ال

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

يعرض الأمعاء بنية هياكل سرداب المتكررة التي تتكون من أنواع مختلفة من الخلايا الظهارية، propia الصفيحة التي تحتوي على الخلايا المناعية، وسدى. كل من هذه الخلايا غير متجانسة تساهم في التوازن المعوي والمشاركة في دفاع المضيف مضادات الميكروبات. لذلك، وتحديد نموذج بديل لدراسة الاستجابة المناعية والنشاط المضادة للميكروبات الأمعاء في الإعداد في المختبر هي صعبة للغاية. في الدراسات المختبرية باستخدام خلد خطوط الخلايا الظهارية في الأمعاء أو سرداب حتى الابتدائي عضي الثقافة لا تمثل علم وظائف الأعضاء الدقيق الأمعاء الطبيعي والمكروية لها. هنا، نحن نناقش طريقة لزراعة الأنسجة الماوس القولون في طبق ثقافة، وكيف يمكن تنفيذ هذا المجراة سابقا نظام الجهاز ثقافة في الدراسات المتعلقة الردود دفاع المضيف مضادات الميكروبات. في التجارب التمثيلية، أظهرنا أن كولون في الثقافة الجهاز تعبر عن الببتيدات المضادة للميكروبات في التنonse إلى دخيلة IL-1β و IL-18. وعلاوة على ذلك، فإن الجزيئات المستجيب المضادة للميكروبات التي تنتجها الأنسجة القولون في الثقافة الجهاز تقتل بكفاءة القولونية في المختبر. هذا النهج، وبالتالي، يمكن استخدامها لتشريح دور أنماط الجزيئية pathogen- ويرتبط خطر والمستقبلات الخلوية في تنظيم المعوية الاستجابات المناعية الفطرية والاستجابات دفاع المضيف مضادات الميكروبات.

Introduction

يمثل الأمعاء نظام ديناميكي يعمل كحاجز للالكائنات الدقيقة المتعايشة، وتحارب ضد مسببات الأمراض الغازية، وينظم تكوينه الميكروبي 1. الخلايا الظهارية في الأمعاء، ويتألف من المعوية والخلايا الكأسية، والخلايا بانيت والخلايا enteroendocrine، هي سكان الخلية الرئيسية التي توفر الردود دفاع المضيف ضد الجراثيم المعوية. الخلايا الكأسية تنتج mucins أن إنشاء منطقة منزوعة السلاح على الجزء العلوي من طبقة الطلائية 2. الخلايا بانيت والمعوية تنتج الببتيدات المضادة للميكروبات، السيتوكينات، والأكسجين والنيتروجين الأنواع المتفاعلة التي تشكل الردود دفاع المضيف مضادات الميكروبات والمساهمة في تشكيل وتكوين الجراثيم المعوية 3 و 4. بالإضافة إلى الخلايا الظهارية، والخلايا المناعية بما في ذلك الضامة، والخلايا الجذعية، العدلات، والخلايا القاتلة الطبيعية، الخلايا الليمفاوية، واينا الخلايا اللمفاوية الشركة المصرية للاتصالات في الصفيحة المخصوصة وتحت المخاطية تلعب دورا حاسما في الردود دفاع المضيف مضادات الميكروبات المعوية من خلال إنتاج السيتوكينات، كيموكينات، وغيرها من الوسطاء 5-7. من أجل فهم كيف يمكن لنظام المناعة المخاطية ينظم الجراثيم ويوفر الحماية ضد العدوى الميكروبية، فمن المهم النظر في التفاعل المعقد للسكان الخلية غير متجانسة من القناة الهضمية. ومع ذلك، وهو نموذج في المختبر الذي يشمل جميع الميزات الموجودة في الأمعاء غير متوفر. لذلك، والدراسات الجزيئية على تفاعل المضيف الممرض في الأمعاء تشكل تحديا للغاية.

على مدى السنوات القليلة الماضية، وقد تم تطوير عدة أنظمة نموذج التي تحاكي جوانب الغشاء المخاطي في الأمعاء عن التحقيق في العمليات الفيزيولوجية المرضية تشارك في الأمراض الالتهابية الأمعاء (IBD) وغيرها من اضطرابات الجهاز الهضمي 8 -= "XREF"> 14. وغالبا ما تستخدم خطوط الخلايا الظهارية في الأمعاء خلد لدراسة الخلايا الظهارية استجابات محددة. ومع ذلك، لأن التعبير الجيني التفاضلية وظيفة في الخلايا خلد، حصلت على البيانات من استخدام هذه الخلايا غالبا ما لا تتطابق مع تلك التي لوحظت في الدراسات المجراة. سرداب الأمعاء عضي الثقافة برزت مؤخرا كأداة محتملة لتقييم استجابة ظهارة الأمعاء لمختلف المحفزات 13. في هذا النظام، ويسمح للخلايا الجذعية سرداب في النمو وتطوير هيكل عضوي الشكل 3D. في حين أن نظام الثقافة عضوي الشكل هو مفيد جدا لدراسة جوانب كثيرة من ظهارة الأمعاء، فإنه لا تحاكي التفاعل المعقد بين الخلايا المناعية والخلايا الظهارية والمنتجات الميكروبية. ثقافة فيفو السابقين من الأنسجة المعوية تقدم تمثيل أفضل للفي الجسم الحي الردود دفاع المضيف. في هذه الطريقة، وهي جزء من الأمعاء هو مثقف في لوحة الثقافة خلية خفة دمح وسائل الإعلام المناسبة السماح للأنواع المختلفة من السكان الخلية في الأمعاء وتكون نشطة عملية الأيض لمدة 48 ساعة على الأقل. وبالتالي، ثقافة فيفو السابقين من الجهاز يمكن استخدامها لقياس التعبير عن الجينات المضادة للميكروبات والردود دفاع المضيف من الأمعاء لحافز معين.

وكان المحققون باستخدام نظام الجهاز ثقافة فيفو السابقين لدراسة الردود دفاع المضيف ضد العدوى الميكروبية في الأمعاء 15-21. اعتمدنا مؤخرا نظام الثقافة الجهاز لدراسة دور inflammasome في الردود دفاع المضيف مضادات الميكروبات في كولون الماوس 22. وinflammasome هي عبارة عن منصة الجزيئية لتفعيل كاسباس 1، وهو مطلوب لإنتاج نضجت IL-1β و IL-18. أظهرنا أن IL-1β و IL-18 حمل الببتيدات المضادة للميكروبات التي تقتل بشكل فعال pathobionts المتعايشة مثل كولاي كولاي في كولون الماوس inflammasome معيب 22. هذا النظام وبالتالي يمكن استخدامها لدراسة دور مستقبلات التعرف على الأنماط (PRRs) وغيرها من الجزيئات المناعية الفطرية في ردود دفاع المضيف مضادات الميكروبات المعوية وكذلك التسبب في اضطرابات الأمعاء مثل مرض التهاب الأمعاء (IBD) وسرطان القولون والمستقيم (CRC). هناك أكثر من 200 الجينات IBD قابلية، والطفرات في كثير من هذه الجينات ترتبط مع تكوين الجراثيم تغير في القناة الهضمية. ومن الأهمية السريرية كبيرة لتحديد الآلية الدقيقة التي من خلالها الجينات IBD-القابلية تنظم الجراثيم القناة الهضمية. ويتمثل الهدف العام من هذه الطريقة لإدخال البروتوكول الأساسي من خارج الحي الثقافة الجهاز القولون وإظهار كيف أن هذا الأسلوب يمكن استخدام الثقافة لدراسة الردود دفاع المضيف مضادات الميكروبات في الأمعاء.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

أجريت جميع التجارب وصفها هنا باستخدام الذكور من النوع البري (C57BL6 / J) الفئران 6-8 أسابيع من العمر الاحتفاظ بها في حر (SPF) منشأة الممرض محددة في مركز الثروة الحيوانية (ARC)، UT جنوب غرب المركز الطبي. تمت الموافقة على جميع الدراسات من قبل لجنة رعاية واستخدام الحيوان المؤسسي (IACUC)، أو جرت وفقا للمبادئ التوجيهية IACUC والمعاهد الوطنية للصحة الدليل لرعاية واستخدام الحيوانات المختبرية.

1. جمع وإعداد القولون

  1. الموت ببطء الفئران مع CO 2 الخنق تليها خلع عنق الرحم.
  2. رش الفئران مع 70٪ من الإيثانول ويعلقون أطرافه إلى لوحة تعلق الحفاظ على الجانب الظهري الماوس لأسفل على متنها.
  3. باستخدام مقص وملقط قبل تعقيمها تشريح، وجعل شق خط منتصف في الغشاء البريتوني في البطن. فتح البطن عن طريق طي الصفاق بالملقط.
  4. إزالة الأمعاء من واي تجويف البطنعشر تشريح ملقط ومقص. فصل القولون من الأمعاء الدقيقة عن طريق قطع في الجزء السفلي من الأعور والطرف الآخر في المستقيم.
  5. وضع القولون في طبق بتري معقمة تحتوي على الجليد الباردة برنامج تلفزيوني. مسح محتويات تجويف القولون مع الثلج الباردة برنامج تلفزيوني باستخدام حقنة 20 مل عقد 20 G إبرة أو إبرة أنبوب تغذية عن طريق الفم حتى البراز داخل تجويف القولون هو إزالتها تماما.
  6. قطع القولون مع مقص طوليا. غسل القولون عن طريق هز بقوة في الجليد الباردة برنامج تلفزيوني في طبق بتري معقمة.
  7. قطع أنسجة القولون إلى قطع حوالي 1 سم باستخدام مشرط معقم أو المقص.
  8. سجل وزن القطع القولون.
    ملاحظة: يمكن تنفيذ جميع الخطوات في القسم 1 سواء داخل أو خارج خزانة السلامة البيولوجية. مرة واحدة كولون جاهزة للثقافة، يجب تنفيذ جميع الخطوات داخل مجلس الوزراء السلامة البيولوجية للحفاظ على عقم.

2. القولون المؤسسةوالثقافة

  1. وضع مصفاة الخلية (100 ميكرون) على 6 جيدا وحة زراعة الخلايا. نقل جميع القطع القولون التي تم جمعها من فأر واحد في مصفاة الخلية.
  2. إضافة 5 مل المتوسطة DMEM / F12 تحتوي على 5٪ FBS، البنسلين، الستربتوميسين (1X)، وجنتاميسين (20 ميكروغرام / مل). تغطي كامل القطع القولون مع وسائل الإعلام.
  3. احتضان لمدة 2 ساعة على 37 درجة مئوية في حاضنة مع 5٪ CO 2 و 95٪ الجوية.
  4. رفع مصفاة الخلية، ونضح وسائل الإعلام.
  5. وضع مصفاة الخلية مرة أخرى على البئر وإضافة 5 مل وسائل الإعلام الجديدة دون أي المضادات الحيوية. رفع مصفاة الخلية، ونضح وسائل الإعلام.
  6. كرر الخطوة أعلاه الغسيل (الخطوة 2.5) مرتين أكثر (3X الإجمالي) لإزالة كافة المضادات الحيوية المتبقية.
  7. ونقل القطع القولون من مصفاة خلية واحدة في بئر واحدة على العقيمة 12-جيدا لوحة الثقافة الخلية.
  8. إضافة DMEM المتوسطة / F12 تحتوي على 5٪ FBS (بدون أي المضادات الحيوية). ضبط حجم المتوسط ​​مع weigحزب التحرير من القطع القولون، على سبيل المثال، 1 مل المتوسطة لمدة 100 ملغ من الأنسجة. احتضان لمدة 12 ساعة عند 37 درجة مئوية في حاضنة حقن 5٪ CO 2 و 95٪ الجوية.
  9. جمع طاف الثقافة في أنبوب 1.5 مل العقيمة.
  10. أجهزة الطرد المركزي في 12000 x ج في 4 درجة مئوية لمدة 5 دقائق. فصل طاف في أنبوب 1.5 مل جديد للاستخدام في قتل البكتيريا فحص و / أو غيرها من المقايسات المناعية. طاف يمكن تخزينها في -80 درجة مئوية حتى الفحص.
  11. جمع القطع القولون في أنبوب لعزل الحمض النووي الريبي.

3. كولاي قتل الفحص

  1. تطعيم كولاي في 5 مل لوريا، Bertani (LB) مرق في أنبوب 15 مل واحتضان عند 37 درجة مئوية مع اهتزاز عند 200 دورة في الدقيقة ليلة وضحاها. الحفاظ على الغطاء من أنبوب ثقافة فضفاضة قليلا.
  2. أنبوب الطرد المركزي ثقافة البكتيرية في 1200 x ج لمدة 10 دقيقة على 4 درجات مئوية. إزالة طاف و resuspend بيليه البكتيرية في برنامج تلفزيوني 5 مل الجليد الباردة.
  3. نقل 1 مل من جرثومةتعليق يريال إلى كفيت وقياس OD في 600 نانومتر. استخدام برنامج تلفزيوني كما فارغة.
  4. حساب وحدة مستعمرة تشكيل (كفو) باستخدام منحنى معيار محدد سلفا. هنا، افترض أن 1 OD = 2 × 10 9 وت م / مل (تقريبا).
  5. تمييع تعليق البكتيرية لجعل تعليق الاسهم 1 × 10 5 كفو / مل.
  6. نقل ثقافة طاف القولون الجهاز (500 ميكرولتر / جيد) التي تم جمعها في القسم 2.10 في الآبار مكررة من لوحة الثقافة خلية 24 أيضا.
  7. إضافة 10 ميكرولتر E. ثقافة القولونية (1000 كفو) في واحدة تحتوي على 500 ميكرولتر جيدا القولون الجهاز طاف الثقافة. مغادرة البعض بشكل جيد دون أي كولاي E. التلقيح للتأكد من أن ثقافة طاف القولون الجهاز لا يحتوي على أي تلوث.
  8. احتضان نفس العدد من البكتيريا (1000 كفو) في وسائل الإعلام الثقافة (DMEM / F12 بالإضافة إلى 5٪ FBS) دون أي المضادات الحيوية كمجموعة تحكم.
  9. احتضان عند 37 درجة مئوية لمدة 1 ساعة.
  10. ضع 50 ميكرولتر من كل عينة انخفاض وايحد ذاته على لوحات أجار ماكونكي. احتضان لوحات ماكونكي أجار عند 37 درجة مئوية خلال الليل.
  11. حساب عدد من المستعمرات وحساب كفو / مل.

4. تأثير خارجي والعوامل الجوهرية في القولون مضادات الميكروبات المضيف الردود الدفاع

ملاحظة: فحص قتل مضادات الميكروبات كما هو موضح هنا يمكن اعتمادها لدراسة تأثير العوامل المسببة للأمراض المرتبطة أنماط الجزيئية (PAMPs) والسيتوكينات على النشاط جراثيم من طاف الثقافة الجهاز. يوصف مثال على هذه التجربة باستخدام IL-1β و IL-18 أدناه.

  1. جمع نقطتين من الفئران كما هو موضح في القسم 1.
  2. وضع القولون على منشفة ورقية معقمة. قطع القولون طوليا إلى ثلاثة أجزاء باستخدام مقص (الشكل 2).
  3. يغسل كل جزء من القولون في الجليد الباردة برنامج تلفزيوني كما هو موضح في القسم 1.
  4. قطع كل جزء من القولون إلى قطع صغيرة وتزن جو معقم و مطهر. نقل قطع من كل جزءمن القولون إلى ثلاثة مصافى خلية منفصلة (100 ميكرون) وضعت على ثلاثة آبار ل6 جيدا وحة زراعة الخلايا (الشكل 2).
  5. إضافة 2 مل DMEM المتوسطة / F12 تحتوي على 5٪ FBS، البنسلين، الستربتوميسين (1X)، وجنتاميسين (20 ميكروغرام / مل).
  6. احتضان لمدة 2 ساعة عند 37 درجة مئوية في حاضنة حقن 5٪ CO 2 و 95٪ الجوية.
  7. تغسل قطع القولون كما هو موضح في 2،4-2،6. ونقل القطع القولون من مصفاة خلية واحدة في بئر واحدة على العقيمة 12-جيدا لوحة الثقافة الخلية. الآبار الثلاثة يحتوي على ثلاثة أجزاء من القولون من ماوس واحدة يجب أن توصف بأنها غير المعالجة، IL-1β، وIL-18 (الشكل 2).
  8. إضافة DMEM المتوسطة / F12 تحتوي على 5٪ FBS (بدون أي المضادات الحيوية). ضبط حجم المتوسطة مع وزن القطع القولون، على سبيل المثال، 1 مل المتوسطة لمدة 100 ملغ من الأنسجة.
  9. تحفيز الجهاز ثقافة القولون مع IL-1β (20 نانوغرام / مل) أو IL-18 (20 نانوغرام / مل) لمدة 12 ساعة. القولون غير المعالجة تخدم الثقافة الجهاز عن السيطرة.
  10. بعد 12 ساعة حضانة عند 37 درجة مئوية في حاضنة حقن 5٪ CO 2 و 95٪ الجوية، وجمع طاف الثقافة في العقيمة 1.5 مل أنبوب.
  11. نقل 500 ميكرولتر ثقافة طاف في الآبار مكررة من 24 لوحة جيدا.
  12. تطعيم كولاي (1000 كفو) في القولون الجهاز طاف الثقافة كما هو موضح في القسم 3. للحصول على كل حالة، تطعيم كولاي في بئر واحدة. سوف تحتوي على البعض جيدا نفس الجهاز ثقافة طاف دون كولاي بمثابة الرقابة على التلوث الجرثومي.
  13. احتضان نفس كمية البكتيريا في وسائل الإعلام ثقافة دون أي المضادات الحيوية كمجموعة تحكم.
  14. احتضان عند 37 درجة مئوية لمدة 1 ساعة.
  15. ضع 50 ميكرولتر من كل عينة قطرة من الحكمة على لوحات ماكونكي أجار. احتضان لوحات ماكونكي أجار ليلا 37 درجة مئوية.
  16. حساب عدد من المستعمرات وحساب كفو / مل (الشكل 4).
e_title "> 5. قياس التعبير عن الجينات مضادات الميكروبات

  1. بعد مرور فترة الحضانة بين عشية وضحاها (12 ساعة) من الثقافة الجهاز القولون كما هو موضح في أقسام 2 و 4، وغسل قطع القولون مع 2 مل الجليد الباردة PBS (2X).
  2. جمع القطع القولون إلى 2 مل ريبونوكلياز / الدناز أنبوب الحرة المسمار الحد الأقصى. وضع أنابيب على الجليد.
  3. إضافة 1 مل كاشف Trizol التجاري والناشر حبات مصفوفة داخل الأنبوب.
  4. ليز الأنسجة باستخدام الخالط الأنسجة الآلي.
  5. جمع المحللة الأنسجة في أنبوب microcentrifuge جديد.
  6. عزل الحمض النووي الريبي باستخدام بروتوكول قياسي.
  7. قياس تركيز الحمض النووي الريبي.
  8. تمييع RNA بشكل مناسب مع الماء منزوع الأيونات واستخدام 500 نانوغرام الحمض النووي الريبي لتجميع كدنا].
  9. استخدام كدنا] في الوقت الحقيقي تحليل RT-PCR من الجينات المستهدفة المضادة للميكروبات، السيتوكينات، كيموكينات، وغيرها من الجينات في المصالح.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

وأظهرت صورة تمثيلية لكولون في الثقافة الجهاز في الشكل 1. لا تزال القطع القولون في الثقافة عملية الأيض والنشطة من الناحية الفسيولوجية. أنها تستجيب بكفاءة للمؤثرات الخارجية إضافة إلى وسائل الإعلام والثقافة. وتدفق العمل التخطيطي للإعداد للأنسجة القولون لفيفو السابقين الثقافة والتحفيز مع مؤثرات خارجية، مثل IL-1β و IL-18، هو مبين في الشكل 2. البيانات الممثلة في الشكل (3) تبين أن كولون في الثقافة الجهاز تعبر عن الببتيدات المضادة للميكروبات مثل defensin β 2 (BD2)، Reg3γ، S100a8، S100a9، وiNOS ردا على IL-1β و IL-18.

الوسطاء الصادرة عن ويزرع القولون يحمل لها تأثير مضاد للميكروبات قتل كما يدل على ذلك انخفاض كبير في نمو كولاي حضنت مع طاف الثقافة الجهاز ( 4B). وpotentiated هذا E. النشاط قتل القولونية مزيد من التحفيز من IL-1β و IL-18 (الأرقام 4A و 4B). تظهر القولون supernatants الثقافة الجهاز المحتضنة دون كولاي أي نمو جرثومي التالية الثقافة على ماكونكي أجار (أرقام 4C و 4D). تشير هذه النتائج أيضا إلى أن inflammasome يلعب دورا هاما في الدفاع المضيف مضادات الميكروبات المعوية.

وعموما، فإن البيانات المقدمة هنا تشير إلى أن فيفو السابقين الثقافة الجهاز القولون هو تقنية مفيدة جدا لدراسة الاستجابات المناعية المضادة للميكروبات المعوية في المختبر.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCC G
β-defensin 2 (BD2) _F TGACCACTGCCACACCAATG
β-defensin 2 (BD2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

الجدول 1: قائمة الاشعال الماوس في الوقت الحقيقي PCR.

جنرال الكتريك = "1"> شكل 1
الشكل 1: الصورة التمثيلية للقطع الماوس القولون في الثقافة. (A) الحضانة من القطع القولون على مصفاة الخلية (100 ميكرون) وضعت على طبق من 6 جيدا. وغرقت أجزاء القولون في 2 وسائل الإعلام ثقافة مل تستكمل مع المضادات الحيوية. (ب) وبعد 2 ساعة الحضانة، يتم نقل قطع القولون في البئر من 12 لوحة جيدا جديدة زراعة الخلايا تحتوي على المتوسط خالية من المضادات الحيوية. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2: عرض تخطيطي من الخطوات لإعداد أنسجة القولون وخارج الحي التحفيز مع IL-1β و IL-18. القولون من الماوس واحد هو لإبهام القدم تشريح tudinally إلى ثلاثة أجزاء. وقطعت كل جزء الى قطع صغيرة وزنه. يتم نقل القطع القولون من كل قسم من القولون على مصافى الخلية وضعت على آبار لوحة 6 جيدا تحتوي على 2 مل DMEM / F12 المتوسطة بالإضافة إلى 5٪ FBS والمضادات الحيوية. بعد حضانة 2 ساعة، ويتم نقل قطع القولون من مصفاة خلية واحدة في بئر واحد من 12 لوحة جيدا ثقافة الخلية. وأضاف DMEM / F12 بالإضافة إلى 5٪ FBS (أي المضادات الحيوية) في كل بئر ويتم تعديل حجم المتوسطة وفقا لوزن النسيج (1 مل سائل الإعلام عن 100 ملغ الأنسجة). يتم تحفيز أنسجة القولون مع IL-1β (20 نانوغرام / مل) و IL-18 (20 نانوغرام / مل) لمدة 12 ساعة. وطرد supernatants ثقافة واستخدامها لكولاي مما أسفر عن مقتل فحص و / أو غيرها من المقايسات المناعية. يتم جمع أنسجة القولون إلى كاشف التربسين التجاري لعزل الحمض النووي الريبي وتحليلات لاحقة في التعبير الجيني للميكروبات التي كتبها الوقت الحقيقي PCR..jpg و"الهدف =" _ فارغة "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
الرقم 3: أنسجة القولون ماوس تعبر عن السيتوكينات والببتيدات المضادة للميكروبات ردا على IL-1β أو IL-18 خلال ثقافة فيفو السابقين. وحفز الثقافات الجهاز القولون مع IL-1β (20 نانوغرام / مل) أو IL-18 (20 نانوغرام / مل) لمدة 12 ساعة. وقد تم قياس التعبير عن BD2، Reg3γ، S100a8، S100a9، وiNOS من قبل في الوقت الحقيقي RT-PCR (الجدول 1). تمثل البيانات سائل ± SD. * ف <0.05، ** ف <0.01. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (4)
الشكل 4: طاف من الماوس القولون الجهاز عبادةلدى عودتهم يسلك النشاط مبيد للجراثيم. وكانت قطع القولون مثقف خارج الجسم الحي في وجود أو عدم وجود IL-1β (20 نانوغرام / مل) أو IL-18 (20 نانوغرام / مل) لمدة 12 ساعة. حضنت 500 ميكرولتر من supernatants الثقافة مع كولاي (1000 وت) لمدة 1 ساعة على 37 درجة مئوية. وقد حضنت القولون الجهاز ثقافة طاف دون كولاي أيضا كمجموعة تحكم. بعد 1 ساعة الحضانة، وضعت 50 ميكرولتر من كل عينة قطرة قطرة على لوحات أجار ماكونكي وحضنت عند 37 درجة مئوية خلال الليل. (A) صورة كولاي المستعمرات على أجار ماكونكي تظهر نشاط مضادات الميكروبات الثقافة القولون الجهاز. (ب) E. القولونية العد يظهر قتل كفاءة IL-1β- وIL-18 معاملة طاف القولون الثقافة الجهاز. (C) صورة ماكونكي لوحة أجار تظهر أي نمو البكتيريا في القولون الثقافة الجهاز المحتضنة دون كولاي. وقد تم تحديد (D) المستعمرات القولونية E. لا في القولون الجهاز جحضنت ulture دون كولاي، مما يدل على عدم وجود أي بكتيريا تلوث في العينة. تمثل البيانات سائل ± SD. ** ف <0.01 ***، ف <0.001. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

الخلايا الظهارية في الأمعاء حساسة جدا من حيث متطلبات نموها وبالتالي يصعب الثقافة. الخلايا الظهارية المعزولة عن طريق العلاج EDTA لا البقاء على قيد الحياة في وسائل الإعلام ثقافة الخلية التقليدية مثل DMEM 8. لذلك، ودراسات التفاعل المضيف الممرض باستخدام سرداب معزول أو الخلايا الظهارية الأساسية هي صعبة للغاية. في الآونة الأخيرة، ساتو وآخرون. وصف نظام الثقافة عضوي الشكل سرداب وهي واعدة جدا ومفيدة للدراسات المتعلقة الفيزيولوجيا المرضية المعوية 13. في حين organoids تمثل العديد من الميزات من سرداب الأمعاء، هناك مخاوف حول ما إذا كانت الاستجابات المناعية للخلايا عضي، والتي تزرع في بيئة معقمة، تلخيص استجابات الخلايا الظهارية في الأمعاء في الجسم الحي. التقنيات الدقيقة اللازمة لعزل والثقافة من الخلايا الجذعية الظهارية ومتطلبات الكواشف مكلفة للثقافة organoids تمنع أماهمختبرات نيويورك من الاستفادة من هذا النظام. في حين أن استخدام فيفو السابقين الثقافة الجهاز ليس بديلا للثقافة عضي، وهذا النظام يوفر وسيلة سهلة وغير مكلفة لدراسة الردود المضادة للميكروبات من ظهارة الأمعاء.

والميزة الرئيسية لهذا الأسلوب هو أن بنية أنسجة الأمعاء المحافظة في حين زرع في الأطباق. لاحظنا أن أنسجة القولون تنشط الناحية الفسيولوجية لمدة 24 ساعة على الأقل بعد ثقافتهم. خلال ثقافة القولون، والقولون الخلايا الظهارية تستجيب للمؤثرات الخارجية التي تقاس تعبير عن السيتوكينات والببتيدات المضادة للميكروبات. الجدوى من الخلايا الظهارية للأنسجة سليمة يمكن تعزيزه من خلال إضافة عوامل ومثبطات موت الخلايا النمو المناسبة في مستنبت. وتشير تقارير سابقة أن البشر الجهاز الأنسجة القولون العادي يمكن الحفاظ على الجسم الحي السابقين لعدة أيام 8 سوب>، 23، 24.

قد يكون لهذا البروتوكول للثقافة فيفو السابقين من الماوس الجهاز القولون العديد من التطبيقات في الدراسات المتعلقة الاستجابات المناعية المضادة للميكروبات من ظهارة الأمعاء. يتم التعرف على مسببات الأمراض وPAMPs من قبل PRRs مثل مستقبلات تول مثل (TLRs) ومستقبلات شبيهة NOD (NLRs) موجودة في الخلايا الظهارية والمناعية. ترتبط التعبير خلل وظيفة العديد من TLRs وNLRs مع التعرض لمرض التهاب الأمعاء، تكون الأورام القولون والمستقيم، والالتهابات البكتيرية. منذ خلد خطوط الخلايا الظهارية لا تمثل كافة الميزات من مكانة المعوية، فيفو السابقين الثقافة القولون الجهاز أداة تجريبية مفيدة جدا. باستخدام هذا النظام، ونحن يمكن دراسة تأثير مختلف PAMPs أو المحفزات على تحريض الجزيئات المستجيب المضادة للميكروبات في الخلايا الظهارية في الأمعاء. في التجربة التمثيلية، أظهرنا أن السيتوكينات مثلIL-1β و IL-18 الزناد التعبير عن الببتيدات المضادة للميكروبات (الشكل 3). علينا أن نبين هنا أن الببتيدات المضادة للميكروبات التي تنتجها الأنسجة القولون يمكن أن تقتل بشكل فعال كولاي (الشكل 4). هذه التقنيات يمكن تطبيقها على اختبار تأثير lipopolysaccharide في (LPS)، ببتيدوغليكان (PGN)، muramyldipeptide (MDP)، وPAMPs أخرى في الردود دفاع المضيف مضادات الميكروبات في الأمعاء.

لقد أدخلت عليها تعديلات طفيفة على بروتوكول ثقافة القولون الجهاز كما هو موضح سابقا 12، 16، 20، 25. نحن مثقف القولون على مرحلتين. في البداية، وحضنت أنسجة القولون في المضادات الحيوية تحتوي على المتوسط ​​لمدة 2 ساعة. نحن ثم إزالة المضادات الحيوية مع الغسيل المتكرر لقطع القولون تليها الحضانة مع المضادات الحيوية الإعلام الحر. وهكذا، فإن طاف ثقافة الحصول عليها من الثقافة بين عشية وضحاها لالمعارض القولون فقط تأثير الببتيدات المضادة للميكروبات يفرز عندما حضنت مع كولاي. هذا النهج يمكن استخدامها لمعرفة تأثير مبيد للجراثيم القولون أو الأمعاء المستمدة الببتيدات المضادة للميكروبات على أي بكتيريا من الفائدة. وينبغي استخدام وسائل الإعلام آغار انتقائية مناسبة لثقافة البكتيريا.

مثل معظم التقنيات، وهناك قيود من خارج الحي نظام الثقافة الجهاز. أولا، على عكس ثقافة الخلية أو ثقافة عضي، وأجهزة لا تنمو وتتكاثر، وبالتالي لا يمكن توسيع نطاقها. الثانية، والخلايا الظهارية في الأمعاء حساسة للغاية وأنها تموت بسرعة نسبيا دون عوامل النمو الإضافية ومثبطات موت الخلايا المبرمج، والتي تستخدم لثقافة عضي سرداب. ثالثا، الاستجابة المناعية لوحظ من الثقافة الجهاز هو استجابة جماعية من أنواع مختلفة من السكان الخلية. ولذلك، فإن دور نوع من الخلايا الفردية في التعبير عن الجينات المضادة للميكروبات والمستجيب لا يمكن تقييمه. Additionally، خلافا لما حدث في خطوط الخلايا والثقافة عضي، والتعبير عن الببتيدات المضادة للميكروبات وغيرها من الجزيئات المستجيب في كولون قد تختلف من الفأر إلى الماوس الخلفية الوراثية نفسها.

باختصار، نحن هنا وصف بروتوكول بسيط للثقافة الجهاز القولون فيفو السابقين يمكن أن يكون مفيدا جدا لدراسة الاستجابات المناعية المضادة للميكروبات المعوية. هذا النهج يمكن استخدامها لاختبار دور مختلف الجينات المناعية الفطرية في التعبير عن الببتيدات المضادة للميكروبات التي كتبها زراعة كولون من فئرانا معدلة وراثيا الجيني للاهتمام. وعلاوة على ذلك، هذا البروتوكول يمكن تكييفها للاستخدام في الدراسات السريرية لدراسة الردود المضادة للميكروبات المعوية للمرضى مرض التهاب الأمعاء عن طريق إجراء الثقافة الجهاز من عينات الخزعة القولون.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

وأيد هذا العمل من خلال تمويل من مرض كرون والتهاب القولون مؤسسة من أمريكا، (CCFA، 3711) الوقاية من السرطان ومعهد بحوث من ولاية تكساس، مركز UT ساوث ويسترن الطبي (CPRIT RP160169)، ونظرا لMHZ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats