Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

आंत दोहराए तहखाना उपकला कोशिकाओं के विभिन्न प्रकार, पटल प्रतिरक्षा कोशिकाओं से युक्त Propia, और स्ट्रोमा से मिलकर संरचनाओं के एक वास्तुकला प्रदर्शित करता है। इन विषम कोशिकाओं के सभी आंतों homeostasis में योगदान और रोगाणुरोधी मेजबान बचाव में भाग लेते हैं। इसलिए, इन विट्रो सेटिंग में प्रतिरक्षा प्रतिक्रिया और आंत के रोगाणुरोधी गतिविधि का अध्ययन करने के लिए एक किराए मॉडल की पहचान बेहद चुनौतीपूर्ण है। इन विट्रो अध्ययन में अमर आंतों उपकला सेल लाइनों या यहां तक कि प्राथमिक तहखाना organoid संस्कृति सामान्य आंत और इसके microenvironment की सटीक शरीर क्रिया विज्ञान का प्रतिनिधित्व नहीं करते इस्तेमाल करते हैं। यहाँ, हम एक संस्कृति डिश और कैसे इस पूर्व vivo अंग संस्कृति प्रणाली रोगाणुरोधी मेजबान बचाव प्रतिक्रियाओं से संबंधित अध्ययन में लागू किया जा सकता है में संवर्धन माउस पेट के ऊतकों की एक विधि पर चर्चा की। प्रतिनिधि प्रयोगों में, हम पता चला है कि अंग संस्कृति में कॉलन resp में रोगाणुरोधी पेप्टाइड्स का इजहारबहिर्जात आईएल 1β और आईएल -18 को Onse। इसके अलावा, रोगाणुरोधी प्रेरक अंग संस्कृति में पेट के ऊतकों द्वारा उत्पादित अणुओं कुशलता से इन विट्रो में कोलाई को मारने। यह दृष्टिकोण, इसलिए, आंतों सहज प्रतिरक्षा प्रतिक्रिया और रोगाणुरोधी मेजबान बचाव प्रतिक्रियाओं को विनियमित करने में pathogen- और खतरे से जुड़े आणविक पैटर्न और उनके सेलुलर रिसेप्टर्स की भूमिका काटना करने के लिए उपयोग किया जा सकता है।

Introduction

आंत, एक गतिशील प्रणाली है कि खानेवाला सूक्ष्मजीवों के लिए एक बाधा के रूप में कार्य करता है का प्रतिनिधित्व करता हमलावर रोगजनकों के खिलाफ लड़ता है, और माइक्रोबियल रचना 1 नियंत्रित करता है। आंतों उपकला कोशिकाओं, एन्तेरोच्य्तेस, जाम कोशिकाओं, Paneth कोशिकाओं और enteroendocrine कोशिकाओं से मिलकर, प्रमुख सेल आबादी है कि आंतों माइक्रोबायोटा के खिलाफ मेजबान बचाव प्रतिक्रियाओं प्रदान कर रहे हैं। जाम कोशिकाओं mucins कि उपकला परत 2 के शीर्ष पर एक ग़ैरफ़ौजीकरण जोन बनाने का उत्पादन। Paneth कोशिकाओं और एन्तेरोच्य्तेस रोगाणुरोधी पेप्टाइड्स, साइटोकिन्स, और प्रतिक्रियाशील ऑक्सीजन और नाइट्रोजन प्रजाति है कि रोगाणुरोधी मेजबान बचाव प्रतिक्रियाओं का गठन और आंत्र माइक्रोबियल रचना 3, 4 को आकार देने के लिए योगदान का उत्पादन। उपकला कोशिकाओं के अलावा, मैक्रोफेज, वृक्ष के समान कोशिकाओं, न्यूट्रोफिल, प्राकृतिक हत्यारा कोशिकाओं, लिम्फोसाइटों, और इन्ना सहित प्रतिरक्षा कोशिकाओं 7 - लामिना propria और submucosa में ते लसीकावत् कोशिकाओं के उत्पादन साइटोकिन्स, Chemokines, और अन्य मध्यस्थों 5 से आंतों रोगाणुरोधी मेजबान बचाव प्रतिक्रियाओं में एक महत्वपूर्ण भूमिका निभाते हैं। आदेश में समझने के लिए कैसे श्लैष्मिक प्रतिरक्षा प्रणाली को नियंत्रित करता है और माइक्रोबायोटा सूक्ष्म जीवाणु संक्रमण के खिलाफ सुरक्षा प्रदान करता है, यह पेट की विषम सेल आबादी के जटिल बातचीत पर विचार करने के लिए महत्वपूर्ण है। हालांकि, इन विट्रो मॉडल है कि आंत की सुविधाओं के सभी शामिल हैं उपलब्ध नहीं है। इसलिए, आंत में मेजबान रोगज़नक़ बातचीत पर आणविक पढ़ाई के अत्यधिक चुनौतीपूर्ण हैं।

पिछले कुछ वर्षों में, कई मॉडल प्रणाली है कि आंत्र mucosa के पहलुओं की नकल pathophysiological सूजन आंत्र रोग (IBD) और अन्य गैस्ट्रोइंटेस्टाइनल विकारों 8 में शामिल प्रक्रियाओं की जांच के लिए विकसित किया गया है -= "xref"> 14। अमर आंतों उपकला सेल लाइनों अक्सर उपकला सेल विशिष्ट प्रतिक्रियाओं का अध्ययन करने के लिए इस्तेमाल कर रहे हैं। हालांकि, अंतर जीन अभिव्यक्ति और अमर कोशिकाओं में समारोह की वजह से, डेटा उन कोशिकाओं का उपयोग अक्सर vivo अध्ययन में मनाया उन लोगों के साथ मेल नहीं खाते से प्राप्त की। आंतों तहखाना organoid संस्कृति हाल ही में विभिन्न उत्तेजनाओं से 13 आंत्र उपकला की प्रतिक्रिया का आकलन करने के लिए एक संभावित उपकरण के रूप में उभरा है। इस प्रणाली में, तहखाना स्टेम कोशिकाओं के विकास और एक 3 डी organoid संरचना विकसित करने के लिए अनुमति दी जाती है। जबकि organoid संस्कृति प्रणाली आंतों उपकला के कई पहलुओं का अध्ययन करने के लिए बहुत उपयोगी है, यह प्रतिरक्षा कोशिकाओं, उपकला कोशिकाओं और सूक्ष्म उत्पादों की जटिल बातचीत की नकल नहीं है। आंतों के ऊतकों के पूर्व vivo संस्कृति में विवो मेजबान बचाव प्रतिक्रियाओं का एक बेहतर प्रतिनिधित्व प्रदान करता है। इस विधि में, आंत का एक हिस्सा एक सेल कल्चर प्लेट बुद्धि में सुसंस्कृत हैज उपयुक्त मीडिया आंत में सेल आबादी के विभिन्न प्रकार की अनुमति के लिए कम से कम 48 घंटे के लिए पाचन सक्रिय होने के लिए। इस प्रकार, एक पूर्व vivo अंग की संस्कृति रोगाणुरोधी जीनों की अभिव्यक्ति है और एक विशेष प्रोत्साहन के लिए आंत के मेजबान बचाव प्रतिक्रियाओं को मापने के लिए इस्तेमाल किया जा सकता है।

21 - जांचकर्ता आंत 15 में सूक्ष्म जीवाणु संक्रमण के खिलाफ मेजबान बचाव प्रतिक्रियाओं का अध्ययन करने के लिए पूर्व vivo अंग संस्कृति प्रणाली का उपयोग किया गया है। हमने हाल ही में माउस कॉलन 22 में रोगाणुरोधी मेजबान बचाव प्रतिक्रिया में inflammasome की भूमिका का अध्ययन करने के लिए अंग संस्कृति प्रणाली को अपनाया। inflammasome कस्पासे 1 की सक्रियता, जो परिपक्व आईएल 1β और आईएल -18 के उत्पादन के लिए आवश्यक है के लिए एक आणविक मंच है। हम पता चला कि आईएल 1β और आईएल 18 रोगाणुरोधी पेप्टाइड्स इस तरह के ई कोलाई के रूप में है जो प्रभावी खानेवाला pathobionts को मारने के लिए प्रेरित 22 में वृद्धि हुई ई कोलाई बोझ के अनुरूप था। इस प्रणाली इसलिए इस तरह के भड़काऊ आंत्र रोग (IBD) और कोलोरेक्टल कैंसर (सीआरसी) के रूप में पेट के रोगों की आंतों रोगाणुरोधी मेजबान बचाव प्रतिक्रिया में पैटर्न मान्यता रिसेप्टर्स (PRRS) और अन्य सहज प्रतिरक्षा अणुओं की भूमिका के रूप में अच्छी तरह से रोगजनन अध्ययन करने के लिए इस्तेमाल किया जा सकता है। वहाँ 200 से अधिक आईबीडी संवेदनशीलता जीन, और इन जीनों में से कई के पेट में बदल माइक्रोबियल रचना के साथ जुड़े रहे हैं में परिवर्तन कर रहे हैं। यह सटीक व्यवस्था है जिसके माध्यम से आईबीडी-संवेदनशीलता जीन पेट microbiota विनियमित निर्धारित करने के लिए महान नैदानिक ​​महत्व का है। इस विधि के समग्र लक्ष्य के पूर्व vivo पेट के अंग संस्कृति की एक बुनियादी प्रोटोकॉल को लागू करने और प्रदर्शन कैसे इस संस्कृति विधि आंत के रोगाणुरोधी मेजबान बचाव प्रतिक्रियाओं का अध्ययन करने के लिए इस्तेमाल किया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

यहाँ वर्णित सभी प्रयोगों 6-8 सप्ताह पुराने पुरुष जंगली प्रकार (C57BL6 / जम्मू) चूहों एक विशिष्ट रोगज़नक़ मुक्त (एसपीएफ) पशु संसाधन केंद्र (एआरसी), UT दक्षिण मेडिकल सेंटर में सुविधा में बनाए रखा का उपयोग कर प्रदर्शन किया गया। सभी अध्ययनों संस्थागत पशु की देखभाल और उपयोग समिति (IACUC) द्वारा अनुमोदित किया गया और IACUC दिशा निर्देशों और देखभाल और प्रयोगशाला पशु के उपयोग के लिए स्वास्थ्य गाइड के राष्ट्रीय संस्थानों के अनुसार आयोजित किया गया।

1. संग्रह और आंतों की तैयारी

  1. ग्रीवा अव्यवस्था के बाद सीओ 2 asphyxiation के साथ चूहों euthanize।
  2. 70% इथेनॉल के साथ चूहों स्प्रे और एक लगाए बोर्ड माउस पृष्ठीय पक्ष बोर्ड पर नीचे रखने के लिए हाथ-पैर पिन।
  3. पूर्व निष्फल विदारक कैंची और संदंश का प्रयोग, पेट की पेरिटोनियम में एक मध्य लाइन चीरा बनाते हैं। संदंश के साथ पेरिटोनियम तह करके पेट खोलें।
  4. उदर गुहा वाई से आंत हटायेवें संदंश और कैंची विदारक। अंधान्त्र के नीचे और मलाशय में दूसरे छोर पर काटने से छोटी आंत से पेट के अलग करें।
  5. युक्त ठंडा पीबीएस एक बाँझ पेट्री डिश में पेट के रखें। एक 20 एमएल सिरिंज एक 20 जी सुई या एक मौखिक gavage सुई पकड़े जब तक पेट के भीतर लुमेन मल पूरी तरह से हटा दिया जाता है का उपयोग कर ठंडा पीबीएस के साथ पेट के लुमेन की सामग्री को फ्लश।
  6. longitudinally कैंची से पेट के कट। एक बाँझ पेट्री डिश में ठंडा पीबीएस में सख्ती झटकों से पेट धो लें।
  7. टुकड़े लगभग 1 सेमी लंबे समय से एक बाँझ छुरी या कैंची का उपयोग करने में पेट के ऊतक में कटौती।
  8. पेट के टुकड़े का वजन रिकॉर्ड।
    नोट: धारा 1 में सभी चरणों को या तो अंदर या एक जैविक सुरक्षा कैबिनेट के बाहर प्रदर्शन किया जा सकता है। एक बार जब कॉलन संस्कृति के लिए तैयार हैं, सभी कदम बाँझपन बनाए रखने के लिए एक जैविक सुरक्षा कैबिनेट के अंदर किया जाना चाहिए।

2. आंतों संगठनएक संस्कृति

  1. एक सेल झरनी (100 माइक्रोन) 6 अच्छी तरह से सेल संस्कृति प्लेट पर रखें। सेल झरनी में एक माउस से एकत्र पेट के टुकड़े के सभी स्थानांतरण।
  2. 5 एमएल DMEM / F12 5% FBS, पेनिसिलिन स्ट्रेप्टोमाइसिन (1x), और Gentamycin (20 माइक्रोग्राम / एमएल) युक्त मध्यम जोड़ें। पूरी तरह से मीडिया के साथ पेट के टुकड़े को कवर किया।
  3. 5% सीओ 2 और 95% हवा के साथ एक मशीन में 37 डिग्री सेल्सियस पर 2 घंटे के लिए सेते हैं।
  4. सेल झरनी लिफ्ट और मीडिया aspirate।
  5. सेल झरनी में अच्छी तरह से पीठ पर जगह और किसी भी एंटीबायोटिक दवाओं के बिना 5 मिलीलीटर ताजा मीडिया जोड़ें। सेल झरनी लिफ्ट और मीडिया aspirate।
  6. ऊपर धोने कदम (2.5 कदम) में दो बार और अधिक (कुल 3x) दोहराएँ अवशिष्ट एंटीबायोटिक दवाओं के सभी हटाने के लिए।
  7. एक बाँझ 12 अच्छी तरह से सेल संस्कृति की थाली का एक भी अच्छी तरह से में एक ही सेल झरनी से पेट के टुकड़े स्थानांतरण।
  8. DMEM / F12 5% FBS (किसी भी एंटीबायोटिक दवाओं के बिना) युक्त मध्यम जोड़ें। weig के साथ मध्यम की मात्रा समायोजित करेंपेट के टुकड़े की हिंदुस्तान टाइम्स, जैसे, ऊतक के 100 मिलीग्राम के लिए 1 मिलीलीटर मध्यम। एक मशीन इंजेक्शन लगाने के 5% सीओ 2 और 95% हवा में 37 डिग्री सेल्सियस पर 12 घंटे के लिए सेते हैं।
  9. एक बाँझ 1.5 मिलीलीटर ट्यूब में संस्कृति सतह पर तैरनेवाला लीजिए।
  10. 5 मिनट के लिए 4 डिग्री सेल्सियस पर 12,000 XG पर अपकेंद्रित्र। परख और / या अन्य प्रतिरक्षा assays की हत्या बैक्टीरिया में इस्तेमाल के लिए एक नया 1.5 एमएल ट्यूब में सतह पर तैरनेवाला अलग करें। सतह पर तैरनेवाला -80 डिग्री सेल्सियस तक परख पर संग्रहित किया जा सकता है।
  11. शाही सेना के अलगाव के लिए एक ट्यूब में पेट के टुकड़े ले लीजिए।

3. ई कोलाई परख हत्या

  1. एक 15 मिलीलीटर ट्यूब में 5 एमएल Luria-Bertani (पौंड) शोरबा ई कोलाई टीका लगाना और रात में 200 rpm पर झटकों के साथ 37 डिग्री सेल्सियस पर सेते हैं। संस्कृति ट्यूब की टोपी थोड़ा ढीला रखें।
  2. 4 डिग्री सेल्सियस पर 10 मिनट के लिए 1,200 XG पर जीवाणु संस्कृति ट्यूब अपकेंद्रित्र। तैरनेवाला निकालें और 5 मिलीलीटर ठंडा पीबीएस में बैक्टीरिया गोली resuspend।
  3. स्थानांतरण 1 bact एमएल600 एनएम पर एक क्युवेट और उपाय आयुध डिपो में erial निलंबन। एक खाली के रूप में पीबीएस का प्रयोग करें।
  4. कॉलोनी बनाने इकाई (CFU) के एक पूर्व निर्धारित मानक वक्र का उपयोग कर की गणना। इधर, मान लेते हैं कि 1 आयुध डिपो = 2 एक्स 10 9 CFU / एमएल (लगभग)।
  5. बैक्टीरियल निलंबन पतला शेयर निलंबन 1 एक्स 10 5 CFU / एमएल बनाने के लिए।
  6. (500 μl / अच्छी तरह से) पेट के अंग संस्कृति सतह पर तैरनेवाला स्थानांतरण 24 अच्छी तरह से सेल संस्कृति की थाली के डुप्लिकेट कुओं में धारा 2.10 में एकत्र की।
  7. 10 μL ई कोलाई संस्कृति (1,000 CFU) एक अच्छी तरह से युक्त 500 μL पेट के अंग संस्कृति सतह पर तैरनेवाला में जोड़ें। किसी भी ई कोलाई टीका के बिना दूसरे को अच्छी तरह छोड़ दो पुष्टि करने के लिए कि पेट के अंग संस्कृति सतह पर तैरनेवाला किसी भी संक्रमण शामिल नहीं है।
  8. एक नियंत्रण के रूप में किसी भी एंटीबायोटिक दवाओं के बिना एक ही संस्कृति मीडिया (DMEM / F12 प्लस 5% FBS) में जीवाणुओं की संख्या (1,000 CFU) सेते हैं।
  9. 1 घंटे के लिए 37 डिग्री सेल्सियस पर सेते हैं।
  10. प्रत्येक नमूना ड्रॉप-वाई के 50 μL रखेंएसई MacConkey अगर प्लेटों पर। रात भर 37 डिग्री सेल्सियस पर MacConkey अगर प्लेटें सेते हैं।
  11. कालोनियों की संख्या की गणना और CFU / एमएल की गणना।

4. पर Colonic रोगाणुरोधी मेजबान बचाव जवाब बाह्य और आंतरिक कारकों के प्रभाव

नोट: के रूप में यहाँ वर्णित रोगाणुरोधी हत्या परख अंग संस्कृति सतह पर तैरनेवाला की जीवाणुनाशक गतिविधि पर रोगज़नक़ जुड़े आणविक पैटर्न (PAMPs) और साइटोकिन्स के प्रभाव की जांच करने के लिए अपनाया जा सकता है। आईएल 1β और आईएल -18 का उपयोग कर इस तरह के प्रयोग का एक उदाहरण नीचे वर्णित है।

  1. धारा 1 में वर्णित के रूप में चूहों से कॉलन लीजिए।
  2. एक बाँझ कागज तौलिया पर पेट के रखें। Longitudinally कैंची का उपयोग तीन भागों (चित्रा 2) में पेट के कट।
  3. धारा 1 में वर्णित के रूप में बर्फ के ठंडे पीबीएस में पेट के प्रत्येक भाग को धो लें।
  4. छोटे टुकड़ों में पेट के प्रत्येक भाग के कट और aseptically तौलना। प्रत्येक भाग के टुकड़े स्थानांतरणतीन अलग-अलग सेल strainers (100 माइक्रोन) (चित्रा 2) 6 अच्छी तरह से सेल संस्कृति की थाली के तीन कुओं पर रखा में पेट के।
  5. 2 मिलीलीटर DMEM / F12 5% FBS, पेनिसिलिन स्ट्रेप्टोमाइसिन (1x), और Gentamycin (20 माइक्रोग्राम / एमएल) युक्त मध्यम जोड़ें।
  6. एक मशीन इंजेक्शन लगाने के 5% सीओ 2 और 95% हवा में 37 डिग्री सेल्सियस पर 2 घंटे के लिए सेते हैं।
  7. 2.4-2.6 में वर्णित के रूप में पेट के टुकड़े को धो लें। एक बाँझ 12 अच्छी तरह से सेल संस्कृति की थाली का एक भी अच्छी तरह से में एक ही सेल झरनी के पेट के टुकड़े स्थानांतरण। आईएल 18 एक माउस से पेट के तीन भागों से युक्त तीन कुओं इलाज, आईएल 1β के रूप में नामित किया जाना चाहिए, और (चित्रा 2)।
  8. DMEM / F12 5% FBS (किसी भी एंटीबायोटिक दवाओं के बिना) युक्त मध्यम जोड़ें। पेट के टुकड़े का वजन, जैसे, ऊतक के 100 मिलीग्राम के लिए 1 एमएल मध्यम के साथ मध्यम की मात्रा समायोजित करें।
  9. 12 घंटे के लिए आईएल 1β (20 एनजी / एमएल) या आईएल -18 (20 एनजी / एमएल) के साथ पेट के अंग संस्कृति को प्रोत्साहित। इलाज पेट के अंग संस्कृति नियंत्रण के रूप में कार्य करता है।
  10. बाद एक मशीन इंजेक्शन लगाने के 5% सीओ 2 और 95% हवा में 37 डिग्री सेल्सियस पर 12 घंटे ऊष्मायन, एक बाँझ 1.5 मिलीलीटर ट्यूब में संस्कृति सतह पर तैरनेवाला इकट्ठा।
  11. 24 अच्छी तरह से थाली के डुप्लिकेट कुओं में 500 μL संस्कृति सतह पर तैरनेवाला स्थानांतरण।
  12. धारा 3 हर हालत के लिए में वर्णित के रूप में पेट के अंग संस्कृति सतह पर तैरनेवाला में ई कोलाई (1,000 CFU) टीका लगाना, एक भी कुएं में ई कोलाई टीका लगाना। दूसरे को अच्छी तरह से युक्त ई कोलाई के बिना ही अंग संस्कृति सतह पर तैरनेवाला जीवाणु संक्रमण के लिए एक नियंत्रण के रूप में काम करेगा।
  13. एक नियंत्रण के रूप में किसी भी एंटीबायोटिक दवाओं के बिना संस्कृति मीडिया में बैक्टीरिया की एक ही राशि सेते हैं।
  14. 1 घंटे के लिए 37 डिग्री सेल्सियस पर सेते हैं।
  15. 50 μL प्रत्येक नमूना बूंद-वार MacConkey अगर प्लेटों पर की जगह है। रात भर में 37 डिग्री सेल्सियस के लिए MacConkey अगर प्लेटें सेते हैं।
  16. कालोनियों की संख्या की गणना और CFU / एमएल (चित्रा 4) की गणना।
e_title "> 5। रोगाणुरोधी जीनों की अभिव्यक्ति का मापन

  1. colonic अंग संस्कृति की रात ऊष्मायन (12 घंटे) के बाद धारा 2 और 4 में वर्णित है, 2 मिलीलीटर ठंडा पीबीएस (2x) के साथ पेट के टुकड़े को धोने के रूप में।
  2. एक 2 एमएल RNase / DNase मुक्त पेंच टोपी ट्यूब में पेट के टुकड़े ले लीजिए। बर्फ पर ट्यूबों रखें।
  3. वाणिज्यिक Trizol अभिकर्मक और lysing मैट्रिक्स मोती ट्यूब में जोड़े 1 एमएल।
  4. Lyse ऊतक एक स्वचालित ऊतक homogenizer का उपयोग।
  5. एक नया microcentrifuge ट्यूब में ऊतक lysate लीजिए।
  6. पृथक आरएनए मानक प्रोटोकॉल का उपयोग।
  7. आरएनए एकाग्रता उपाय।
  8. विआयनीकृत पानी के साथ उचित रूप से पतला आरएनए और उपयोग करने के लिए 500 एनजी शाही सेना सीडीएनए के संश्लेषण के लिए।
  9. लक्षित रोगाणुरोधी जीन, साइटोकिन्स, Chemokines, और हित के अन्य जीन की वास्तविक समय आरटी पीसीआर विश्लेषण के लिए सीडीएनए का प्रयोग करें।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

अंग संस्कृति में कॉलन का एक प्रतिनिधि चित्र चित्र 1 में दिखाया गया है। संस्कृति में पेट के टुकड़े पाचन और physiologically सक्रिय रहते हैं। वे संस्कृति मीडिया को जोड़ा गया बहिर्जात उत्तेजनाओं को कुशलता से जवाब। पूर्व vivo संस्कृति और exogenous उत्तेजनाओं के साथ उत्तेजना, जैसे आईएल 1β और आईएल 18 के लिए पेट के ऊतकों की तैयारी का एक योजनाबद्ध काम प्रवाह, चित्रा 2 में दिखाया गया है। चित्रा 3 शो है कि अंग संस्कृति में कॉलन जैसे रोगाणुरोधी पेप्टाइड्स व्यक्त करने में प्रतिनिधि डेटा β-defensin 2 (BD2), Reg3γ, S100a8, S100a9, और INOS आईएल 1β और आईएल 18 के जवाब में।

के रूप में ई कोलाई का काफी कम विकास अंग संस्कृति सतह पर तैरनेवाला के साथ incubated द्वारा प्रदर्शन मध्यस्थों पेट के प्रत्यारोपण द्वारा जारी एक रोगाणुरोधी हत्या प्रभाव दिखा रहे हैं ( 4 बी के आंकड़े)। इस तरह के ई कोलाई हत्या गतिविधि आगे आईएल 1β और आईएल -18 (आंकड़े -4 ए और 4 बी) की उत्तेजना से potentiated है। पेट के अंग संस्कृति ई कोलाई के बिना incubated supernatants MacConkey अगर (आंकड़े 4C और 4D) पर संस्कृति निम्न कोई बैक्टीरिया विकास दिखा। इन परिणामों के आगे बताते हैं कि inflammasome आंतों रोगाणुरोधी मेजबान रक्षा करने में एक महत्वपूर्ण भूमिका निभाता है।

कुल मिलाकर, यहाँ प्रस्तुत आंकड़े बताते हैं कि पूर्व vivo colonic अंग संस्कृति इन विट्रो में आंतों रोगाणुरोधी प्रतिरक्षा प्रतिक्रिया का अध्ययन करने के लिए एक बहुत ही उपयोगी तकनीक है।

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCजी
β-defensin 2 (BD2) _F TGACCACTGCCACACCAATG
β-defensin 2 (BD2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

तालिका 1: के लिए वास्तविक समय पीसीआर माउस प्राइमरों की सूची।


चित्रा 1: संस्कृति में माउस पेट के टुकड़े के प्रतिनिधि तस्वीर। (ए) एक सेल झरनी (100 माइक्रोन) 6 अच्छी तरह से थाली पर रखा पर पेट के टुकड़े की ऊष्मायन। पेट के टुकड़े 2 एमएल संस्कृति एंटीबायोटिक दवाओं के साथ पूरक मीडिया में डूबे हुए हैं। (बी) 2 घंटे ऊष्मायन के बाद, पेट के टुकड़े एक नया 12 अच्छी तरह से सेल संस्कृति एंटीबायोटिक दवाओं मुक्त माध्यम युक्त थाली के कुएं में स्थानांतरित कर रहे हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2: आईएल 1β और आईएल 18 के साथ पेट के ऊतकों की तैयारी और पूर्व vivo उत्तेजना के लिए कदम के योजनाबद्ध प्रस्तुति। एक माउस से पेट के longi है tudinally तीन भागों में विच्छेदित। प्रत्येक भाग छोटे टुकड़ों में काट और तौला गया। पेट के प्रत्येक खंड से पेट के टुकड़े 6 अच्छी तरह से थाली 2 मिलीलीटर DMEM / F12 मध्यम प्लस 5% FBS और एंटीबायोटिक दवाओं युक्त के कुओं पर रखा सेल strainers पर स्थानांतरित कर रहे हैं। एक 2 घंटे ऊष्मायन के बाद, एक ही सेल झरनी से पेट के टुकड़े एक 12 अच्छी तरह से सेल संस्कृति की थाली का एक भी अच्छी तरह से स्थानांतरित कर रहे हैं। DMEM / F12 प्लस 5% FBS (कोई एंटीबायोटिक) ऊतक का वजन (100 मिलीग्राम ऊतक के लिए 1 एमएल मीडिया) के अनुसार प्रत्येक कुएं में जोड़ा जाता है और मध्यम की मात्रा समायोजित किया जाता है। पेट के ऊतकों 12 घंटे के लिए आईएल 1β (20 एनजी / एमएल) और आईएल -18 (20 एनजी / एमएल) के साथ प्रेरित कर रहे हैं। संस्कृति supernatants centrifuged और ई कोलाई की हत्या परख और / या अन्य प्रतिरक्षा assays के लिए उपयोग किया जाता है। पेट के ऊतकों शाही सेना अलगाव और वास्तविक समय पीसीआर द्वारा रोगाणुरोधी जीन अभिव्यक्ति के बाद के विश्लेषण के लिए वाणिज्यिक trypsin अभिकर्मक में एकत्र कर रहे हैं।.jpg "लक्ष्य =" _blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3: माउस पेट के ऊतकों पूर्व vivo संस्कृति के दौरान आईएल 1β या आईएल 18 के जवाब में साइटोकिन्स और रोगाणुरोधी पेप्टाइड्स व्यक्त करते हैं। पेट के अंग संस्कृतियों 12 घंटे के लिए आईएल 1β (20 एनजी / एमएल) या आईएल -18 (20 एनजी / एमएल) के साथ प्रेरित किया गया। BD2, Reg3γ, S100a8, S100a9, और INOS की अभिव्यक्ति वास्तविक समय आरटी पीसीआर (तालिका 1) द्वारा मापा गया था। डेटा ± एसडी साधन प्रतिनिधित्व करते हैं; * पी <0.05, ** पी <0.01। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4: माउस पेट के अंग पंथ की सतह पर तैरनेवालाUre जीवाणुनाशक गतिविधि दर्शाती है। पेट के टुकड़े सुसंस्कृत पूर्व vivo 12 घंटे के लिए उपस्थिति या आईएल 1β (20 एनजी / एमएल) या आईएल -18 (20 एनजी / एमएल) के अभाव में थे। संस्कृति supernatants के 500 μl 37 डिग्री सेल्सियस पर 1 घंटे के लिए ई कोलाई (1,000 CFU) के साथ incubated रहे थे। ई कोलाई के बिना पेट के अंग संस्कृति सतह पर तैरनेवाला भी एक नियंत्रण के रूप में incubated था। 1 घंटे ऊष्मायन के बाद, प्रत्येक नमूने की 50 μL MacConkey अगर प्लेटों पर dropwise रखा और रात में 37 डिग्री सेल्सियस पर incubated था। (ए) का चित्र पेट के अंग संस्कृति के रोगाणुरोधी गतिविधि दिखा MacConkey अगर पर कालोनियों कोलाई। (बी) ई कोलाई गिनती आईएल 1β- और आईएल 18 इलाज पेट के अंग संस्कृति सतह पर तैरनेवाला की दक्षता की हत्या दिखा। (सी) MacConkey अगर प्लेट का चित्र ई कोलाई के बिना incubated पेट के अंग संस्कृति में कोई बैक्टीरिया विकास को दर्शाता है। (डी) नहीं कोलाई कालोनियों में पेट के अंग ग की पहचान की गईulture ई कोलाई के बिना incubated, नमूने में किसी भी दूषित बैक्टीरिया के अभाव का संकेत है। डेटा ± एसडी साधन प्रतिनिधित्व करते हैं; ** पी <0.01, *** पी <0.001। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

आंतों उपकला कोशिकाओं उनके विकास की आवश्यकताओं के मामले में बहुत संवेदनशील है और इसलिए संस्कृति के लिए मुश्किल हो जाता है। उपकला EDTA उपचार से अलग कक्षों में इस तरह के DMEM 8 के रूप में पारंपरिक सेल संस्कृति मीडिया में जीवित नहीं है। इसलिए, मेजबान रोगज़नक़ बातचीत पृथक तहखाना या प्राथमिक उपकला कोशिकाओं का उपयोग अध्ययन बहुत चुनौती दे रहे हैं। हाल ही में, सातो एट अल। एक तहखाना organoid संस्कृति प्रणाली है जो बहुत ही होनहार और आंतों pathophysiology 13 से संबंधित अध्ययन के लिए उपयोगी है का वर्णन किया। जबकि organoids आंतों तहखाना के कई सुविधाओं का प्रतिनिधित्व करते हैं, वहाँ के रूप में करने के लिए organoid कोशिकाओं है, जो एक बाँझ वातावरण में उगाया जा रहा है, के प्रतिरक्षा प्रतिक्रिया विवो में आंतों उपकला कोशिकाओं की प्रतिक्रियाओं पुनरावृत्ति कि क्या चिंता कर रहे हैं। सटीक अलगाव और उपकला स्टेम कोशिकाओं और organoids की संस्कृति के लिए महंगा अभिकर्मकों की आवश्यकता की संस्कृति के लिए आवश्यक तकनीक मा को रोकने केइस प्रणाली का लाभ लेने से एनवाई प्रयोगशालाओं। जबकि पूर्व vivo अंग संस्कृति के उपयोग organoid संस्कृति के लिए एक विकल्प नहीं है, इस प्रणाली आंतों उपकला के रोगाणुरोधी प्रतिक्रियाओं का अध्ययन करने के लिए एक आसान और सस्ता तरीका प्रदान करता है।

इस तकनीक का प्रमुख लाभ यह है कि आंत के ऊतक वास्तुकला, जबकि बर्तन में संवर्धन बनाए रखा है। हमने देखा है कि पेट के ऊतकों में कम से कम 24 घंटे के बाद उनकी संस्कृति के लिए physiologically सक्रिय हैं। पेट के संस्कृति के दौरान, colonic उपकला कोशिकाओं के रूप में साइटोकिन्स और रोगाणुरोधी पेप्टाइड्स की अभिव्यक्ति से मापा बहिर्जात उत्तेजनाओं को प्रतिक्रिया। बरकरार ऊतक के उपकला कोशिकाओं की व्यवहार्यता आगे संस्कृति के माध्यम में उचित वृद्धि कारक है और कोशिका मृत्यु का अवरोधकों के अलावा द्वारा बढ़ाया जा सकता है। पिछली रिपोर्टों का सुझाव है कि सामान्य मानव colonic ऊतक अंग कई दिनों 8 के लिए पूर्व vivo बनाए रखा जा सकता है sup>, 23, 24।

माउस colonic अंग के पूर्व vivo संस्कृति के लिए प्रोटोकॉल आंतों उपकला के रोगाणुरोधी प्रतिरक्षा प्रतिक्रिया से संबंधित अध्ययन में कई आवेदन कर सकते हैं। रोगजनकों और उनके PAMPs ऐसे टोल की तरह रिसेप्टर्स (TLRs) और इशारा की तरह रिसेप्टर्स (NLRs) उपकला और प्रतिरक्षा कोशिकाओं में मौजूद रूप PRRS द्वारा मान्यता प्राप्त हैं। दोषपूर्ण अभिव्यक्ति और कई TLRs और NLRs के समारोह आईबीडी के लिए संवेदनशीलता, कोलोरेक्टल tumorigenesis, और बैक्टीरियल संक्रमण के साथ जुड़े रहे हैं। चूंकि अमर उपकला कोशिका लाइनों आंतों आला की सभी सुविधाओं का प्रतिनिधित्व नहीं करते, पूर्व vivo पेट के अंग संस्कृति एक बहुत ही उपयोगी प्रायोगिक उपकरण है। इस प्रणाली का उपयोग करते हुए, हम आंतों उपकला कोशिकाओं में रोगाणुरोधी प्रेरक अणुओं की प्रेरण पर विभिन्न PAMPs या उत्तेजनाओं के प्रभाव की जांच कर सकते हैं। प्रतिनिधि प्रयोग में, हम पता चला है साइटोकिन्स like thatआईएल 1β और आईएल -18 ट्रिगर रोगाणुरोधी पेप्टाइड्स की अभिव्यक्ति (चित्रा 3)। हम यह भी पता चलता है कि यहां रोगाणुरोधी पेट के ऊतकों द्वारा उत्पादित पेप्टाइड्स प्रभावी ढंग से ई कोलाई (चित्रा 4) को मार सकता है। इन तकनीकों में पेट में रोगाणुरोधी मेजबान बचाव प्रतिक्रिया में lipopolysaccharide के प्रभाव (एलपीएस), पेप्टीडॉग्लीकैन (PGN), muramyldipeptide (एमडीपी), और अन्य PAMPs परीक्षण करने के लिए लागू किया जा सकता है।

हम थोड़ा के रूप में पहले 12, 16, 20, 25 में वर्णित पेट के अंग संस्कृति प्रोटोकॉल संशोधित किया है। हम दो चरणों में पेट के सुसंस्कृत। सबसे पहले, हम एंटीबायोटिक दवाओं के 2 घंटे के लिए मध्यम युक्त में पेट के ऊतक incubated। हम तो एंटीबायोटिक दवाओं के लिए स्वतंत्र मीडिया के साथ ऊष्मायन द्वारा पीछा पेट के टुकड़े के बार-बार धोने के साथ एंटीबायोटिक दवाओं हटा दिया। इस प्रकार, संस्कृति सतह पर तैरनेवाला की रात संस्कृति से प्राप्तपेट के प्रदर्शन के केवल स्रावित रोगाणुरोधी पेप्टाइड्स के प्रभाव जब ई कोलाई के साथ incubated। यह दृष्टिकोण हित के किसी भी बैक्टीरिया पर पेट के या आंत निकाली गई रोगाणुरोधी पेप्टाइड्स के जीवाणुनाशक प्रभाव को देखने के लिए उपयोग किया जा सकता है। एक उपयुक्त चयनात्मक अगर मीडिया संस्कृति को बैक्टीरिया का इस्तेमाल किया जाना चाहिए।

सबसे तकनीकों की तरह, वहाँ पूर्व vivo अंग संस्कृति प्रणाली की सीमाएं हैं। सबसे पहले, सेल संस्कृति या organoid संस्कृति के विपरीत, अंगों बढ़ने नहीं है और पैदा करना है और इसलिए विस्तार नहीं किया जा सकता है। दूसरा, आंतों उपकला कोशिकाओं बहुत संवेदनशील होते हैं और वे अतिरिक्त वृद्धि कारक है और apoptosis निरोधक, जो तहखाना organoid संस्कृति के लिए उपयोग किया जाता है बिना अपेक्षाकृत जल्दी मर जाते हैं। तीसरा, प्रतिरक्षा प्रतिक्रिया अंग संस्कृति से मनाया सेल आबादी के विभिन्न प्रकार के एक सामूहिक प्रतिक्रिया है। इसलिए, रोगाणुरोधी और प्रेरक जीनों की अभिव्यक्ति में अलग-अलग प्रकार की कोशिका की भूमिका का मूल्यांकन नहीं किया जा सकता। additionally, सेल लाइनों और organoid संस्कृति के विपरीत, रोगाणुरोधी पेप्टाइड्स और कोलन में अन्य प्रेरक अणुओं की अभिव्यक्ति माउस से ही आनुवंशिक पृष्ठभूमि के माउस के लिए भिन्न हो सकते हैं।

सारांश में, हम यहाँ है कि आंतों रोगाणुरोधी प्रतिरक्षा प्रतिक्रिया का अध्ययन करने के लिए बहुत उपयोगी है पूर्व vivo colonic अंग संस्कृति के लिए एक सरल प्रोटोकॉल का वर्णन। यह दृष्टिकोण ब्याज की आनुवंशिक उत्परिवर्ती चूहों से कॉलन संवर्धन द्वारा रोगाणुरोधी पेप्टाइड्स की अभिव्यक्ति में विविध सहज प्रतिरक्षा जीन की भूमिका का परीक्षण करने के लिए नियोजित किया जा सकता है। इसके अलावा, इस प्रोटोकॉल नैदानिक ​​अध्ययन में उपयोग colonic बायोप्सी नमूने का अंग संस्कृति का आयोजन द्वारा आईबीडी मरीजों की आंतों रोगाणुरोधी प्रतिक्रियाओं की जांच करने के लिए अनुकूलित किया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

कैंसर की रोकथाम और टेक्सास के अनुसंधान संस्थान (CPRIT; RP160169), और केन्द्र शासित प्रदेशों के दक्षिण मेडिकल सेंटर मेगाहर्ट्ज के लिए दिया जाता है, यह काम क्रोहन और अमेरिका के कोलाइटिस फाउंडेशन, (3711 CCFA) से धन के द्वारा समर्थित किया गया

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats