dies ermöglicht eine Pyridin-2-thion-Spaltung, was zu einem Sulfhydryl-aktivierte SA.
  5. 7.5 ul SMCC-Lösung zu 72 & mgr; l HRP-Lösung und Inkubation für 1,5 h bei RT in Aluminiumfolie eingewickelt Lichteinwirkung zu vermeiden. Dies führt zu einem Maleimid-aktivierte HRP durch eine Aminogruppe gebunden ist.
  6. Mischen Sie 17 & mgr; l LC-LC-Biotin-Lösung mit 200 ul BSA-Lösung und Inkubation für 1,5 h bei RT in Aluminiumfolie eingewickelt Lichteinwirkung zu vermeiden. Dieser Schritt ermöglicht Biotin-Konjugat to BSA über eine Amidbindung.
  7. Übertragen Sie die Lösungen aus den Schritten 5.4, 5.5 und 5.6 Zentrifugalkonzentratoren innerhalb Spin Rohre zu trennen.
  8. Für Rohre SA-SPDP enthält, aus Schritt 5.4, Zentrifuge bei 10.000 × g, bis das Rohrvolumen erreicht 100 & mgr; l oder 16 min. Füllen Sie das Zentrifugenröhrchen bis 500 & mgr; l mit PBS-EDTA.
    1. Wiederholen Sie Schritt 5.8 fünfmal. Lagern Sie die Lager bei 4 ° C.
  9. Für Röhrchen mit HRP-SMCC, aus Schritt 5.5, Zentrifuge bei 10.000 × g , bis das Volumen 25 & mgr; l oder 16 min erreicht. Füllen Sie das Zentrifugenröhrchen bis 500 & mgr; l mit PBS.
    1. Wiederholen Sie Schritt 5.9 fünfmal. Lagern Sie die Lager bei 4 ° C.
  10. Für Röhrchen , die BSA-Biotin, aus Schritt 5.6, Zentrifuge bei 10.000 × g , bis das Volumen 100 & mgr; l oder 12 min erreicht. Füllen Sie das Zentrifugenröhrchen bis 500 & mgr; l mit PBS.
    1. Wiederholen Sie Schritt 5.10 viermal.
    2. Zentrifuge bei 10.000 xg bis das Volumen erreicht 100 uloder für 12 min. Füge 100 & mgr; l PBS in das Röhrchen. Lagern Sie die Lager bei 4 ° C.
  11. In 25 ul der 10 mg / ml HRP - Lösung mit 25 & mgr; l von 10 mg / ml Lösung SA und lagern bei 4 ° C über Nacht. Dies bewirkt , dass die SA mit dem HRP über eine Thioetherbindung konjugiert zu werden.
    1. Bereiten Sie eine 1: 4 Arbeitslösung mit der über Nacht Lösung und Store in 4 ° C Kühlschrank. Store verbleibende Lösung bei -20 ° C.
  12. Bereiten Sie zwei Lösungen, bestehend aus BSA-Biotin (oder BSA) in PBS, durch Zugabe von 10 & mgr; l BSA-Biotin-Lager (oder 10 & mgr; l BSA-Stamm) bis 490 & mgr; l PBS.
  13. Füge 100 & mgr; l der Lösung von Schritt 5.12 in jede Vertiefung einer 96-Well-Polystyrol-Platte.
  14. Inkubieren der Platte bei 37 ° C für 1 h, in Folie verpackt.
  15. Waschen Sie die Vertiefungen der Platte mit 0,05% Tween 80.
    1. Mit 200 & mgr; l 0,05% PBS-Tween 80 in die Vertiefungen. Inkubieren für 2 min bei RT. Die Flüssigkeit.
    2. <li> Wiederholen Sie Schritt 5.15.1 dreimal.
  16. Mit 200 & mgr; l der 0,5% igen Casein-Lösung zu jeder der Vertiefungen in der Platte mit 96 Vertiefungen.
  17. Inkubieren der Platte bei 37 ° C für 1 h.
  18. Wiederholen Sie Schritt 5.15 Vertiefungen dreimal zu waschen.
  19. Bereiten Sie eine Lösung, die durch Mischen von 12 ml 0,5% Casein-Lösung mit 7,5 ul von 0,05% Tween 80.
  20. Verdünnen Sie die SA-HRP Lager 1: 10.000, die Lösung in Schritt 5.19 vorbereitet werden.
  21. Hinzuzufügen 80 ul der Lösung, hergestellt in Schritt 5.20 an jede Vertiefung einer 96-Well-Platte.
  22. Geben Sie 20 & mgr; l der hergestellten Biotin Probe in jede Vertiefung der Polystyrol-Platte. Der Überstand, hergestellt in 4,6 kann als Biotin Probe in diesem Schritt verwendet werden.
  23. Inkubieren der Platte bei 37 ° C für 1 h. Dieser Schritt ermöglicht eine wettbewerbsfähige zwischen freien Biotinbindung und BSA-Biotin für SA-HRP-Bindungsstellen zu immobilisieren.
  24. Wiederholen Sie Schritt 5.15 Vertiefungen dreimal zu waschen.
  25. Mischungs 50 mM Natriumacetat-Lösung, 1% TMB-Lösung,und 3% H 2 O 2 -Lösung bei einem 1000: 10: 1 - Verhältnis (20 ml Gesamtvolumen).
  26. Mit 200 & mgr; l der Lösung von Schritt 5.25 in jede Vertiefung und damit mit einer Folie für 15 min bei RT, abgedeckt zu sitzen.
  27. Zugabe von 50 & mgr; l von 2 MH 2 SO 4 zu jeder Vertiefung , die Reaktion zu stoppen. Messen OD 450 einen Plattenleser.

6. Direct Control Scheme Funktionalisierte Oberflächenvorbereitung

  1. Bereiten Sie die folgenden Lösungen.
    1. Es werden 20 mg / ml LC-LC-Biotin in DMSO.
    2. Herstellung von 10 mg / ml HRP in PBS.
    3. Bereiten 0,17 ug / ml SA in PBS.
    4. Bereiten Sie 0,5% Casein in PBS.
    5. Es werden 20% Tween 80 Lager in DI-Wasser.
    6. Bereiten 0,05% Tween 80 (von 20% Lager) in PBS.
    7. Vorbereitung 50 mM Natriumacetat in DI Wasser.
    8. Bereiten Sie 1% TMB in DMSO.
    9. Bereiten Sie 3% H 2 O 2 in DI - Wasser.
    10. Bereiten Sie 2 MH 2 SO 4 Wasser.
  2. 7.5 ul LC-LC-Biotin bis 72 & mgr; l HRP und Inkubation bei 1,5 h bei RT, in Aluminiumfolie eingewickelt Lichteinwirkung zu vermeiden. Dieser Schritt bewirkt, dass Biotin-Konjugats an HRP über eine Amidbindung.
  3. Transfer der Lösung aus Schritt 6.2 zu einer Zentrifugalkonzentrator innerhalb eines Spinnschachtes
    1. Zentrifugieren Sie die Lösung bei 10.000 × g, bis das Volumen erreicht 100 & mgr; l oder 12 min. Füllen Sie das Zentrifugenröhrchen bis 500 & mgr; l mit PBS und wiederholen Sie die Zentrifugation und PBS zusätzlich viermal. Lagern Sie die Lager bei 4 ° C.
  4. Fügen Sie die 100 & mgr; l der SA-Lösung von 6.1.3 zu jeder Vertiefung in einer 96-Well Polystyrolplatte.
  5. Inkubieren der Platte bei 37 ° C für 1 h, in Folie verpackt.
  6. Waschen Sie die Vertiefungen der Platte mit 0,05% Tween 80.
    1. Mit 200 & mgr; l 0,05% Tween 80 in die Vertiefungen. Inkubieren für 2 min bei RT. Die Flüssigkeit.
    2. Wiederholen 6.6.1 dreimal.
  7. Mit 200 & mgr; l der 0,5% igen Casein-Lösung zu jeder der Vertiefungen in der Platte mit 96 Vertiefungen.
  8. Inkubieren der Platte bei 37 ° C für 1 h.
  9. Wiederholen Sie Schritt 6.6 dreimal die Brunnen zu waschen.
  10. Verdünnen Sie die Biotin-HRP Lager 1: 10.000, die Lösung in Schritt 6.3 vorbereitet werden.
  11. Hinzuzufügen 80 ul der Lösung, hergestellt in Schritt 6.10 an jede Vertiefung einer 96-Well-Platte.
  12. Geben Sie 20 & mgr; l der hergestellten Biotin Probe in jede Vertiefung der Polystyrol-Platte. Der Überstand, hergestellt in 4,6 kann als Biotin Probe in diesem Schritt verwendet werden.
  13. Inkubieren der Platte bei 37 ° C für 1 h. Dieser Schritt ermöglicht eine wettbewerbsfähige zwischen freiem Biotin und Biotin-HRP für immobilisiert SA-Bindungsstellen zu binden.
  14. Wiederholen Sie Schritt 6.6 Vertiefungen dreimal zu waschen.
  15. Mischungs 50 mM Natriumacetat - Lösung, 1% TMB - Lösung und 3% H 2 O 2 -Lösung bei einem 1000: 10: 1 - Verhältnis (20 ml Gesamtvolumen).
  16. Mit 200 & mgr; l der Lösung von Schritt 6.15 in jede Vertiefung und mit Folie für 15 min bei RT, abgedeckt inkubiert.
  17. In 50 & mgr; l von 2 MH 2 SO 4 -Lösung zu jeder Vertiefung die Reaktion zu stoppen. Messen OD 450 einen Plattenleser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Repräsentative Ergebnisse sind in den beigefügten fünf Figuren dargestellt. Zunächst stellen wir die Klonprozess grafisch (Abbildung 1) , so dass der Leser visuell die entscheidenden Schritte für die Erstellung der synthetisch konstruierte E. coli - Stamm folgen kann. Um die Populationsdynamik der Zellen zu kennzeichnen, stellen wir eine Wachstumskurve (Figur 2) erzeugt , indem die optische Dichte bei 600 nm (OD 600) der Population zu messen. Dann zeigen wir , wie das regulatorische Gen - Netzwerk überprüft wird, unter Verwendung von mCherry als Proxy für bioB (Abbildung 3), so dass wir die optisch an die relative Menge an bioB messen , die von der Zelle nach Induktion mit IPTG erzeugt werden würde. Als nächstes stellen wir Antwortdaten für die indirekte Steuerung und Direktsteuerung funktionalisierten Oberflächen. Diese Diagramme (Abbildung 4) wurden unter Verwendung von gemessenen Lösungen von freiem entwickeltBiotin die funktionalisierten Oberflächen "Reaktionsprofile zu charakterisieren. Schließlich stellen wir Kenndaten zeigt , wie die gentechnisch veränderten Zellen werden induziert , an Biotin (Abbildung 5) zu erzeugen, wodurch die funktionalisierten Oberflächen zu modifizieren.

Abbildung 1
Abbildung 1: Planung und Bau von induzierbare, manipulierten Zellen. (A) Die Primer wurden entworfen , um die bioB - Gen aus dem E. coli Genom zu isolieren, die in der Biotin - Synthesewegs eine entscheidende Enzym kodiert. (B) Die P L, tetO-1 -lacI und P trc-2 - Sequenzen von einem Plasmid isoliert werden , um einen genetischen Schalter mit entsprechenden Primern enthält. (C) Das extrahierte bioB - Gen und die beiden Fragmente aus dem Kippschalter kann dann verwendet werden , um das Gen Schaltung zu schaffen. Die Zugabe von IPTG kann dann indUCE die Expression von bioB und dadurch Biotinsynthese wenn DTB als Substrat für bioB hinzugefügt wird. (D) Das zusammengesetzte Plasmid in K-12 MG1655 E. coli transformiert wurde. Dies verursacht die Anwesenheit von IPTG die Expression von bioB zu induzieren und dadurch Biotin - Synthese durch die engineered Zellinie wenn DTB als Substrat bereitgestellt wurde. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2: Wachstumskurven für gentechnisch veränderten Zellen. Die gentechnisch induzierbare MG1655 Wildtyp - Zellen wurden in Minimalmedien (dh Biotin freien M9 - Medien) sowie Minimalmedium , supplementiert mit DTB (200 ng / ml) und / oder IPTG (0,5 mM) gezüchtet und überwacht. Die Diagramme zeigen die OD 600 lesen, gemessen alle 5 mi n für 24 h. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3: Testen des Engineered Gen - Netzwerk. Das fluoreszierende Protein mCherry wurde anstelle von der verwendeten bioB Gen , so dass wir optisch die Induktionsprofil messen konnte , wenn gentechnisch veränderten Zellen mit IPTG induziert wurden. Wir Kontrast, die mit IPTG (rote Rhomben) induzierten Zellen mit den Zellen nicht mit IPTG (blaue Rauten) induziert. Diese Ergebnisse zeigen die Wirksamkeit des induzierbaren Gen-Netzwerk. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

/55300/55300fig4.jpg "/>
Abbildung 4: Überprüfung der Funktionalisierte - Material - Schnittstelle. Durch Aussetzen unserer funktionalisierten Oberflächenkonzentrationen von Biotin variiert, sind wir in der Lage , die optische Reaktion zu messen , indem OD 450 Absorption zu messen. Diese Ergebnisse ermöglichen es uns, eine Kalibrierungskurve zu erzeugen, die Verknüpfung, die Konzentration von Biotin an die optische Intensität der Antwort. Hier präsentieren wir die Biotin gegenüber dem optischen Signalkurven für die beiden indirekten (links) und direkte (rechts) funktionalisierten Oberfläche Schemata. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 5
Abbildung 5: manipulierte Zellen Kontrollmaterial Schnittstelle. Durch die Verwendung von Protokollabschnitte 5 oder 6, sind wir in der Lage, die Produkte von induzierten, engineered c zu verwenden,ells chemisch die funktionalisierte Oberfläche zu modifizieren. Wir können diese Antworten überwachen optisch von 450 OD Messung. Ferner kann durch die Kalibrierungskurve in Abbildung entwickelt unter Verwendung von 4, kann man die optische Intensität der Reaktion auf das Biotin innerhalb des Konzentrations verbinden. Wir stellen Ihnen hier die verschiedenen Biotin-Konzentrationen, die von unserer indirekten Steuerschema funktionalisierten Oberfläche gemessen, für Wildtyp-Zellen (weiß), nicht-induzierten Zellen, die die pKE1-lacI-bioB Plasmid (orange) enthält, und induzierten Zellen mit dem pKE1-lacI-bioB Plasmid (grau). Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Chemisch Endkonzentration Menge
5x M9-Salze 1x 20 ml
1 M MgSO 4 2 mM 200 ul
1 M CaCl 2 0,1 mM 10 & mgr; l
20% Glucose 0,40% 2 mL
2% Biotin freie Casaminosäuren 0,02% 1 ml
DI-Wasser N / A 76,8 ml

Tabelle 1: M9 Medien Rezept.

Name Primer - Sequenz Verwendung
1-f CCGCCGGAATTCTCCCTATCAGTGATAGAGATT lacI Kassettenentnahme
1-r CCGACGTCTCACTGCCCGCTTTCCAGTC lacI Kassettenentnahme
nBioB1-f CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P trc-2 - Extraktion
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P trc-2 - Extraktion
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG bioB Extraktion
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC bioB Extraktion
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC Synthetische RBS zusätzlich

Tabelle 2: Liste der Grundierungen.

Schritt 1
Schritt 2 Schritt 3 Schritt 4 Schritt 5 Schritt 6 Schritt 7 Schritt 8 Schritt 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
0.30 00.10 0.30 01: 00 / kb 00.10 0.30 01: 00 / kb 02.00
12 mal wiederholen, Wiederholen 25mal
-1 ° C / Zyklus

Tabelle 3: PCR - Programm.

Name Volumen
Zelllysat (template) 10 & mgr; l
Primer (je) 0.625 & mgr; l (je)
5x Q5 Puffer 5 ul
Q5 Polymerase 0,25 & mgr; l
dNTP Mix 0,5 ul
DI-Wasser 6,75 & mgr; l

Tabelle 4: Ganzzellen - PCR - Reaktion (25 & mgr; l).

Name Volumen
10x Reaktionspuffer 5 ul
Enzyme 1 1 ul
Enzyme 2 1 ul
Template-DNA 1 & mgr; g
DI-Wasser 43 & mgr; l - Volumen von DNA

Tabelle 5: Restriktionsenzymverdau Reaktion (50 & mgr; l).

Name Volumen
DNA 50 ug Vektor + X ug Insert
10fach Ligasepuffer 1 ul
T4 Ligase 1 ul
DI-Wasser 8 & mgr; l - Volumen von DNA

Tabelle 6: Ligatur Reaktion (10 & mgr; l).

Name Konzentration Notizen
CaCl 2 100 mM
Carbeniccilin 50 mg / ml (1000x)
DTB 50 ug / ml
IPTG 0,5 M
SMCC 20 mg / mL 2 mg in 100 ul DMSO
SPDP 20 mg / mL 2 mg in 100 ul DMSO
LC-LC-Biotin 20 mg / mL 2 mg in 100 ul DMSO
HRP 10 mg / mL in PBS
SA (indirekt) 10 mg / mL in PBS
SA (direkt) 0,17 & mgr; g / mL in PBS
BSA 20 mg / mL in PBS
DTT 100 mM In DI-Wasser
EDTA 5 mM 18,6 mg in 10 ml PBS
Kasein 0,50% in PBS
Tween 80 20% In DI-Wasser
Tween 80 in PBS 0,05%
Natriumacetat 50 mM In DI Wasser, einstellen auf 5,1 pH mit 3 M HCl
TMB 1% in DMSO
H 2 O 2 3% In DI-Wasser
H 2 SO 4 2 M In DI-Wasser

Tabelle 7: Liste der Reagenzlösungen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Wir haben für die Anbindung entwickelt lebenden Zellen mit einem funktionalisierten Materialoberfläche eine neue Strategie vorgestellt. Dies wurde durch die Entwicklung einer Zelllinie erreicht der Lage, erhöhte Konzentrationen von Biotin zu synthetisieren, wenn sie mit IPTG induziert. Die erhöhten Mengen an Biotin kann dann verwendet werden, um die funktionalisierte Oberfläche zu modifizieren. Die Protokolle detailliert , wie die E. coli - Zelllinie zu entwickeln und , wie zwei verschiedene funktionalisierte Oberflächen zu schaffen.

Kritische Schritte in diesem Protokoll kommen überall in der Konstruktion der konstruierten Zelllinie. Um Downstream - Probleme zu vermeiden, die gentechnisch veränderten Zellstämme mit beiden Wachstumskurven zu charakterisieren (Abbildung 2) und Fluoreszenzantwort (Abbildung 3) gefördert wird . Sollte Verfahrensfragen entstehen, andere molekulare Klonierstrategien, wie PCR Extraktion und Gibson Anordnung 14 kann für die Schritte ersetzt werden gegebenenfalls. Für die Biotin yie Optimierungld der Zelllinie entwickelt, ist es entscheidend, dass eine ausreichende Menge von DTB zu gewährleisten wird den Zellen zur Verfügung gestellt. In unseren Untersuchungen haben wir festgestellt, dass 200 ng / mL DTB eine wesentliche und statistisch signifikante Erhöhung der Biotinproduktion hervorgerufen, wenn die Zellen mit IPTG induziert wurden. Darüber hinaus erfolgreiche Konjugation von BSA-Biotin, SA-HRP und Biotin-HRP ist von entscheidender Bedeutung für die wirksame Durchführung und Überwachung der indirekten und direkten Steuerungsschemata. Achten Sie darauf, unnötige Lichteinwirkung vermieden werden und die Konjugate über Nacht bei 4 ° C inkubiert ein wirksames Konjugat, um sicherzustellen, gebildet wird.

Unser Protokoll bietet Vorteile gegenüber alternativen Methoden 15 aufgrund seiner Fähigkeit , kleine Mengen von Biotin zu detektieren , die biologisch von Bedeutung sind (pg / ml - Maßstab) im Vergleich zu handelsüblichen Biotin Nachweiskits, wie solche auf Basis von 4'-Hydroxyazobenzol-2-carbonsäure kompetitiver Bindungsstrategien. Obwohl die Verwendung der Streptavidin-bioZinn - System ist in der Biotechnologie 16, 17, unser System in der Lage ist zu reagieren , um geringe Mengen an Biotin ermöglicht es uns , unsere gemeinsamen direkt gentechnisch veränderten Zelllinie mit der funktionalisierten Oberfläche zu verbinden.

Eine mögliche Einschränkung unseres Protokolls ist die resultierende Dynamikbereich von Biotin-Erkennung. Bei den indirekten und direkten Steuerungsschemata, sind wir in der Lage Biotin zwischen 10 2 bis 10 3 und 10 4 -10 6 pg / ml, bzw. (Abbildung 4) zu erkennen. Glücklicherweise erlaubt die geringe Reichweite der indirekten Steuerschema uns leicht Biotin Produktion von gentechnisch veränderten Zellen zu erkennen. Jedoch begrenzt die enge Band der indirekten Kontrolle Dynamikbereich seine Fähigkeit, große Veränderungen (100-fach) in Biotinkonzentrationen zu messen. Die Veränderung der Dynamikbereich sowohl für die indirekte und direkte Steuerungsschemata würden zusätzliche Engineering erfordern. Wenn jedoch Nachweis von zell produzierend Biotin ist ein Problem, Verdünnungen des Biotin Überstand in Schritt Vorbereitung 4.6 sollte der Forscher ermöglichen den dynamischen Bereich der indirekten Steuerschema zu zielen (Abbildung 5). Wir fanden, dass eine 1: 5-Verdünnung des Überstandes erlaubt uns effektiv die indirekten Steuerschema der dynamischen Bereich zu zielen. Diese Verdünnung Strategie sollte die Notwendigkeit, zu lindern, den Dynamikbereich direkt zu ändern.

Die zweiteilige, Zellstoffsystem hier vorgestellten ermöglicht Zellen entwickelt, um die Zusammensetzung einer funktionalisierten Oberfläche zu modifizieren. Dynamische, lebende Zellen können ihre chemische Umgebung interpretieren eine genetische Reaktion zu erzeugen. Von Engineering diese genetische Reaktion Biotinproduktion zu erhöhen, können wir engineered lebenden Zellen mit der Fähigkeit auszustatten, eine funktionalisierte Oberfläche zu steuern und zu manipulieren. Indem Sie die Protokolle vorgestellt, sind gentechnisch veränderten Zellen können als dynamische Sensoren, in der Lage zu lesen, die Verarbeitung zu handeln, und die Aufzeichnung der Bedingungen rund um them über funktionalisierte Schnittstellen. Diese Technologie könnte Felder aus der molekularen Medizin Analytennachweisregion für Umweltsanierung im Bereich auswirken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Die Autoren danken Unterstützung von preis FA9550-13-1-0108 von der Air Force Office of Scientific Research der USA. Die Autoren erkennen zusätzlich Unterstützung von preis N00014-15-1-2502 vom Office of Naval Research der USA, aus dem Institut die Finanzierung für kritische Technik und angewandte Wissenschaft an der Virginia Polytechnic Institute und State University und der National Science Foundation Graduierten Fellowship-Programm, Verleihungsnummer 1607310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics