Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

bağırsak epitel hücrelerinin, farklı türde lamina bağışıklık hücrelerini ihtiva eden propia ve stroma oluşan tekrarlanan kript yapılarının bir mimariyi gösterir. Bu heterojen hücrelerin tüm intestinal homeostasis katkıda bulunmak ve antimikrobiyal konak savunmasında katılmak. Bu nedenle, in vitro ortamda bir bağışıklık yanıtı ve bağırsak antimikrobiyal aktivitesini incelemek için bir vekil örneğin belirlenmesi son derece zordur. In vitro çalışmalar, normal bağırsak ve mikroçevresinin tam fizyolojisini temsil etmemektedir organoid kültür ölümsüzleştirdi bağırsak epitel hücre hatları ya da birincil crypt kullanarak. Burada, bir kültür kabı ve bunun nasıl ex vivo organ kültürü sistemi antimikrobiyal konak savunma yanıtları ile ilgili çalışmalarda uygulanabilir kültürlemenin fare kolon dokusu için bir yöntem tartışılmaktadır. Örnek deneylerde, organ kültüründe kolonlar resp antimikrobiyal peptitleri ifade olduğunu göstermiştireksojen IL-1 ve IL-18'e Onse. Ayrıca, organ kültüründe kolon dokular tarafından üretilen antimikrobiyal efektör molekülleri verimli in vitro Escherichia coli öldürmek. Bu yaklaşım, bu nedenle, bağırsak doğuştan gelen bağışıklık yanıtlarını ve antimikrobiyal bir ev sahibi savunma tepkilerini düzenleyen patojen ve tehlike ilişkili moleküler desen ve hücresel reseptörlerin rol incelemek için kullanılabilir.

Introduction

Bağırsak, ortakçı mikroorganizmalar için bir bariyer olarak görev yapan bir dinamik bir sistemi temsil eder, işgalci patojenlere karşı mücadele ve mikrobik bileşim 1 düzenler. bağırsak epitel hücreleri, enterositlerde, goblet hücreleri, Paneth hücreleri ve enteroendokrin hücrelerden oluşan, bağırsak mikrobıyota karşı konak savunma yanıtları sağlamak önemli hücre popülasyonları vardır. Goblet hücreleri epitel tabakası 2'nin üstünde bir askerden arındırılmış bölge oluşturmak müsinleri üretirler. Paneth hücreleri ve enterositler antimikrobiyal peptidler, sitokinler ve antimikrobiyal konak savunma yanıtları oluşturan ve bağırsak mikrobiyal kompozisyon 3, 4 şekillenmesine katkı reaktif oksijen ve nitrojen türlerinin üretirler. epitel hücrelerine ek olarak, makrofajlar, dendritik hücreler, nötrofiller, doğal katil hücreler, lenfositler ve Inna gibi immün hücrelerin 7 - lamina propria ve submukozada te lenfoid hücreler üreten sitokinler, kemokinler ve diğer arabulucular 5 bağırsak antimikrobiyal konak savunma yanıtları kritik bir rol oynamaktadır. mukozal bağışıklık sistemi Mikrobiyota düzenler ve mikrobik enfeksiyonlara karşı koruma sağlar anlamak amacıyla, gut heterojen hücre popülasyonu karmaşık etkileşimi dikkate alınması önemlidir. Bununla birlikte, bağırsak tüm özelliklerini kapsayan bir in vitro model için mevcut değildir. Bu nedenle, bağırsakta konak-patojen etkileşimi üzerinde moleküler çalışmalar son derece zordur.

Geçtiğimiz birkaç yıl içinde, bağırsak mukozasının yönlerini taklit birkaç model sistemler enflamatuar barsak hastalıkları (IBD) ve diğer gastrointestinal bozukluklar 8 katılan patofizyolojik süreçlerin araştırılması için geliştirilmiştir -= "xref"> 14. Ölümsüzleştirilmiş intestinal epitelyal hücre hatları genellikle epitel hücre spesifik yanıtlar incelemek için kullanılır. Bununla birlikte, farklı gen ifadesi ve ölümsüzleştirilmiş hücre fonksiyon, veriler genellikle, in vivo çalışmalarda gözlenen ile eşleşmiyorsa, bu hücreler kullanılarak elde edilen. Son zamanlarda farklı uyaranlara 13 bağırsak epiteli yanıtını değerlendirmek için potansiyel bir araç olarak ortaya çıkmıştır organoid kültür bağırsak crypt. Bu sistemde, kript kök hücrelerin büyümesine ve 3D organoid yapısını geliştirmek için izin verilir. organoid kültür sistemi, bağırsak epiteli birçok açıdan çalışmak için çok yararlı olsa da, bağışıklık hücreleri, epitel hücreleri ve mikrobiyal ürünler kompleks bir etkileşim taklit etmez. Bağırsak dokusunun ex vivo kültür içinde in vivo konukçu savurma tepkilerin daha iyi bir temsilini sunar. Bu yöntemde, bağırsağın bir bölümü, bir hücre kültür plakası wit kültürlenirbağırsakta hücre popülasyonlarının farklı sağlayan h uygun ortam en az 48 saat süreyle metabolik olarak aktif olması için. Bu nedenle, organ, bir ex vivo kültür antimikrobiyal gen ekspresyonunu ve belirli bir uyarana bağırsak konak savunma tepkilerini ölçmek için kullanılabilir.

21 - Müfettişler bağırsakta 15 mikrobiyal enfeksiyonlara karşı konak savunma yanıtları incelemek için ex-vivo organ kültürü sistemi kullanılarak edilmiştir. Biz son zamanlarda fare iki nokta üst üste 22 antimikrobiyal konak savunma yanıtları inflammasome rolünü incelemek için organ kültürü sistemini benimsemiştir. inflammasome olgunlaşmış IL-1 p ve IL-18 üretimi için gerekli olan kaspaz-1 aktivasyonu için moleküler bir platformdur. Bu, IL-1β ve IL-18, E. coli gibi etkili bir ortakçı pathobionts öldürmek antimikrobiyal peptitler neden olduğunu gösterdi 22 artmış, E. coli yükü ile tutarlıdır. Bu sistem, bu nedenle bu tür enflamatuvar bağırsak hastalığı (IBD) ve kolorektal kanserin (CRC) gibi, bağırsak rahatsızlıklarının bağırsak antimikrobiyal konak savunma karşılıklarında eden örüntü tanıma reseptöleri (PRR'ler) ve diğer doğal bağışıklık moleküllerinin rolü ve hastalık oluşumunun incelenmesinde kullanılabilir. Bu genlerin çoğu bağırsağında değiştirilmiş mikrobiyal bileşim ile ilişkilidir 200'den IBD yatkınlık genleri ve mutasyon vardır. Bu IBD-yatkınlık genleri bağırsak Mikrobiyota düzenleyen hangi aracılığıyla hassas mekanizmasını belirlemek için büyük bir klinik öneme sahiptir. Bu yöntemin genel amacı, ex vivo kolon organ kültürü temel bir protokol tanıtmak ve bu kültür yöntemi bağırsak antimikrobiyal konak savunma yanıtları incelemek için nasıl kullanılabileceğini göstermektir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Burada açıklanan tüm deneyler Hayvan Resource Center (ARC), UT Southwestern Tıp Merkezi'nde belirli bir patojen free (SPF) tesiste muhafaza 6-8 haftalık erkek vahşi tip (C57BL6 / J) fareleri kullanılarak gerçekleştirilmiştir. Tüm çalışmalar Kurumsal Hayvan Bakım ve Kullanım Komitesi (IACUC) tarafından onaylanmış ve IACUC kurallarına ve Laboratuvar Hayvanları Bakım ve Kullanım Sağlık Rehberi National Institutes göre yapılmıştır.

1. Toplama ve Colon hazırlanması

  1. Servikal dislokasyon tarafından takip CO 2 boğulma ile fareler Euthanize.
  2. % 70 etanol ile fareler Sprey ve gemide aşağı fare dorsal yüzü tutmak iğneleme kuruluna bacaklarda pin.
  3. önceden sterilize edilmiş kesme makasları ve forseps kullanarak, karın periton bir orta hat kesi yapmak. forseps ile periton katlanarak karın açın.
  4. karın boşluğu wi gelen bağırsak kaldırinci forseps ve makas diseksiyon. çekum alt ve rektum diğer ucunda kesilerek ince bağırsaktan kolon ayırın.
  5. buz soğukluğunda PBS içeren steril bir petri kolon yerleştirin. kolon lümeni içinde dışkı tamamen kaldırılması, bir 20 G iğne veya oral gavaj iğnesi tutan bir 20 ml şırınga kullanılarak buz gibi soğuk PBS ile kolonun lümen içeriği çalkalayın.
  6. uzunlamasına makasla kolon kesin. Steril bir Petri kabındaki buz gibi soğuk PBS ile şiddetli bir şekilde çalkalayarak kolon yıkayın.
  7. yaklaşık 1 cm uzunluğunda bir steril neşter veya makas kullanarak parçalar halinde kolon doku kesin.
  8. Kolon parçaları ağırlığını kaydedin.
    Not: Bölüm 1 'de tüm adımlar içinde ya da biyolojik güvenlik kabini dışındaki ya da gerçekleştirilebilir. Kolonlar kültür için hazır olduğunda, tüm adımları kısırlık korumak için bir biyolojik güvenlik kabini içinde yapılmalıdır.

2. Kolon Orgbir Kültür

  1. 6 oyuklu hücre kültürü plakasının bir hücre süzgecinden (100 um) yerleştirin. hücre süzgecinden içine bir fare toplanan kolon parçalarının hepsini aktarın.
  2. % 5 FBS, penisilin-streptomisin (1x) ve gentamisin (20 ug / ml) ihtiva eden 5 ml DMEM / F12 ortamı ekleyin. Tamamen medya ile kolon parçaları kapsamaktadır.
  3. % 5 CO2 ve% 95 hava içeren bir inkübatörde 37 ° C'de 2 saat süreyle inkübe edin.
  4. Hücre süzgeç kaldırın ve medya aspire.
  5. geri çukuruna hücre süzgeç yerleştirin ve herhangi bir antibiyotik olmadan 5 ml taze medya ekleyin. Hücre süzgeç kaldırın ve medya aspire.
  6. bakiye antibiyotikler kaldırmak için yukarıdaki yıkama adımı (adım 2.5) iki kez daha (toplam 3x) tekrar edin.
  7. steril 12-yuvalı hücre kültürü plakasının tek kuyuya tek bir hücre süzgecinden alınan kolon parçaları aktarın.
  8. (Antibiyotikler olmadan),% 5 FBS içeren DMEM / F12 ortamı ekleyin. Weig ile orta ses seviyesini ayarlamakKolon parçaları HT örneğin, doku, 100 mg, 1 ml aracı. % 5 CO2 ve% 95 hava enjekte bir kuluçka makinesi içinde 37 ° C'de 12 saat boyunca inkübe edilir.
  9. steril 1.5 ml tüp içinde kültür süpernatant toplayın.
  10. 5 dakika boyunca 4 ° C'de 12,000 x g'de santrifüjleyin. deneyi ve / veya diğer bağışıklık tahlilleri öldürme bakteride kullanım için yeni bir 1.5 ml tüp içine yüzey maddesi ayrılır. Süpernatan, deneye kadar -80 ° C'de muhafaza edilebilir.
  11. RNA izolasyonu için bir tüp kolon parçaları toplamak.

Öldürme Denemesi 3. E.coli

  1. 15 ml'lik bir tüp içinde 5 ml Luria-Bertani (LB) sıvısında E. coli inoküle ve gece boyunca 200 rpm'de çalkalanarak 37 ° C'de inkübe edin. biraz gevşek kültür tüpünün kapağını tutun.
  2. 4 ° C'de 10 dakika boyunca 1200 x g'de bakteriyel kültür tüpü santrifüjleyin. Süpernatantı ve 5 mi buz soğukluğunda PBS içine bakteriyel pelletini.
  3. Bact Devri 1 mL600 nm 'de bir küvet ve ölçü OD içine eri süspansiyon. Bir boş olarak PBS kullanın.
  4. önceden tespit edilmiş bir standart eğri kullanılarak koloni oluşturan birimi (CFU) hesaplayın. Burada, bu 1 OD = 2 x 10 9 kob / ml (yaklaşık) varsayalım.
  5. Stok süspansiyon 1 x 10 5 cfu / ml yapmak için bakteri süspansiyonu sulandırmak.
  6. 24-iyi hücre kültür plakası yinelenen kuyulara Bölüm 2.10 toplanan kolon organ kültür süpernatant aktarın (500 ul / oyuk).
  7. Bir de içeren 500 uL kolon organ kültürü süpernatant içine 10 uL E.coli kültürü (1.000 cfu) ekleyin. Kolon, organ kültür süpernatanı herhangi bir bulaşmayı içermiyor onaylamak için herhangi bir E.coli aşılamadan olmadan başka kuyu bırakın.
  8. Bir kontrol olarak bir antibiyotiksiz kültür ortamı (DMEM / F12 +% 5 FBS) içinde bakteri aynı sayıda (1.000 CFU) inkübe edin.
  9. 1 saat boyunca 37 ° C'de inkübe edin.
  10. Her bir örnek açılan wi 50 uL yerleştirinMacConkey agar plaklarına se. gece boyunca 37 ° C 'de MacConkey agar plakaları inkübe edin.
  11. kolonilerin sayısını ve kob / ml hesaplayın.

4. Kolon Antimikrobiyal Konak savunma Yanıtları üzerinde Dış ve iç Faktörlerin Etkisi

NOT: Burada açıklandığı gibi antimikrobiyal öldürme tahlil organ kültürü süpernatant bakterisidal aktivitesi üzerine patojen ilişkili moleküler desenleri (PAMPS) ve sitokinler etkisini incelemek üzere kabul edilebilir. IL-1 ve IL-18 ile bu deney bir örneği, aşağıda tarif edilmektedir.

  1. Bölüm 1 'de tarif edildiği gibi farelerden nokta üst üste toplar.
  2. steril bir kağıt havlu üzerine kolon yerleştirin. Makas kullanarak üç bölümden (Şekil 2) içine uzunlamasına kolon kesin.
  3. Bölüm 1 'de tarif edildiği gibi bu gibi soğuk PBS kolonun her bir bölümü yıkayın.
  4. küçük parçalar halinde kolonun her bir parçasını kesin ve aseptik tartın. her bir parçanın parçaları aktarın6-yuvalı hücre kültürü plakasının üç kuyu (Şekil 2) üzerine yerleştirilmiş üç ayrı hücre süzgeçler (100 um) olarak kolonun.
  5. % 5 FBS, penisilin-streptomisin (1x) ve gentamisin (20 ug / ml) ihtiva eden 2 ml DMEM / F12 ortamı ekleyin.
  6. % 5 CO2 ve% 95 hava enjekte bir kuluçka makinesi içinde 37 ° C'de 2 saat boyunca inkübe edilir.
  7. 2.4-2.6 de tarif edildiği gibi kolon parçaları yıkayın. steril 12-yuvalı hücre kültürü plakasının tek kuyuya tek bir hücre süzgecinden kolon parçaları aktarın. Tek bir fare kolon üç parça içeren üç kuyu (Şekil 2), tedavi edilmemiş, IL-1 olarak adlandırılan, ve IL-18 olmalıdır.
  8. (Antibiyotikler olmadan),% 5 FBS içeren DMEM / F12 ortamı ekleyin. Kolon parçaları ağırlığı, örneğin, doku 100 mg 1 ml orta ile orta ses seviyesini ayarlayın.
  9. 12 saat, IL-1 p (20 ng / ml) ya da IL-18 (20 ng / mL) ile kolon organ kültürü teşvik. Tedavi edilmeyen kolon Organ kültürü kontrol olarak hizmet vermektedir.
  10. % 5 CO2 ve% 95 hava enjekte bir kuluçka makinesi içinde 37 ° C'de 12 saat inkübe edildikten sonra, steril bir 1.5 ml bir tüp içinde kültür süpernatan toplamak.
  11. 24-iyi plaka çift kuyulara 500 uL kültür süpernatant aktarın.
  12. Her bir durum için, Bölüm 3'te tarif edildiği gibi tek bir kuyuda E. coli inoküle, kolon organ kültür yüzey maddesinde E. coli (1000 CFU) inoküle. E. coli olmadan diğer iyi içeren aynı organ kültürü süpernatant bakteriyel kontaminasyon için bir kontrol olarak görev yapacak.
  13. Bir kontrol olarak bir antibiyotiksiz kültür ortamında bakteri aynı miktarda inkübe edin.
  14. 1 saat boyunca 37 ° C'de inkübe edin.
  15. damla damla MacConkey agar plakaları üzerinde her numunenin 50 uL yerleştirin. gece boyunca 37 ° C'de MacConkey agar plakaları inkübe edin.
  16. Kolonilerin sayısını ve kob / mL (Şekil 4) hesaplayın.
e_title "> 5. Antimikrobiyal Genlerin İfade ölçümü

  1. kolon organ kültürü bir gece inkübe (12 saat) sonra, 2 ml buz soğukluğunda PBS (2x) ile kolon parçaları yıkama Bölüm 2 ve 4'te tarif edildiği gibi.
  2. 2 ml RNaz / DNaz ücretsiz vidalı kapaklı tüp içine kolon parçaları toplamak. buz üzerinde tüpler yerleştirin.
  3. tüp içine 1 ml ticari bir Trizol reaktif ve yokedici matris boncuk ekleyin.
  4. Lyse otomatik bir doku homojenleştirici kullanılarak doku.
  5. Bir yeni bir mikrosantrifüj tüpü içine doku lizatındaki toplayın.
  6. standart protokolü kullanarak RNA izole.
  7. RNA konsantrasyonu ölçün.
  8. iyonu giderilmiş su ile uygun bir şekilde RNA seyreltilir ve cDNA sentezi için, 500 ng RNA kullanın.
  9. hedeflenen antimikrobiyal gen, sitokinler, kemokinler ve diğer ilgi genleri gerçek zamanlı RT-PCR analizi için cDNA'nın kullanılmasıdır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Organ kültüründe iki nokta üst üste bir temsili resmi, Şekil 1 'de gösterilmiştir. kültürde kolon parçaları metabolik ve fizyolojik olarak aktif kalır. Bu kültür ortamına ilave ekzojen uyarıcılara etkin yanıt. Ex vivo kültür ve dış uyarılara ile uyarma, örneğin IL-1 ve IL-18 için kolon dokusunun hazırlanması şematik bir iş akışı, Şekil 2 'de gösterilmiştir. Organ kültüründe kolonlar gibi antimikrobiyal peptitleri ifade Şekil 3 göstermek için temsili verilerin β-defensin 2 (BD2), Reg3γ, S100a8, S100a9 ve İNOS, IL-1 p ve IL-18'e yanıt olarak.

Organ kültürü süpernatanı ile inkübe E. coli'nin önemli ölçüde azaltılmış bir büyüme ile gösterildiği gibi kolon implantlar tarafından salınan medyatörler antimikrobiyal öldürme etkisi sergiler ( 4B Rakamlar. E. coli öldürme aktivitesi ayrıca, IL-1 p ve IL-18 (Şekil 4A ve 4B) uyarılması kuvvetlendirilir. E. coli olmadan kuluçkaya kolon organ kültürü süpernatanları Macconkey Agar (Şekil 4C ve 4D) üzerinde kültür izleyen bakteri büyüme göstermektedir. Bu sonuçlar ayrıca inflammasome bağırsak antimikrobiyal konak savunmasında önemli bir rol oynadığını göstermektedir.

Genel olarak, burada sunulan veriler ex vivo kolon organ kültür in vitro bağırsak antimikrobiyal immün yanıtları incelemek için çok kullanışlı bir teknik olduğunu göstermektedir.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCG
2 (BD2) _F β-defensin TGACCACTGCCACACCAATG
2 (BD2) _R β-defensin CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Tablo 1: real-time PCR için fare primerler listesi.


Şekil 1: kültüründe fare kolon parçaları Temsilcisi resim. 6-çukurlu bir plaka üzerine yerleştirilir, bir hücre süzgecinden (100 um) üzerinde kolon parçalarının (A) inkube edildi. Kolon parçaları antibiyotik ile desteklenmiş 2 mL kültür ortamında batık. 2 saat kuluçkadan sonra (B), kolon parçaları antibiyotik içermeyen ortam içeren yeni bir 12-yuvalı hücre kültürü plakasının her bir oyuğuna transfer edilir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

şekil 2
Şekil 2: IL-1 ve IL-18, kolon dokularında hazırlanması ve ex vivo stimülasyonu adımlarından şematik sunumu. bir fare kolon Longi olduğu tudinally üç bölüme parçalandı. Her bölüm, küçük parçalar halinde kesilmiş ve tartılmıştır. kolonun her bölüm alınan kolon adet 2 ml DMEM / F12 ortamı artı% 5 FBS ve antibiyotik ihtiva eden bir 6-yuvalı plakanın yuvalarına yerleştirilen hücre süzgeçler aktarılır. 2 saatlik bir inkübasyonun ardından, tek bir hücre süzgecinden alınan kolon adet 12-yuvalı hücre kültürü plakasının tek oyuk aktarılır. doku ağırlığı (1 ml ortam 100 mg doku) göre olan DMEM / F12 +% 5 FBS (Antibiyotik) her bir kuyucuğa ilave edildi ve ortam hacmi ayarlanır. Kolon dokularında 12 saat, IL-1 p (20 ng / ml) ve IL-18 (20 ng / ml) ile uyarılır. Kültür süpernatanları santrifüjlenmiş ve E. coli öldürme deneyi ve / veya diğer bağışıklık tahlilleri için kullanılır. kolon dokularında RNA izolasyonu ve gerçek zamanlı PCR ile antimikrobiyal gen ekspresyonunun daha sonraki analizler için ticari bir tripsin reaktif toplanır..jpg "target =" _ blank "> bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3: Fare kolon dokularında ex vivo kültür içinde IL-1 veya IL-18'e yanıt olarak sitokinler ve antimikrobiyal peptitler ifade eder. Kolon organ kültürleri 12 saat, IL-1 p (20 ng / ml) ya da IL-18 (20 ng / ml) ile uyarılmıştır. BD2, Reg3γ, S100a8, S100a9 ve iNOS sentezlenmesi, gerçek zamanlı RT-PCR (Tablo 1) ile ölçülmüştür. Veriler ± SD araçları temsil eder; * P <0.05, ** p <0.01. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 4,
Şekil 4: fare kolon organı kült Süpernatanture bakterisidal aktivite sergiler. Kolon parçaları 12 saat, IL-1 p (20 ng / ml) ya da IL-18 (20 ng / ml) varlığında ya da yokluğunda, ex vivo olarak kültürlendi. Kültür yüzey 500 ul, 37 ° C 'de 1 saat süre ile, E. coli (1000 CFU) ile inkübe edildi. E. coli olmayan Kolon organ kültürü süpernatanı, aynı zamanda, bir kontrol olarak inkübe edildi. 1 saat inkübe edildikten sonra, her bir örnek 50 uL MacConkey agar plakaları üzerinde damla damla yerleştirildi ve gece boyunca 37 ° C'de inkübe edildi. E. (A) Resim kolon organ kültürü antimikrobiyal aktivitesini gösteren MacConkey agarda coli kolonileri. (B) E. coli sayımı, IL-1β- ve IL-18 ile tedavi edilen kolon organ kültürü üstte kalan sıvı kısmın, öldürme etkinliğindeki gösteren. E. coli olmadan kuluçkalanmıştır kolon organ kültüründe bakteriyel büyüme gösteren MacConkey agar plaka (C) Şekil. (D) Resim bir E. coli kolonisi, kolon, organ c tanımlandıulture numunedeki herhangi bir kirletici bakterilerin olmadığına işaret E. coli olmadan kuluçkalanmıştır. Veriler ± SD araçları temsil eder; ** P <0.01, *** P <0.001. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bağırsak epitelial hücreler büyüme şartları açısından çok hassas ve kültür nedenle zordur. EDTA muamelesi ile izole epitel hücreler, DMEM 8 gibi geleneksel hücre kültür ortamında hayatta yoktur. Bu nedenle, izole crypt veya birincil epitel hücreleri kullanılarak konak-patojen etkileşim çalışmaları çok zorlu. Son zamanlarda, Sato ve ark. Bağırsak patofizyolojisi 13 ile ilgili çalışmalar için çok umut verici ve yararlı bir crypt organoid kültür sistemi nitelendirdi. Organoids bağırsak kriptalarının birçok özellik temsil ederken, bir steril bir ortamda yetiştirilen olan organoid hücreler, immün tepkileri, in vivo olarak, bağırsak epitel hücrelerinin tepkileri özetlemek hususunun endişeler vardır. epitel kök hücre ve organoids kültürü için pahalı reaktif gereksinimi izolasyonu ve kültürü için gerekli olan hassas teknikler ma önlemekBu sistemin yararlanarak ny laboratuarlar. Ex vivo olarak organ kültürlerinin kullanımı organoid kültürüne alternatif değildir, bu sistem, bağırsak epiteli antimikrobiyal tepkileri çalışma için kolay ve ucuz bir yöntem sunmaktadır.

Bu tekniğin başlıca avantajı, yemekler kültür sırasında bağırsak doku mimarisi muhafaza edilmesidir. Bu kolon dokuların kültürden sonra en az 24 saat boyunca fizyolojik olarak aktif olduğu görülmüştür. sitokin ve antimikrobiyal peptitlerin ifadesi ile ölçülen kolon kültürü sırasında kolon epitel hücreleri eksojen uyaranlara yanıt. sağlam dokuların epiteliyal hücrelerin yaşayabilirliği daha kültür ortamında uygun büyüme faktörleri ve hücre ölümüne inhibitörleri eklenerek zenginleştirilebilir. Önceki raporlar, normal insan kolon doku, organ, birkaç gün 8 ex vivo olarak korunabilir düşündürmektedir sup>, 23, 24.

Fare kolon organ ex vivo kültür protokolü bağırsak epiteli antimikrobiyal immün yanıtların ilgili çalışmalarda birçok uygulama olabilir. patojenler ve bunların PAMPS gibi Toll benzeri reseptörler (TLR) ve epitel ve bağışıklık hücrelerinde bulunan NOD benzeri reseptörler (NLR'ler) olarak PRR tarafından kabul edilmektedir. Kusurlu ifade ve birçok TLR'lerin ve NLR'ler fonksiyonu IBD yatkınlık, kolorektal kanser gelişiminde ve bakteriyel enfeksiyonlarla ilişkilidir. Ölümsüzleştirdi epitel hücre hatları bağırsak niş tüm özelliklerini temsil etmemektedir beri, ex vivo kolon organ kültürü çok kullanışlı bir deneysel araçtır. Bu sistemi kullanarak, bağırsak epitelial hücrelerinde antimikrobiyal efektör moleküllerinin indüksiyonu çeşitli PAMPS veya uyarıcıların etkilerini incelemek için. temsili deneyde, sitokinler gibi olduğunu gösterdiIL-1β ve IL-18 tetikleme antimikrobiyal peptitlerin sentezlenmesi (Şekil 3). Ayrıca, kolon dokusu ile üretilen antimikrobiyal peptitler etkili E. coli (Şekil 4) öldürebilir burada göstermektedir. Bu teknikler, bağırsaktaki antimikrobiyal konak savunma karşılıklarında lipopolisakkarid etkisi (LPS), peptidoglikan (PGN), muramyldipeptide (MDP) ve diğer PAMPS test etmek için uygulanabilir.

Biz biraz daha önce 12, 16, 20, 25 anlatıldığı gibi kolon organ kültürü protokolü değiştirdiniz. Biz iki aşamada kolon kültüre. İlk başta, 2 saat boyunca ortam içeren antibiyotik kolon dokusu kuluçkalanmıştır. Daha sonra antibiyotik içermeyen ortam ile kuluçkalandı ve ardından kolon parçalarının tekrar yıkama ile antibiyotik çıkarıldı. Bu nedenle, kültür süpernatanı içinde gece boyunca kültüründen elde edilenkolon sergiler, E. coli ile inkübe salgılanan antimikrobiyal peptidler tek etkisi. Bu yaklaşım çıkar bakteriler üzerinde kolon veya bağırsak türevli antimikrobiyal peptitler bakterisit etkisini görmek için kullanılabilir. Uygun bir seçici agar ortam kültür bakterileri kullanılmalıdır.

En teknikleri gibi, ex vivo organ kültürü sisteminin sınırlamalar vardır. İlk olarak, hücre kültürü veya organoid kültürü aksine, organlar büyür ve çoğalır ve bu nedenle genişletilmiş edilemez yoktur. İkinci olarak, bağırsak epitel hücreleri çok hassastır ve kript organoid kültürü için kullanılan ek büyüme faktörleri ve apoptoz inhibitörleri olmadan nispeten hızlı bir şekilde ölürler. Üçüncü olarak, bir organ kültür görülen bağışıklık tepkisi hücre popülasyonlarının farklı türde ortak bir yanıttır. Bu nedenle, antimikrobiyal ve efektör gen ekspresyonunda bir hücre tipi rolü değerlendirilemez. Additionally, hücre çizgileri ve organoid kültüründe farklı olarak, antimikrobiyal peptitler ve iki nokta üst üste diğer efektör moleküllerinin ekspresyonu fare aynı genetik kökenli fare değişebilir.

Özet olarak, bağırsak antimikrobiyal immün yanıtları üzerinde çalışmak için çok yararlı olan ex vivo kolon organ kültürü için basit bir protokol burada açıklanmaktadır. Bu yaklaşım, ilgi genetik mutant farelerden iki nokta üst üste kültürlenmesiyle antimikrobiyal peptitlerin ifadesi çeşitli doğal immün genlerin rolü test etmek için de kullanılabilir. Bundan başka, bu protokol, kolon biyopsi örneklerinde organ kültürü yapma IBD hastaların bağırsak antimikrobik tepkiler incelemek için klinik çalışmalarda kullanım için adapte edilebilir.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Kanser Önleme ve Texas Araştırma Enstitüsü (CPRIT; RP160169) ve UT Güneybatı Tıp Merkezi MHZ verilen, bu çalışma Crohn ve Amerika Kolit Vakfı, (3711 CCFA) fon tarafından desteklenmiştir

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats