그만큼

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

장 상피 세포의 종류, 점막 면역 세포를 포함 propia 및 간질로 이루어진 반복 토굴 구조체의 구조를 표시한다. 이러한 이종 세포 모두 장내 항상성에 기여 항균 호스트 방어에 참여한다. 따라서, 생체 외 환경에서 면역 반응과 소장의 항균 활성을 연구 대리 모델을 식별하는 것은 매우 어렵습니다. 시험관 연구에서 정상 소장과 미세 환경의 정확한 생리를 대변하지 않습니다 organoid 문화 불후의 장 상피 세포 라인 또는 기본 토굴을 사용. 여기서, 우리는 배양 접시와 어떻게 생체 기관 배양 물 시스템은 미생물 숙주 방어 반응에 관한 연구에서 구현 될 수있다에서 배양 마우스 결장암 조직의 방법을 논의한다. 대표 실험에서, 우리는 장기 문화에 콜론이 RESP에 항균 펩티드를 표현하는 것으로 나타났다외인성 IL-1β 및 IL-18 온세. 또한, 기관 배양 물에서의 결장 조직에 의해 생성 된 미생물 이펙터 분자가 효율적으로 시험 관내 대장균 죽인다. 이 방법은, 따라서, 장내 선천적 면역 반응과 미생물 숙주 방어 반응을 조절하는 pathogen- 및 위험 - 관련 분자 패턴 및 세포 수용체의 역할을 절개하는 데에 이용 될 수있다.

Introduction

소장은 공생 미생물에 대한 장벽 역할을하는 동적 시스템을 나타냅니다 침입하는 병원균에 대한 싸움, 그리고 미생물 조성물 1을 조절한다. 장 상피 세포, 장 세포, 술잔 세포 Paneth 세포 및 장 내분비 세포로 이루어진 장내 미생물 대 숙주 방어 반응을 제공하는 주요 세포 집단이다. 술잔 세포는 상피 층 (2)의 상단에 완충 영역을 작성 뮤신 생산. Paneth 세포 및 장 세포 항균 펩티드, 사이토 카인과 항균 숙주 방어 반응을 구성하고 장내 미생물 조성물 (3, 4)를 형성에 기여하는 활성 산소 및 질소 종을 생산한다. 상피 세포뿐만 아니라, 대 식세포, 수지상 세포, 호중구, 자연 살해 세포, 림프구 및 인나 포함한 면역 세포 - 7 점막 고유 층과 점막하에 테 림프 세포를 생산하는 사이토 카인, 케모카인, 기타 매개체 5 장 항균 호스트 방어 반응에 중요한 역할을한다. 점막 면역계는 미생물을 조절하고 미생물 감염에 대한 보호를 제공하는 방법을 이해하기 위해, 장내의 이종 세포 집단의 복잡한 상호 작용을 고려하는 것이 중요하다. 그러나, 소장의 기능을 모두 포함 체외 모델을 사용할 수 없습니다. 따라서, 소장에서 호스트 병원체 상호 작용에 대한 분자 연구는 매우 도전이다.

지난 몇 년 동안, 장 점막의 양상을 모방 여러 모델 시스템은 염증성 장 질환 (IBD) 등의 위장 장애 (8)과 관련된 병리 생리 학적 과정을 연구 개발되어왔다 -= "외부 참조"> 14. 불후의 장 상피 세포 라인은 종종 상피 세포의 특정 반응을 연구하는 데 사용됩니다. 그러나, 차등 유전자 발현 및 불멸화 세포 기능, 데이터는 주로 생체 내 연구에서 관찰 된 것과 일치하지 않는 세포를 사용하여 얻은. 최근에 다른 자극 13 장 상피 세포의 반응을 평가하기위한 잠재적 인 도구로 떠오르고있다 organoid 문화 장 토굴. 이 시스템에서, 굴 줄기 세포 성장 및 3D organoid 구조를 개발할 수있다. organoid 배양 시스템은 장 상피 세포의 여러 측면을 연구하는데 매우 유용하지만, 면역 세포, 상피 세포 및 미생물 제품의 복잡한 상호 작용을 모방하지 않는다. 장 조직의 생체 문화는 생체 내 숙주 방어 반응을 더 잘 표현을 제공합니다. 이 방법에서, 상기 부위의 일부는 세포 배양 용 접시에서 배양 재치장내 세포 집단의 다른 유형을 허용 시간 적절한 미디어는 최소 48 시간 동안 대사 활성화합니다. 따라서, 장기의 생체 외 배양 미생물 유전자의 발현하고 특정 자극에 창자 숙주 방어 반응을 측정 할 수있다.

21 - 수사는 소장 (15)에 미생물 감염에 대한 숙주 방어 반응을 연구하기 위해 생체 장기 배양 시스템을 사용하고있다. 우리는 최근 마우스 콜론 (22)의 항균 호스트 방어 반응의 inflammasome을의 역할을 연구하기 위해 장기 배양 시스템을 채택했다. inflammasome을 성숙 IL-1β 및 IL-18의 생산을 위해 필요한 카스파 제 1의 활성화를위한 분자 플랫폼이다. 우리는 IL-1β 및 IL-18은 대장균 효과적으로 공생 pathobionts을 죽이는 항균 펩티드를 유도 것으로 나타났다 22 증가 대장균 부담과 일치했다. 이 시스템은 따라서, 그러한 염증성 장 질환 (IBD)과 결장암 (CRC)와 같은 장 질환의 장내 미생물 숙주 방어 반응에 패턴 인식 수용체 (PRRS)와 기타 선천성 면역 분자의 역할뿐만 아니라 기전을 연구하기 위해 이용 될 수있다. 이들 유전자의 대부분이 장내에서 변형 된 미생물 조성과 관련된 200 개 이상의 IBD 감수성 유전자, 돌연변이가있다. 그것은 IBD - 감수성 유전자가 장내 미생물 규제되는 정확한 메커니즘을 결정하는 큰 임상 적 의의이다. 이 방법의 전반적인 목표는 생체 대장 기관 배양의 기본 프로토콜을 소개하고,이 배양 방법은 대장의 항균 호스트 방어 반응을 연구하는 데 사용할 수있는 방법을 설명하는 것입니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

여기에 설명 된 모든 실험 동물 자원 센터 (ARC), UT 사우스 웨스턴 의료 센터에서 특정 병원체 무료 (SPF) 시설 유지 6-8주 세 남자 야생형 (C57BL6 / J) 마우스를 사용하여 수행 하였다. 모든 연구는 기관 동물 관리 및 사용위원회 (IACUC)의 승인을하고, IACUC 지침 및 실험 동물의 관리 및 사용을위한 건강 가이드의 국립 연구소에 따라 실시 하였다.

1. 수집 및 결장의 준비

  1. 자궁 경부 전위 다음 CO 2 질식와 쥐를 안락사.
  2. 70 % 에탄올로 마우스 스프레이와 보드 아래로 마우스 등의 측면을 지키는 고정 보드에 사지를 고정.
  3. 미리 멸균 해부 가위 집게를 사용하여 복부의 복막에 중심선을 절개한다. 집게로 복막을 접어 복부를 엽니 다.
  4. 복강 위스콘신에서 장을 제거번째는 집게와 가위를 해부. 맹장 하단과 항문의 타단 절단함으로써 소장으로부터 대장 별개.
  5. 얼음처럼 차가운 PBS를 포함하는 멸균 배양 접시에 콜론을 배치합니다. 결장 내강 내에서 대변이 완전히 제거 될 때까지 20 G 바늘 또는 경구 위관 영양법 바늘을 잡고 20 ㎖ 주사기를 사용하여 빙냉 PBS로 결장 내강의 내용이 플러시.
  6. 세로로 가위로 결장을 잘라. 멸균 페트리 접시에 얼음처럼 차가운 PBS에 격렬하게 흔들어 콜론을 씻으십시오.
  7. 약 1cm 긴 멸균 메스 나 가위를 사용하여 조각으로 결장 조직을 잘라.
  8. 대장 조각의 무게를 기록한다.
    참고 : 제 1의 모든 단계를 내부 또는 생물 안전 캐비닛의 외부에 수행 할 수 있습니다. 콜론 문화에 대한 준비가되면, 모든 단계는 무균 상태를 유지하기 위해 생물 안전 캐비닛 내부에서 수행해야합니다.

2. 콜론 조직문화

  1. 6- 웰 세포 배양 접시에 세포 스트레이너 (100 μm의)을 놓는다. 셀 스트레이너에 하나의 마우스에서 수집 결장 조각을 모두 전송합니다.
  2. 5 % FBS, 페니실린 - 스트렙토 마이신 (1 배) 및 겐타 마이신 (20 μg의 / ㎖)를 포함하는 5 mL의 DMEM / F12 매체를 추가합니다. 완전히 매체와 콜론 조각을 커버합니다.
  3. 5 % CO 2 및 95 % 공기 인큐베이터에서 37 ℃에서 2 시간 동안 인큐베이션.
  4. 셀 스트레이너를 들어 올리고 미디어를 대기음.
  5. 다시 우물의 셀 스트레이너를 놓고 어떤 항생제없이 5 ml의에게 신선한 매체를 추가 할 수 있습니다. 셀 스트레이너를 들어 올리고 미디어를 대기음.
  6. 잔류 항생 물질을 모두 제거하기 위해 위 세척 단계 (단계 2.5) 두 번 더 (총 3 회) 반복한다.
  7. 멸균 12 웰 세포 배양 플레이트의 한 웰에 단일 셀 스트레이너에서 결장 부분을 전송.
  8. (어떤 항생제 제외) 5 % FBS가 포함 된 DMEM / F12 매체를 추가합니다. weig와 매체의 볼륨을 조절할결장 조각 저항성, 예를 들어, 조직의 100 mg을 1 ml의 배지. 5 % CO 2 및 95 % 공기 주입 배양기에서 37 ℃에서 12 시간 동안 배양.
  9. 멸균 1.5 ML 튜브에서 배양 상등액을 수집합니다.
  10. 5 분 동안 4 ° C에서 12,000 XG에 원심 분리기. 분석 및 / 또는 기타 면역 분석을 죽이는 박테리아에 사용하기위한 새로운 1.5 mL의 튜브에 뜨는을 분리합니다. 상층 액을 분석 전까지 -80 ℃에서 저장 될 수있다.
  11. RNA 분리 용 튜브에 콜론 조각을 수집합니다.

분석을 죽이는 3. 대장균

  1. 15 ML 튜브에 5 mL의 루리아 - 베르 타니 (LB) 국물에 대장균을 접종하고 밤새 200 rpm으로 진탕 37 ° C에서 품어. 약간 느슨한 문화 튜브의 캡을 보관하십시오.
  2. 4 ℃에서 10 분 동안 1,200 XG에서 세균 배양 튜브를 원심 분리기. 상층 액을 제거하고 5 ml의 얼음처럼 차가운 PBS로 세균 펠렛을 재현 탁.
  3. BACT의 양도 1 mL의600 nm에서 큐벳 및 측정 OD에 erial 정지. 빈으로 PBS를 사용합니다.
  4. 소정의 표준 곡선을 사용하여 콜로니 형성 유닛 (CFU)을 계산한다. 여기, 그 1 OD = 2 × 109 CFU / ㎖ (약)를 가정합니다.
  5. 주식 서스펜션 1 × 105 CFU / mL로 세균 현탁액을 희석.
  6. 24 웰 세포 배양 플레이트의 중복 웰에 2.10 수집 결장 기관 배양 상등액을 전송 (500 μL / 웰).
  7. 하나 잘 포함 된 500 μL 대장 기관 배양 상청에 10 μL 대장균 문화 (1,000 CFU)를 추가합니다. 콜론 기관 배양 상청은 어떤 오염 물질을 포함하지 않는 것을 확인하는 대장균 접종하지 않고 다른 잘 둡니다.
  8. 제어와 같은 항생제없이 배양 배지 (DMEM / F12 플러스 5 % FBS) 박테리아 동일한 수 (1000 CFU)를 부화.
  9. 1 시간 동안 37 ℃에서 인큐베이션.
  10. 각각의 샘플 드롭 위스콘신의 50 μL를 놓습니다맥 콘키 배지 플레이트에 자체. 하룻밤 37 ° C에서 맥 콘키 배지 판을 품어.
  11. 콜로니의 수를 계산하고 CFU / ㎖을 계산합니다.

4. 대장 항균 호스트 방어 응답에 외부와 내장 요인의 효과

주 : 여기에서 설명 된 것처럼 미생물 사멸 분석은 장기 배양 상등액의 살균 활성에 대한 병원체 관련 분자 패턴 (PAMPs가) 및 사이토 카인의 효과를 조사하기 위해 채용 할 수있다. IL-1β 및 IL-18을 이용한 실험 예에 대하여 설명한다.

  1. 제 1 절에 설명 된대로 마우스의 콜론를 수집합니다.
  2. 멸균 종이 타월에 콜론을 배치합니다. 가위를 사용하여 세 부분 (그림 2)에 길이 방향으로 결장을 잘라.
  3. 제 1 항에 기재된 빙냉 PBS에서 결장의 각 부분을 세척한다.
  4. 작은 조각으로 대장의 각 부분을 잘라 무균 무게. 각 파트의 부분을 전송6 웰 세포 배양 플레이트의 세 개의 웰 (도 2) 상에 배치 된 세 개의 셀 스트레이너 (100 μm의)으로 결장.
  5. 5 % FBS, 페니실린 - 스트렙토 마이신 (1 배) 및 겐타 마이신 (20 μg의 / ㎖)를 포함하는 2 ml의 DMEM / F12 매체를 추가합니다.
  6. 5 % CO 2 및 95 % 공기 주입 배양기에서 37 ℃에서 2 시간 동안 배양.
  7. 2.4-2.6에 설명 된대로 대장 조각을 씻으십시오. 멸균 12 웰 세포 배양 플레이트의 한 웰에 단일 셀 스트레이너의 결장 부분을 전송. 하나의 마우스에서 결장의 세 부분을 포함하는 세 개의 우물 (그림 2) 치료, IL-1β로 지정하고, IL-18해야한다.
  8. (어떤 항생제 제외) 5 % FBS가 포함 된 DMEM / F12 매체를 추가합니다. 결장 부분의 중량, 예를 들어, 조직의 100 mg을 1 mL의 매체를 상기 매체의 볼륨을 조정한다.
  9. 12 시간 동안 IL-1β (20 NG / ㎖) 또는 IL-18 (20 NG / mL)로 콜론 기관 배양을 자극한다. 처리되지 않은 결장 장기 문화는 제어 역할을합니다.
  10. 5 % CO 2 및 95 % 공기를 주입 인큐베이터에서 37 ℃에서 12 시간 배양 한 후 멸균 된 1.5 ㎖의 튜브에 배양 상등액을 모은다.
  11. 24 웰 플레이트의 중복 우물에 500 μL의 배양 상등액을 전송합니다.
  12. 각 조건에 대해 제 3 절에서 설명한대로 하나의 웰에 대장균을 접종 대장 기관 배양 상등액 대장균 (1000 CFU)을 접종한다. 대장균이없는 다른 잘 포함하는 동일 장기 배양 상층 액은 세균 오염에 대한 제어 역할을합니다.
  13. 제어와 같은 항생제없이 배양 배지에서 세균이 동일한 양의 인큐베이션.
  14. 1 시간 동안 37 ℃에서 인큐베이션.
  15. 드롭 현명한 맥 콘키 배지 플레이트에 각 샘플의 50 μL를 놓습니다. 하룻밤에 37 ° C의 맥 콘키 배지 판을 품어.
  16. 콜로니의 수를 계산하고 CFU / ㎖ (그림 4)을 계산합니다.
e_title "> 5. 항균 유전자의 발현 측정

  1. 대장 기관 문화의 하룻밤 배양 (12 시간) 후 2 ml의 얼음처럼 차가운 PBS (2 배)와 콜론 조각을 씻고, 제 2 조 및 제 4에 설명 된대로.
  2. 2 용액의 RNase / DNase의 무료 스크류 캡 튜브에 콜론 조각을 수집합니다. 얼음에 튜브를 놓습니다.
  3. 튜브에 1 mL의에게 상업 트리 졸 시약 및 용균 매트릭스 구슬을 추가합니다.
  4. 를 Lyse 자동화 조직 균질화기를 사용하여 조직.
  5. 새로운 microcentrifuge 관에 조직 해물를 수집합니다.
  6. 표준 프로토콜을 사용하여 RNA를 분리합니다.
  7. RNA의 농도를 측정한다.
  8. 탈 이온수로 적절 RNA를 희석하는 cDNA를 합성하기 위해 500 NG의 RNA를 사용합니다.
  9. 대상 항균 유전자, 사이토 카인, 케모카인, 관심의 다른 유전자의 실시간 RT-PCR 분석을위한 cDNA를 사용합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

기관 배양에서 콜론의 대표적인 그림은 그림 1과 같다. 문화의 대장 조각 대사 및 생리 활성 남아있다. 그들은 배지에 첨가 외인성 자극에 효율적으로 반응한다. 생체 외 배양과 외인성 자극 자극, 예를 들어, IL-1β 및 IL-18에 대한 결장 조직의 제조 방법의 개략적 인 작업 흐름은,도 2에 도시되어있다. 기관 배양에서 콜론과 같은 항균 펩티드를 표현하는 그림 3 쇼 대표 데이터 β-디펜 신 2 (BD2), Reg3γ, S100a8, S100a9 및 iNOS의 IL-1β 및 IL-18에 대응한다.

장기 배양 상등액과 함께 배양 된 대장균의 성장 상당히 감소 있듯이 결장 임플란트에 의해 방출 된 매개체는 미생물 사멸 효과를 나타낸다 ( 4b에 도시한다. 대장균 죽이는 활성은 상기 IL-1β 및 IL-18 (도 4a 및도 4b)의 자극 potentiated된다. 대장균없이 배양 콜론 기관 배양 상층 액은 맥 콘키 배지 (도 4C와 4D)에 문화 다음 어떤 박테리아의 성장을 표시하지 않습니다. 이러한 결과는 상기 inflammasome을가 장내 미생물 숙주 방어에 중요한 역할을한다는 것을 제안한다.

전반적으로, 여기에 제시된 데이터는 생체 대장 기관 문화가 체외에서 장 항균 면역 반응을 연구하는 매우 유용한 기술이다하는 것이 좋습니다.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCC지
2 (BD2) _F을 β-디펜 신 TGACCACTGCCACACCAATG
2 (BD2) _R을 β-디펜 신 CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

표 1 : 실시간 PCR 용 마우스 프라이머의 목록입니다.


그림 1 : 문화의 마우스 대장 조각의 대표적인 사진입니다. 6- 웰 플레이트 상에 배치 된 셀 스트레이너 (100 μm의)의 대장 편 (A) 인큐베이션. 콜론 조각은 항생제로 보충 2 mL의 문화 미디어에 빠져들 수 있습니다. 2 시간 배양 후 (B)는, 대장 편 항생제 배지를 함유하는 새로운 12 웰 세포 배양 플레이트의 웰에 전달된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2 : IL-1β 및 IL-18과 대장 조직의 준비 및 생체 자극에 대한 단계의 도식 표현. 하나의 마우스에서 콜론은 longi입니다 tudinally 세 부분으로 해부. 각 부분은 작은 조각으로 절단하고 칭량 하였다. 대장의 각 섹션에서 콜론 조각 2 ml의 DMEM / F12 배지 플러스 5 % FBS와 항생제를 포함하는 6 웰 플레이트의 우물에 배치 셀 스트레이너에 전송됩니다. 2 시간 배양 한 후, 단일 셀 스트레이너에서 콜론 조각 12 웰 세포 배양 플레이트의 한 웰에 전송된다. 조직의 중량 (1 mL의 배지 100 mg의 조직을위한)에있어서 DMEM / F12 플러스 5 % FBS (항생제)을 각 웰에 첨가하고, 배지의 부피가 조절된다. 결장 조직을 12 시간 동안 IL-1β (20 ng의 / ml) 및 IL-18 (20 ng의 / ㎖)로 자극한다. 배양 상청액은 원심 분리하여 대장균 사망 분석 및 / 또는 다른 면역 분석에 사용된다. 결장 조직은 RNA 분리 및 실시간 PCR에 의한 항균 유전자 발현의 연속 분석 상용 트립신 시약으로 수집된다..JPG "대상 ="_ 빈 ">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3 : 마우스 대장 조직을 체외 배양시 IL-1β 또는 IL-18에 대한 응답으로 사이토 카인 및 항균 펩티드를 표현한다. 결장 기관 배양 12 시간 동안 IL-1β (20 ng의 / ㎖) 또는 IL-18 (20 ng의 / ml)로 자극 하였다. BD2, Reg3γ, S100a8, S100a9 및 iNOS의 발현을 실시간 RT-PCR (표 1)에 의해 측정 하였다. 데이터는 SD ± 수단을 나타냅니다; * P <0.05, ** p <0.01. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
그림 4 : 마우스 콜론 기관 숭배의 상층URE는 살균 작용을 나타낸다. 콜론 조각 12 시간 동안 IL-1β (20 ng의 / ㎖) 또는 IL-18 (20 ng의 / ㎖)의 존재 또는 부재 생체 전 배양 하였다. 배양 상청액 500 μL를 37 ℃에서 1 시간 동안 대장균 (1000 CFU)와 함께 배양 하였다. E. 콜라이없이 결장 기관 배양 상등액은 대조군으로 배양 하였다. 1 시간 배양 한 후, 각 시료 50 μL는 맥 콘키 배지 플레이트 상에 적하하여 넣고, 37 ℃에서 하룻밤 배양 하였다. E.의 (A) 사진 대장 기관 문화의 항균 활성을 나타내는 맥 콘키 배지에 식민지를 대장균. (B) 대장균 수는 IL-1β- 및 IL-18 처리 된 결장 기관 배양 상청 효율을 죽이는 도시. 대장균없이 배양 대장 기관 배양에는 세균의 성장을 보여주는 맥 콘키 배지 플레이트 (C) 사진. (D) 없음 대장균 콜로니 결장 기관 C에서 식별 된ulture 샘플에있는 박테리아 오염의 부재를 나타내는, E. 콜라이 않고 배양 하였다. 데이터는 SD ± 수단을 나타냅니다; ** p <0.01, *** p <0.001. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

장 상피 세포 성장 요구 사항의 관점에서 매우 민감하고 문화에 따라서 어렵다. EDTA 처리에 의해 고립 된 상피 세포는 DMEM (8)과 같은 기존의 세포 배양 배지에서 생존하지 않습니다. 따라서, 고립 된 지하실 또는 기본 상피 세포를 사용하여 호스트 병원체 상호 작용 연구는 매우 도전이다. 최근, 사토 등. 장 병태 생리 (13)에 관한 연구에 매우 유망하고 유용한 토굴 organoid 문화 시스템을 설명했다. organoids이 장 지하실의 많은 기능을 나타내는 반면, 같은 무균 환경에서 재배되고있는 organoid 세포의 면역 반응이 생체 내에서 장 상피 세포의 반응을 요점을 되풀이할지 여부에 관심이 있습니다. 상피 줄기 세포와 organoids의 문화 비싼 시약의 요구 사항의 분리 및 배양에 필요한 정확한 기술은 엄마를 방지이 시스템의 이점을 취하는 NY 연구소. 생체 장기 문화의 사용이 organoid 문화에 대한 대안은 아니지만,이 시스템은 장 상피 세포의 항균 반응을 연구 할 수있는 쉽고 저렴한 방법을 제공합니다.

이 기술의 주요 장점은 접시에 배양하면서 부위의 조직 구조가 유지된다는 점이다. 우리는 대장 조직이 그들의 문화 후 최소 24 시간 동안 생리 활성되어 있음을 관찰 할 수 있었다. 사이토 카인과 항균 펩타이드의 발현에 의해 측정 된 결장의 배양 동안, 대장 상피 세포는 외인성 자극에 반응한다. 손상되지 않은 조직의 상피 세포의 생존 능력은 상기 배양 배지에 적절한 성장 인자 및 세포 사멸 억제제의 첨가에 의해 향상 될 수있다. 이전 보고서는 정상적인 인간 결장 조직 기관 며칠 8 생체 유지 될 수 있음을 시사 SUP> 23, 24.

마우스 결장 기관의 체외 배양을위한 프로토콜은 장 상피 세포의 항균 면역 반응에 관한 연구에 많은 응용 프로그램을 가질 수있다. 병원균과 PAMPs가 그러한 수신자 같은 수용체 (TLR들)과 상피와 면역 세포에 존재하는 NOD 같은 수용체 (NLRs)와 같은 PRRS에 의해 인식됩니다. 결함이있는 표현과 많은 TLR들과 NLRs의 기능은 IBD에 대한 감수성, 대장 종양 및 세균 감염과 연관되어 있습니다. 불멸화 상피 세포주 장내 틈새의 모든 기능을 나타내지 않기 때문에 상기 생체 결장 기관 배양 물은 매우 유용한 실험 도구이다. 이 시스템을 사용하여, 우리는 장 상피 세포에서 항균 이펙터 분자의 유도에 다양 PAMPs가하거나 자극의 효과를 조사 할 수있다. 대표 실험에서는 사이토 카인이 좋아하는 것으로 나타났다IL-1β 및 IL-18 트리거 항균 펩타이드의 발현 (도 3). 우리는 또한 대장 조직에 의해 생성 된 항균 펩타이드를 효과적으로 대장균 (그림 4)을 죽일 수 있다는 것을 여기에 표시됩니다. 이러한 기술은 장내 미생물 숙주 방어 반응에 리포 폴리 사카 라이드의 영향 (LPS), 펩티도 글리 칸 (PGN) muramyldipeptide (MDP) 및 다른 PAMPs가 테스트에 적용될 수있다.

우리는 이전에 약간의 12, 16, 20, 25 바와 같이 결장 기관 배양 프로토콜을 수정했다. 우리는 두 단계로 콜론을 배양. 첫째, 우리는 2 시간 동안 매체를 포함하는 항생제 결장 조직을 배양 하였다. 우리는 그 다음 항생제 무료 매체와 배양 다음에 콜론 조각의 반복 세탁으로 항생제를 제거했습니다. 따라서, 배양 상층 액의 하룻밤 배양 물로부터 얻은대장을 나타낸다 대장균 배양 분비 항균 펩타이드의 효과. 이 방법은 관심있는 박테리아에 결장 부위 유래 항균 펩타이드의 살균 효과를 확인하기 위해 이용 될 수있다. 적절한 선택 한천 미디어 문화에 박테리아를 사용해야합니다.

대부분의 기술과 마찬가지로, 생체 기관 배양 물 시스템의 한계가있다. 첫째, 세포 배양 또는 organoid 문화와는 달리, 장기 성장하고 증식하기 때문에 확장 할 수 없습니다하지 않습니다. 둘째, 장 상피 세포는 매우 민감하고는 토굴 organoid 문화에 사용되는 추가 성장 인자 및 세포 사멸 억제제없이 비교적 빨리 죽는다. 셋째, 장기 배양에서 관찰 된 면역 반응은 세포 집단의 다른 종류의 집합 적 응답이다. 따라서, 항균성 및 효과기 유전자 발현의 개별 세포 유형의 역할을 평가 될 수 없다. Additionally, 세포주 및 organoid 문화와는 달리, 항균 펩타이드와 콜론의 다른 이펙터 분자의 발현 마우스에서 동일한 유전 적 배경 마우스 다를 수 있습니다.

요약하면, 우리는 장 항균 면역 반응을 연구하는데 매우 유용 생체 대장 기관 배양을위한 간단한 프로토콜은 여기에 대해 설명합니다. 이 접근법은 관심의 유전자 변이 생쥐 콜론 배양하여 항균 펩타이드의 발현에서 다양한 선천성 면역 유전자의 역할을 테스트하기 위해 사용될 수있다. 또한,이 프로토콜은 결장 생체 검사 샘플을 기관 배양 물을 실시하여 IBD 환자의 장내 미생물 반응을 조사하는 임상 연구에 사용하기 위해 구성 될 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

암 예방 및 텍사스 연구소 (CPRIT, RP160169), 그리고 UT 사우스 웨스턴 의료 센터가 MHZ에게 주어진,이 작품은 크론과 미국의 대장염 재단 (3711 CCFA)에서 자금에 의해 지원되었다

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats