Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Кишечник отображает архитектуру повторяющихся крипт структур, состоящих из различных типов эпителиальных клеток, пластинкой propia, содержащих иммунные клетки, и стромы. Все эти гетерогенных клеток способствуют кишечной гомеостаза и участвуют в антимикробной защите хозяина. Таким образом, выявление суррогатной модели для изучения иммунного ответа и антимикробную активность кишечника в установке в пробирке является чрезвычайно сложной задачей. В пробирке исследования с использованием иммортализованных кишечника линии эпителиальных клеток или даже первичного крипту Органоид культуры не представляют точной физиологии нормального кишечника и его микросреды. Здесь мы обсудим метод культивирования мыши ткани толстой кишки в культуральную чашку и как это ех естественных условиях система органной культуры может быть реализован в исследованиях , связанных с антимикробным защитных реакций - хозяев. В типичных экспериментах мы показали, что колоны в органной культуре выражают антимикробные пептиды в соотвonse к экзогенного IL-1 и IL-18. Кроме того, противомикробные эффекторные молекулы , вырабатываемые ткани толстой кишки в органной культуре эффективно убить кишечной палочки в пробирке. Этот подход, таким образом, может быть использован, чтобы рассекать роль патогенез и опасности ассоциированных молекулярных моделей и их клеточных рецепторов в регуляции кишечной врожденные иммунные реакции и противомикробные реакции защиты организма.

Introduction

Кишечник представляет собой динамическую систему , которая действует в качестве барьера для синантропных микроорганизмов, борется с вторгшихся патогенов, а также регулирует микробного состава 1. Кишечные эпителиальные клетки, состоящие из энтероцитов, бокаловидных клеток, клеток Paneth и энтероэндокринные клеток, являются основными популяции клеток, которые обеспечивают защитные реакции организма против кишечных микробиоты. Кубком клетки производят муцины , которые создают демилитаризованную зону на верхней части эпителиального слоя 2. Клетки Paneth и энтероцитов производят антимикробные пептиды, цитокины и реактивные формы кислорода и азота , которые представляют собой противомикробные реакции защиты организма и способствует формированию кишечного микробного состава 3, 4. В дополнение к эпителиальным клеткам, клетки иммунной системы, включая макрофаги, дендритные клетки, нейтрофилы, естественные клетки-киллеры, лимфоциты, и Инны т.е лимфоидных клеток в собственной пластинке слизистой оболочки и подслизистой играют решающую роль в кишечных антибактериальных реакций иммунной защиты путем продукции цитокинов, хемокинов и других посредников 5 - 7. Для того, чтобы понять, как иммунная система слизистых оболочек регулирует микрофлору и обеспечивает защиту от микробной инфекции, важно учитывать сложное взаимодействие гетерогенных клеточных популяций кишечнике. Тем не менее, модель в пробирке , которая включает в себя все особенности кишечника отсутствует. Таким образом, молекулярные исследования взаимодействия хозяин-патоген в кишечнике являются весьма сложной задачей.

За последние несколько лет, известно несколько модельных систем , которые имитируют аспекты слизистой оболочки кишечника, были разработаны для исследования патофизиологических процессов , участвующих в воспалительных заболеваний кишечника (IBD) и других желудочно - кишечных расстройств , 8 -= "Xref"> 14. Иммортализованные эпителиальным клеткам кишечника линии часто используются для изучения эпителиальные клетки конкретных ответов. Тем не менее, из - за дифференциальной экспрессии генов и функции в иммортализованных клеток, данные , полученные с использованием этих клеток не часто совпадают с наблюдаемыми в исследованиях in vivo на . Кишечные крипты Органоид культура в последнее время появились в качестве потенциального инструмента для оценки реакции эпителия кишечника на различные стимулы 13. В этой системе, крипт стволовые клетки могут расти и развивать 3D Органоид структуру. В то время как система Органоид культура очень полезна для изучения многих аспектов кишечного эпителия, он не имитирует сложное взаимодействие иммунных клеток, эпителиальных клеток и микробных продуктов. Экс Vivo культуры кишечной ткани предлагает лучшее представление в естественных условиях защитных реакций хозяина. В этом способе часть кишечника культивируют в пластинчатом остроумием клеточной культурыч надлежащие средства, позволяющие различные типы клеточных популяций в кишечнике, чтобы быть метаболически активными в течение по крайней мере 48 часов. Таким образом, экс виво культура органа может быть использован для измерения экспрессии генов антимикробных и ответов защиты хозяина кишечника к определенному стимулу.

Исследователи использовали экс виво систему органной культуры для изучения реакции иммунной защиты против микробной инфекции в кишечнике 15 - 21. Недавно мы приняли систему органной культуры для изучения роли инфламмасома в антимикробных защитных реакций хозяев в двоеточиями 22 мыши. Инфламмасома является молекулярная платформа для активации каспазы-1, который необходим для производства выдержанного IL-1 и IL-18. Мы показали , что IL-1β и IL-18 индуцирует антимикробные пептиды , которые эффективно уничтожают комменсальные pathobionts , таких как E.coli кишечной палочки в инфламмасома исправный двоеточиями мыши 22. Эта система, следовательно, может быть использована для изучения роли распознающих рецепторов (РРСС) и других врожденных иммунных молекул в кишечных антибактериальных реакций иммунной защиты, а также патогенез кишечных расстройств, таких как воспалительное заболевание кишечника (IBD) и колоректального рака (КПР). Есть более чем 200 IBD восприимчивость генов, мутации и во многих из этих генов связаны с изменением микробного состава в кишечнике. Это имеет большое клиническое значение для определения точного механизма, с помощью которого гены IBD-восприимчивость регулировать кишечную флору. Общая цель этого метода является введение базовый протокол экс виво толстой кишки органной культуры и продемонстрировать , как этот метод культура может быть использован для изучения антимикробные реакции иммунной защиты кишечника.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все эксперименты, описанные здесь, были выполнены с использованием 6-8 недель самцам дикого типа (C57BL6 / J) мышей поддерживали в не содержащих специфических патогенов (SPF) объекта в ресурсном центре животных (ARC), Техасском медицинском центре. Все исследования были одобрены Institutional Animal Care и использование комитета (IACUC) путем и были проведены в соответствии с руководящими принципами IACUC и Национальных институтов здравоохранения Руководство по уходу и использованию лабораторных животных.

1. Сбор и подготовка толстой кишки

  1. Эвтаназии мышей с СО 2 удушья с последующим смещением шейных позвонков.
  2. Спрей мышей с 70% этанолом и приколоть конечности к пиннинга борту, поддерживая мышь спинной стороной вниз на доске.
  3. Использование предварительно стерилизованы рассечения ножницы и пинцет, сделать надрез в середине строки в брюшине живота. Откройте живот путем складывания брюшины с пинцетом.
  4. Удалите кишечник из брюшной полости Wiй рассекает пинцет и ножницы. Отделить толстую кишку из тонкой кишки за счет сокращения в нижней части слепой кишки, а другой конец в прямой кишке.
  5. Поместите двоеточие в стерильную чашку Петри, содержащую ледяной PBS. Промыть содержимое просвета толстой кишки с охлажденным льдом PBS, используя 20 мл шприц, держащего 20 G иглу или перорально через зонд иглу до тех пор, стул в просвете ободочной кишки не полностью удаляется.
  6. Вырезать толстую кишку с ножницами в продольном направлении. Вымойте толстую кишку путем встряхивания энергично в ледяном PBS в стерильную чашку Петри.
  7. Обрежьте ткань толстой кишки на куски длиной около 1 см с использованием стерильным скальпелем или ножницами.
  8. Запишите вес кусков толстой кишки.
    Примечание: Все действия, описанные в разделе 1 может быть выполнена внутри или снаружи биологической безопасности кабинета. После того, как колоны готовы к культуре, все шаги должны быть выполнены в кабинете биологической безопасности для поддержания стерильности.

2. Colon Orgкультуральной

  1. Поместите клеточный фильтр (100 мкм) на 6-луночный культуральный планшет. Перенесите все части толстой кишки, собранные от одной мыши в ячейки фильтра.
  2. Добавьте 5 мл DMEM / F12 среды, содержащей 5% FBS, пенициллин-стрептомицина (1x) и гентамицин (20 мкг / мл). Полностью покрыть куски толстой кишки со средствами массовой информации.
  3. Инкубировать в течение 2 ч при 37 ° С в инкубаторе с 5% CO 2 и 95% воздуха.
  4. Поднимите фильтр грубой очистки клеток и аспирата СМИ.
  5. Поместите сетчатый фильтр клеток обратно на лунку и добавляют 5 мл свежей средой без каких-либо антибиотиков. Поднимите фильтр грубой очистки клеток и аспирата СМИ.
  6. Повторите предыдущий шаг стирки (этап 2.5) в два раза больше (всего 3 раза), чтобы удалить все остатки антибиотиков.
  7. Передача части ободочной кишки из одной клетки сетчатого фильтра в одну лунку стерильного 12-луночный планшет для культивирования.
  8. Добавить DMEM / F12, содержащей 5% FBS (без каких-либо антибиотиков). Регулировка громкости среды с WeigХТ из кусков толстой кишки, например, 1 мл среды для 100 мг ткани. Инкубируют в течение 12 ч при 37 ° С в термостате инъекционным 5% CO 2 и 95% воздуха.
  9. Собирают супернатант культуры в стерильном 1,5 мл трубки.
  10. Центрифуга при 12000 х г при 4 ° С в течение 5 мин. Отделить супернатант в новую 1,5 мл трубки для использования в бактериях умерщвления анализа и / или другие иммунные анализы. Жидкость над осадком можно хранить при температуре -80 ° С до анализа.
  11. Соберите части толстой кишки в трубке для выделения РНК.

3. кишечная палочка Killing Пробирной

  1. Инокулируйте кишечной палочки в 5 мл Лурии-Бертани (LB) бульона в 15 мл пробирку и инкубировать при 37 ° C при встряхивании со скоростью 200 оборотов в минуту в течение ночи. Держите крышку культуральной трубки слегка свободно.
  2. Центрифуга культуральную пробирку бактериальный при 1200 х г в течение 10 мин при температуре 4 ° С. Удалить супернатант и ресуспендируют осадок в бактериальную 5 мл охлажденного льдом PBS.
  3. Передача 1 мл BactПерс подвески в кювету и меры OD при 600 нм. Используйте PBS в качестве заготовки.
  4. Вычислить колониеобразующих единицы (КОЕ), используя заранее определенную калибровочную кривую. Здесь предположим , что 1 OD = 2 · 10 9 КОЕ / мл (приблизительно).
  5. Развести бактериальной суспензии , чтобы сделать акции подвеска 1 х 10 5 КОЕ / мл.
  6. Перенести двоеточие органной культуральный супернатант (500 мкл / лунку), собранные в разделе 2.10 в дублированных лунках 24-луночный планшет для культивирования.
  7. Добавляют 10 мкл культуры кишечной палочки (1000 CFU) в одну лунку , содержащую 500 мкл толстой кишки органа супернатанта культуры. Оставьте другую скважину без палочки E. инокуляции , чтобы подтвердить , что двоеточие орган супернатанта культуры не содержит каких - либо загрязнений.
  8. Выдержите в то же количество бактерий (1000 КОЕ) в культуральной среде Игла (DMEM / F12 плюс 5% FBS) без каких-либо антибиотиков в качестве контроля.
  9. Инкубируют при 37 ° С в течение 1 ч.
  10. Поместите 50 мкл каждого образца в раскрывающемся Wiсебе на чашках МакКонки. Инкубируйте МакКонки агаром при 37 ° С в течение ночи.
  11. Подсчитайте количество колоний и рассчитывают КОЕ / мл.

4. Влияние внешних и внутренних факторов на Толстокишечная противомикробным принимающих ответные меры обороны

Примечание: Противомикробное анализ убийства, как описано здесь, могут быть приняты для изучения влияния патогена ассоциированных молекулярных моделей (PAMPs) и цитокинов на бактерицидную активность органной культуры супернатанта. Примером такого эксперимента с использованием IL-1 и IL-18 описан ниже.

  1. Соберите колонов от мышей, как описано в разделе 1.
  2. Поместите двоеточие на стерильную бумажным полотенцем. Вырезать толстую кишку в продольном направлении на три части с помощью ножниц (рисунок 2).
  3. Промыть каждую часть толстой кишки в охлажденный льдом PBS, как описано в разделе 1.
  4. Разрезать каждую часть толстой кишки на мелкие кусочки и взвешивают асептически. Передача части каждой частитолстой кишки на три отдельных сетчатых клеток (100 мкм) , размещенных на трех скважинах 6-луночный культуральный планшет (рисунок 2).
  5. Добавить 2 мл DMEM / F12 среды, содержащей 5% FBS, пенициллин-стрептомицина (1x) и гентамицин (20 мкг / мл).
  6. Инкубировать в течение 2 ч при 37 ° С в термостате инъекционным 5% CO 2 и 95% воздуха.
  7. Вымойте части толстой кишки, как описано в 2.4-2.6. Передача части толстой кишки одной ячейки фильтра в одну лунку стерильного 12-луночный планшет для культивирования. Три лунки , содержащие три части толстой кишки от одной мыши , должны быть назначены в качестве необработанной, IL-1 и ИЛ-18 (фигура 2).
  8. Добавить DMEM / F12, содержащей 5% FBS (без каких-либо антибиотиков). Регулировка громкости среды с весом кусков толстой кишки, например, 1 мл среды для 100 мг ткани.
  9. Стимулируют толстой кишки органной культуры с IL-1 (20 нг / мл) или IL-18 (20 нг / мл) в течение 12 ч. Необработанные толстой кишки органной культуры служит в качестве контроля.
  10. Через 12 ч инкубации при 37 ° С в термостате инъекционным 5% CO 2 и 95% воздуха, собирают супернатант культуры в стерильном 1,5 мл трубки.
  11. Перенести 500 мкл супернатанта культуры в дублированных лунках 24-луночного планшета.
  12. Привить E. coli (1000 CFU) в Колоне органе супернатанта культуры , как описано в разделе 3. Для каждого условия посев кишечной палочки в одной скважине. Другой резервуар, содержащий тот же орган супернатант культуры без кишечной палочки будет служить в качестве контроля бактериального загрязнения.
  13. Выдержите в то же самое количество бактерий в культуральной среде без каких-либо антибиотиков в качестве контроля.
  14. Инкубируют при 37 ° С в течение 1 ч.
  15. Поместите 50 мкл каждого образца по каплям на МакКонки чашках с агаром. Инкубируйте МакКонки агаром в течение ночи при 37 ° С.
  16. Подсчитайте количество колоний и рассчитывают КОЕ / мл (рисунок 4).
e_title "> 5. Измерение экспрессии антимикробных генов

  1. После инкубации в течение ночи (12 ч) ободочной органной культуры, как описано в разделах 2 и 4, моют куски толстой кишки с 2 мл охлажденного льдом PBS (2х).
  2. Соберите части толстой кишки в свободный завинчивающейся крышкой трубки 2 мл РНКазы / ДНКазы. Место труб на льду.
  3. Добавить 1 мл коммерческого тризола реагента и Lysing матрицы бусинки в трубку.
  4. Лизиса ткани с использованием автоматического гомогенизатора тканей.
  5. Собирают лизата ткани в новую пробирку микроцентрифужных.
  6. Изолировать РНК с использованием стандартного протокола.
  7. Измерение концентрации РНК.
  8. Развести РНК соответствующим образом с помощью деионизированной воды и используют 500 нг РНК для синтеза кДНК.
  9. С помощью кДНК в режиме реального времени RT-PCR анализа целевых антимикробных генов, цитокинов, хемокинов и других представляющих интерес генов.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Представитель картина двоеточиями в органной культуре показано на рисунке 1. Части толстой кишки в культуре остаются метаболически и физиологически активным. Они эффективно реагируют на экзогенные раздражители, добавленных в культуральную среду. Схема работы потока подготовки ткани толстой кишки для экс естественных условиях культуры и стимуляции экзогенных раздражителей, например , IL-1 и IL-18, как показано на рисунке 2. Представительные данные на рисунке 3 , показывают , что колоны в органной культуре выражают антимикробные пептиды , такие как β-дефенсина 2 (BD2), Reg3γ, S100a8, S100a9 и иОАС в ответ на IL-1 и IL-18.

Эти медиаторы , высвобождаемые при помощи имплантатов толстой кишки проявляют противомикробное Летальный эффект , как продемонстрировано значительно сниженным роста кишечной палочки , инкубированных с органной культуры супернатанта ( 4B). Такой кишечной палочки убийство активность дополнительно усилено стимуляции IL-1 и IL-18 (фиг.4А и 4В). Colon супернатанты органной культуры , инкубированные без кишечной палочки не обнаруживают роста бактерий следующей культуры на МакКонки агар (рис 4C и 4D). Эти результаты также свидетельствуют о том, что инфламмасома играет важную роль в кишечном антимикробной защиты организма.

В целом, представленные здесь данные свидетельствуют о том , что экс виво ободочной органной культуры является очень полезным методом для изучения кишечных антимикробные иммунные реакции в пробирке.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCг
β-дефенсина 2 (bd2) _F TGACCACTGCCACACCAATG
β-дефенсина 2 (bd2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Таблица 1: Список праймеров мыши для ПЦР в реальном времени.


Рисунок 1: представитель изображение частей мыши толстой кишки в культуре. (А) инкубацию кусков толстой кишки на клеточный фильтр (100 мкм) , размещенные на 6-луночный планшет. Colon кусочки погружают в 2 мл культуральной среды, дополненной антибиотиками. (В) После 2 ч инкубации кусочки ободочной переносятся в скважину нового 12-луночный планшет для культивирования , содержащей антибиотики среде без. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2: Схематическое представление шагов для подготовки тканей толстой кишки и экс естественных условиях стимуляции с IL-1 и IL-18. Толстой кишки от одной мыши Longi поля- разрезан на три части. Каждая часть разрезали на мелкие кусочки и взвешивают. Куски ободочной из каждой секции толстой кишки переносятся на клеточные стяжек, размещенных на лунки 6-луночного планшета, содержащую 2 мл DMEM / F12 плюс 5% FBS и антибиотиков. После 2 ч инкубации, куски толстой кишки от одной ячейки фильтра передаются в одну лунку 12-луночный культуральный планшет. DMEM / F12 плюс 5% FBS (без антибиотиков) добавляли в каждую лунку и объем среды регулируют в зависимости от веса ткани (1 мл среды для 100 мг ткани). тканей толстой кишки, стимулированных IL-1 (20 нг / мл) и IL-18 (20 нг / мл) в течение 12 ч. Супернатанты культуры центрифугируют и используют дл E.coli убивающей анализа и / или других иммунных анализов. Ткани толстой кишки собирают в промышленную трипсина реагент для выделения РНК и последующего анализа антимикробной экспрессии генов с помощью ПЦР в реальном времени..jpg "целевых =" _blank "> Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3: ткани толстой кишки мышей выразить цитокины и антимикробные пептиды в ответ на IL-1 или IL-18 во время экс естественных условиях культуры. Colon органных культур стимулировали IL-1 (20 нг / мл) или IL-18 (20 нг / мл) в течение 12 часов. Выражение BD2, Reg3γ, S100a8, S100a9 и иСОА измерялась в режиме реального времени RT-PCR (таблица 1). Данные представляют собой среднее значение ± SD; * Р <0,05, ** р <0,01. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 4
Рисунок 4: супернатанта мыши культа толстой кишки органаЮр проявляет бактерицидную активность. Colon кусочки культивировали экс виво в присутствии или в отсутствие IL-1 (20 нг / мл) или IL-18 (20 нг / мл) в течение 12 ч. 500 мкл супернатанта культуры инкубировали с E. coli (1000 CFU) в течение 1 ч при 37 ° С. Colon орган супернатант культуры без E.coli, также инкубировали в качестве контроля. После 1 ч инкубации, 50 мкл каждого образца помещали по каплям на чашках с агаром MacConkey и инкубировали при 37 ° С в течение ночи. (A) Изображение E.coli колоний на МакКонки агар показывающие антимикробную активность культуры толстой кишки органа. (B) E. Количество палочки , показывая убийство эффективность IL-1β- и IL-18-обработанной толстой кишки орган супернатанта культуры. (C) Изображение агаром МакКонки не показывая роста бактерий в культуре органов толстой кишки инкубировали без кишечной палочки. (D) Нет E. колонии палочки были обнаружены в толстой кишки органа Culture инкубировали без кишечной палочки, что свидетельствует об отсутствии каких - либо загрязняющих бактерий в образце. Данные представляют собой среднее значение ± SD; ** Р <0,01, *** р <0,001. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Кишечные эпителиальные клетки очень чувствительны с точки зрения их потребностей роста и, следовательно, трудно культуре. Эпителиальные клетки , выделенные при обработке ЭДТА , не выживают в обычных средах для культивирования клеток , таких как DMEM 8. Таким образом, исследования взаимодействия хозяин-патоген с использованием выделенных крипту или первичные эпителиальные клетки являются очень сложной задачей. В последнее время, Сато и др. описал шифровальную Органоид систему культуры , которая является весьма перспективным и полезным для исследований , связанных с патофизиологии кишечника 13. В то время как органоиды представляют много особенностей кишечной крипты, существуют опасения относительно того , является ли иммунные ответы на органоид клеток, которые выращивают в стерильных условиях, Повторим реакции клеток эпителия кишечника в естественных условиях. Точные методы, необходимые для выделения и культуры эпителиальных стволовых клеток и требование дорогих реагентов для культуры органоидами предотвращения маюбые лаборатории из воспользовавшись этой системы. В то время как использование экс естественных условиях органной культуры не является альтернативой Органоид культуре, эта система предлагает простой и недорогой метод для изучения антимикробные реакции кишечного эпителия.

Основным преимуществом этого метода является то, что архитектура ткани кишечника сохраняется во время культивирования в чашках. Мы наблюдали, что ткани толстого кишечника физиологически активны в течение по меньшей мере 24 ч после их культуры. Во время культивирования толстой кишки, ободочной эпителиальные клетки реагируют на экзогенные раздражители, как измерено с помощью экспрессии цитокинов и противомикробных пептидов. Жизнеспособность клеток эпителия интактной ткани может быть дополнительно повышена за счет добавления соответствующих факторов роста и ингибиторов клеточной гибели в культуральной среде. Предыдущие доклады свидетельствуют о том, что нормальный человеческий орган толстой ткани может быть сохранена ех VIVO в течение нескольких дней 8 SUP>, 23, 24.

Протокол экс виво культуры мыши ободочной органа может иметь множество применений в исследованиях , связанных с антимикробным иммунных реакций эпителия кишечника. Возбудители и их PAMPs признаны PRRS, такие как Toll-подобные рецепторы (TLR,) и NOD-подобных рецепторов (NLRs), присутствующих в эпителиальных и иммунных клеток. Дефектные выражение и функцией многих TLRs и NLRs связаны с восприимчивостью к IBD, колоректальный онкогенеза и бактериальных инфекций. Так как иммортализованные эпителиальные клеточные линии , не представляют все признаки кишечной нише, экс Vivo культуры толстой кишки орган является очень полезным экспериментальный инструмент. Используя эту систему, мы можем исследовать влияние различных PAMPs или стимулов на индукции противомикробных эффекторных молекул в эпителиальных клетках кишечника. В типичном эксперименте мы показали, что цитокины нравитсяIL-1β и IL-18 пусковой механизм экспрессии антимикробных пептидов (рисунок 3). Мы также показываем, что антимикробные пептиды , полученные ткани толстой кишки может эффективно убить E. coli (Рисунок 4). Эти методы могут быть применены, чтобы проверить влияние липополисахарида (LPS), пептидогликана (ПГН), muramyldipeptide (ПРУ), а также другие PAMPs в антимикробных реакций иммунной защиты в кишечнике.

Мы несколько изменили протокол культуры двоеточие органа , как описано выше 12, 16, 20, 25. Мы культивировали двоеточие в два этапа. Во-первых, мы инкубировали ткани толстой кишки в антибиотики, содержащие среду в течение 2 ч. Затем мы удалили антибиотики с повторным промыванием из кусков толстой кишки с последующей инкубацией с антибиотиками свободных средств массовой информации. Таким образом, культуральный супернатант, полученный из ночной культуры изтолстой кишки проявляет только эффект секретируемых антимикробных пептидов при инкубации с E.coli. Такой подход может быть использован, чтобы увидеть бактерицидный эффект толстой кишки или кишечника полученные антимикробные пептиды на любых бактерий, представляющих интерес. Соответствующий селективный агар носитель следует использовать для культивирования бактерий.

Как и большинство методов, существуют ограничения ех естественных условиях системы культуры органа. Во-первых, в отличие от культуры клеток или Органоид культуры, органы не растут и пролиферируют и, следовательно, не может быть расширена. Во-вторых, эпителиальные клетки кишечника очень чувствительны, и они умирают относительно быстро без дополнительных факторов роста и ингибиторов апоптоза, которые используются для крипт Органоид культуры. В-третьих, иммунный ответ, наблюдаемый с органной культуры является коллективный отклик различных клеточных популяций. Таким образом, роль индивидуального типа клеток в экспрессии антимикробных и эффекторных генов не могут быть оценены. дополнительonally, в отличие от клеточных линий и Органоид культуры, экспрессию антимикробных пептидов и других эффекторных молекул в двоеточием может варьироваться от мыши к мыши из той же генетического фона.

В заключение, мы опишем здесь простой протокол для экс естественных ободочной органной культуры , что является очень полезным для изучения кишечных антимикробные иммунных реакций. Такой подход может быть использован, чтобы проверить роль различных врожденного иммунитета генов в экспрессии антимикробных пептидов культивированием колонов от генетической мутантных мышей, представляющих интерес. Кроме того, этот протокол может быть адаптирован для использования в клинических исследованиях для изучения кишечную антимикробные реакции пациентов с IBD путем проведения органной культуры образцов ободочной биопсии.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Эта работа была поддержана финансирование от болезни Крона и колита фонда Америки, (CCFA, 3711) Профилактика рака и Научно-исследовательский институт Техаса (CPRIT; RP160169) и UT Southwestern Medical Center дано МГЦ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats