Das

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Der Darm zeigt eine Architektur von repetitiven Krypta Strukturen, die aus verschiedenen Typen von Epithelzellen, Lamina Propria Immunzellen enthalten, und Stroma. Alle diese heterogenen Zellen tragen dazu bei, antimikrobielle Abwehrdarm Homöostase und daran teilzunehmen. Daher ist für das Studium Immunantwort und antimikrobielle Aktivität des Darmes in einem in vitro - Einstellung ein Ersatzmodell identifizieren , ist extrem schwierig. In - vitro - Studien mit verewigte Darmepithel - Zelllinien oder auch primäre Krypta organoiden Kultur nicht die genaue Physiologie der normalen Darm und seine Mikroumgebung darstellen. Hier haben wir ein Verfahren zum Kultivieren der Maus Kolongewebe in einer Kulturschale und darüber , wie diese ex vivo - Organkultursystem kann in Studien durchgeführt werden in Bezug auf antimikrobielle Wirtsabwehrreaktionen. In repräsentativen Experimenten haben wir gezeigt, dass Doppelpunkte in Organkultur exprimieren antimikrobiellen Peptiden in bzw.onse auf exogenes IL-1β und IL-18. Die antimikrobiellen Effektor - Molekülen durch den Dickdarm Gewebe in der Organkultur produziert effizient Escherichia coli in vitro Ferner töten. Dieser Ansatz kann daher genutzt werden, um die Rolle der pathogen und Gefahren associated molecular patterns und ihre zellulären Rezeptoren bei der Regulierung der Darm angeborenen Immunantwort und antimikrobielle Abwehrreaktionen zu sezieren.

Introduction

Der Darm stellt ein dynamisches System , das für commensal Mikroorganismen als Barriere wirkt, kämpft gegen eindringende Krankheitserreger, und reguliert die mikrobielle Zusammensetzung 1. Die intestinalen Epithelzellen, bestehend aus Enterozyten, Becherzellen, Panethzellen und enteroendokrinen Zellen sind die Hauptzellpopulationen, die Abwehrreaktionen gegen Darmmikrobiota liefern. Die Becherzellen produzieren Muzine , die eine entmilitarisierte Zone auf der Oberseite der Epithelschicht 2 erstellen. Die Panethzellen und Enterozyten produzieren antimikrobielle Peptide, Zytokine und reaktive Sauerstoff und Stickstoff - Spezies , die eine antimikrobielle Abwehrreaktionen darstellen und tragen 3, die Darmflora 4 zu formen. Zusätzlich zu Epithelzellen, die Immunzellen, einschließlich Makrophagen, dendritische Zellen, Neutrophile, natürliche Killerzellen, Lymphozyten und inna te lymphatischen Zellen in der Lamina propria und Submukosa durch die Herstellung Zytokinen, Chemokinen eine entscheidende Rolle bei Darm-antimikrobielle Abwehrreaktionen spielen, und andere Vermittler fähig 5 - 7. Um zu verstehen, wie die Schleimhaut Immunsystem reguliert Mikrobiota und bietet Schutz gegen mikrobielle Infektionen, ist es wichtig, das komplexe Zusammenspiel der heterogenen Zellpopulationen des Darms zu berücksichtigen. Jedoch ist ein in vitro - Modell , das alle Merkmale des Darmes umfasst ist nicht verfügbar. Daher sind molekulare Untersuchungen auf Wirt-Pathogen-Interaktion im Darm sehr herausfordernd.

In den letzten Jahren mehrere Modellsystemen , die Aspekte der Darmschleimhaut zu imitieren wurden zur Untersuchung der pathophysiologischen Prozesse bei entzündlichen Darmerkrankungen (IBD) und anderen gastrointestinalen Störungen 8 entwickelt -= "xref"> 14. Immortalized Darmepithel-Zelllinien werden oft zu studieren epithelialen Zell-spezifische Antworten verwendet. Wegen der differentiellen Genexpression und Funktion in immortalisierten Zellen jedoch die erhaltenen Daten aus diesen Zellen unter Verwendung von nicht mit denen häufig in in vivo Studien beobachtet entsprechen. Intestinale Krypta organoiden Kultur wurde als mögliches Instrument zur Beurteilung der Reaktion des Darmepithels auf verschiedene Reize 13 kürzlich entstanden. In diesem System werden Krypta Stammzellen erlaubt eine 3D-organoiden Struktur zu wachsen und sich entwickeln. Während die organoiden Kultursystem für die Untersuchung vieler Aspekte des Darmepithels sehr nützlich ist, ist es nicht die komplexe Interaktion von Immunzellen, Epithelzellen und mikrobielle Produkte nachahmen. Die ex vivo Kultur des Darmgewebe bietet eine bessere Darstellung der in vivo - Wirtsabwehrreaktionen. In diesem Verfahren wird ein Teil des Darms kultiviert in einer Zellkulturplatte with geeigneten Medien, die verschiedenen Arten von Zellpopulationen im Darm ermöglichen, aktiv zu sein metabolisch für mindestens 48 h. Somit kann eine ex vivo - Kultur des Organs kann verwendet werden , um die Expression von antimikrobiellen Genen und die Abwehrreaktionen des Darmes auf einen bestimmten Reiz zu messen.

Die Ermittler haben die Ex - vivo - Organkultursystem unter Verwendung von zu Abwehrreaktionen gegen mikrobielle Infektion im Darm 15 studieren - 21. Wir nahmen kürzlich die Organkultursystem die Rolle des Inflammasoms in antimikrobiellen Abwehrreaktionen in Maus Doppelpunkte 22 zu studieren. Die Inflammasoms ist eine molekulare Plattform für die Aktivierung von Caspase-1, die für die Produktion von IL-1β gereift und IL-18 benötigt wird. Wir haben gezeigt , dass IL-1β und IL-18 antimikrobielle Peptide induzieren , die effektiv commensal pathobionts wie E. coli töten E. coli in Inflammasoms defekten Maus Doppelpunkte 22. Dieses System kann daher verwendet werden, um die Rolle der Mustererkennungsrezeptoren (PRRS) und andere angeborene Immunmoleküle in intestinalen antimikrobielle Wirtsabwehrreaktionen zu untersuchen sowie Pathogenese von intestinalen Erkrankungen, wie entzündlichen Darmerkrankungen (IBD) und Darmkrebs (CRC). Es gibt mehr als 200 IBD Suszeptibilitätsgene, und Mutationen in vielen dieser Gene mit veränderten mikrobiellen Zusammensetzung im Darm verbunden sind. Es ist von großer klinischer Bedeutung, die genaue Mechanismus, durch den die IBD-Anfälligkeit Gene regulieren Darmflora zu bestimmen. Das übergeordnete Ziel dieses Verfahrens ist es, ein Basisprotokoll von Ex - vivo - Kolon Organkultur einzuführen und zu zeigen , wie diese Kulturverfahren verwendet werden können antimikrobielle Abwehrreaktionen des Darms zu studieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Verwendung von 6-8 Wochen alten männlichen Wildtyp (C57BL6 / J) Mäuse gehalten in einem spezifischen Pathogen (SPF) Anlage im Tier Resource Center (ARC), UT Southwestern Medical Center Alle hier beschriebenen Experimente wurden durchgeführt. Alle Untersuchungen wurden von der Institutional Animal Care und Use Committee (IACUC) genehmigt und wurden in Übereinstimmung mit den Richtlinien IACUC und die National Institutes of Health Guide für die Pflege und Verwendung von Labortieren durchgeführt.

1. Sammlung und Vorbereitung des Colon

  1. Euthanize Mäuse mit CO 2 Erstickung durch zervikale Dislokation gefolgt.
  2. Spray-Mäuse mit 70% Ethanol und Stift Gliedmaßen zu einem Pinning Bord der Maus Rückenseite nach unten auf dem Brett zu halten.
  3. Mit vorsterilisiert Dissektionsscheren und Zange, machen einen Einschnitt Mittellinie in das Peritoneum des Bauches. Öffnen Sie den Bauch durch das Peritoneum mit einer Pinzette zu falten.
  4. Entfernen Sie den Darm aus der Bauchhöhle with Pinzette und Schere. Trenne die Kolon vom Dünndarm durch am Boden des Blinddarms Schneiden und das andere Ende am Rektum.
  5. Platzieren Sie den Darm in eine sterile Petrischale mit eiskaltem PBS. Spülen, den Inhalt des Lumens des Dickdarms mit eiskaltem PBS unter Verwendung einer 20 ml-Spritze mit einer 20 G Nadel oder eine Schlundsonde Nadel, bis der Stuhl in dem Lumen des Kolons Halte vollständig entfernt wird.
  6. Schneiden Sie den Dickdarm mit einer Schere in Längsrichtung. Waschen Sie den Doppelpunkt durch kräftiges in eiskaltem PBS in einer sterilen Petrischale schütteln.
  7. Schneiden Sie den Doppelpunkt Gewebe in Stücke von etwa 1 cm lange ein steriles Skalpell oder einer Schere.
  8. Nehmen Sie das Gewicht der Kolon Stücke.
    HINWEIS: Alle Schritte in dem Abschnitt 1 kann entweder innerhalb oder außerhalb eines biologischen Sicherheitswerkbank durchgeführt werden. Sobald Doppelpunkte für Kultur bereit sind, alle Schritte müssen in einem biologischen Sicherheitsschrank durchgeführt werden, zur Aufrechterhaltung der Sterilität.

2. Colon Orgeine Kultur

  1. Legen Sie eine Zelle Sieb (100 um) auf einer 6-Well-Zellkulturplatte. Übertragen Sie alle von den Kolon Stücke von einer Maus in die Zelle Sieb gesammelt.
  2. Werden 5 ml DMEM / F12 Medium mit 5% FBS, Penicillin-Streptomycin (1x) und Gentamycin (20 ug / ml). Decken Sie die Kolon Stücke mit den Medien.
  3. In einem Inkubator mit 5% CO 2 und 95% Luft bei 37 ° C für 2 Stunden inkubieren.
  4. Heben Sie die Zelle Sieb und absaugen Medien.
  5. Legen Sie die Zelle Sieb wieder auf den Brunnen und 5 ml frisches Medium ohne Antibiotika. Heben Sie die Zelle Sieb und absaugen Medien.
  6. Wiederholen der obigen Waschschritt (Schritt 2.5) zweimal (insgesamt 3x) alle restlichen Antibiotika zu entfernen.
  7. Übertragen Sie die Kolon Stücke aus einer einzigen Zelle Sieb in eine einzige Vertiefung einer sterilen 12-Well-Zellkulturplatte.
  8. Hinzufügen DMEM / F12 Medium mit 5% FBS (ohne Antibiotika). Stellen Sie die Lautstärke des Mediums mit dem weight der colon Stücken, beispielsweise 1 ml Medium pro 100 mg Gewebe. Inkubieren für 12 h bei 37 ° C in einem Inkubator Injizieren von 5% CO 2 und 95% Luft.
  9. Sammeln Sie die Kulturüberstand in ein steriles 1,5-ml-Röhrchen.
  10. Zentrifuge bei 12.000 × g bei 4 ° C für 5 min. Trennen der Überstand in ein neues 1,5 ml-Röhrchen zur Verwendung in den Assays der Abtötung von Bakterien und / oder andere Immunassays. Der Überstand kann bis zum Test bei -80 ° C gelagert werden.
  11. Sammeln Sie die Kolon Stücke in einem Rohr für die RNA-Isolierung.

3. E. coli Assay Töten

  1. Impfen E. coli in 5 ml Luria-Bertani (LB) Brühe in einem 15 - ml - Röhrchen und Inkubation über Nacht bei 37 ° C bei 200 Umdrehungen pro Minute unter Schütteln. Halten Sie die Kappe des Kulturröhrchen etwas locker.
  2. Zentrifugieren der Bakterienkulturröhrchen bei 1.200 xg für 10 min bei 4 ° C. Entfernen Sie den Überstand und resuspendieren Bakterienpellet in 5 ml eiskaltem PBS.
  3. 1 ml der bacterial Suspension in eine Küvette und messen der OD bei 600 nm. Verwenden Sie PBS als leer.
  4. Berechnen der Kolonie bildenden Einheit (cfu) mit einer vorbestimmten Standardkurve verwendet wird. Hier wird angenommen , dass 1 OD = 2 x 10 9 cfu / ml (ungefähr).
  5. Verdünnen Sie die Bakteriensuspension auf die Stoffsuspension 1 x 10 5 KBE / ml zu machen.
  6. Übertragen Sie die Kolon-Organkulturüberstand (500 ul / Vertiefung) gesammelt in Abschnitt 2.10 in zwei Vertiefungen einer 24-Well-Zellkulturplatte.
  7. In 10 & mgr; l E. coli - Kultur (1000 KBE) in eine Vertiefung mit 500 ul Kolon Organkulturüberstand. Lassen Sie die anderen auch ohne E. coli Impfung zu bestätigen , dass der Darm Organkulturüberstand keine Verunreinigung enthält.
  8. Inkubiere die gleiche Anzahl von Bakterien (cfu 1000) in Kulturmedium (DMEM / F12 plus 5% FBS) ohne Antibiotika als Kontrolle.
  9. Inkubieren bei 37 ° C für 1 h.
  10. Man gibt 50 & mgr; l jeder Probe Drop-wise auf MacConkey-Agar-Platten. Inkubieren der MacConkey-Agarplatten bei 37 ° C über Nacht.
  11. Zähle die Anzahl der Kolonien und die Berechnung der cfu / ml.

4. Die Wirkung von extrinsischen und intrinsischen Faktoren auf Kolon Antimicrobial-Host Defense Antworten

HINWEIS: Die antimikrobielle Tötung Test, wie hier beschrieben ist, kann die Wirkung von pathogen associated molecular patterns (PAMPs) und Zytokinen auf die bakterizide Aktivität der Organkulturüberstand zu prüfen, angenommen werden. Ein Beispiel eines solchen Experiments unter Verwendung von IL-1β und IL-18 wird nachfolgend beschrieben.

  1. Sammeln Sie Doppelpunkte von Mäusen, wie in Abschnitt 1 beschrieben.
  2. Platzieren Sie den Doppelpunkt auf einer sterilen Papiertuch. Schneiden Sie den Doppelpunkt der Länge nach in drei Teile mit einer Schere (Abbildung 2).
  3. Waschen Sie jeden Teil des Dickdarms in eiskaltem PBS, wie in Abschnitt 1 beschrieben.
  4. Schneiden Sie jeden Teil des Dickdarms in kleine Stücke und aseptisch wiegen. Übertragen Sie die Stücke jedes Teilsdes Kolons in drei separate Zellsiebe (100 um) , die auf drei Wells einer 6-Well - Zellkulturplatte (Abbildung 2).
  5. 2 ml DMEM / F12 Medium mit 5% FBS, Penicillin-Streptomycin (1x) und Gentamycin (20 ug / ml).
  6. Bei 37 ° C für 2 h Inkubieren in einem Inkubator Injizieren 5% CO 2 und 95% Luft.
  7. Waschen Sie die Kolon Stücke wie in 2,4-2,6 beschrieben. Übertragen Sie die Kolon Stücke aus einer einzigen Zelle Sieb in eine einzige Vertiefung einer sterilen 12-Well-Zellkulturplatte. Die drei Vertiefungen , die drei Teile des Dickdarms von einer einzelnen Maus sollte als unbehandelte, IL-1β bezeichnet werden, und IL-18 (Abbildung 2).
  8. Hinzufügen DMEM / F12 Medium mit 5% FBS (ohne Antibiotika). Stellen Sie das Volumen des Mediums mit dem Gewicht der colon Stücke, beispielsweise 1 ml Medium pro 100 mg Gewebe.
  9. Stimulieren des Dickdarms Organkultur mit IL-1β (20 ng / ml) oder IL-18 (20 ng / ml) für 12 h. Die unbehandelte Kolon Organkultur dient als Kontrolle.
  10. Nach 12 h Inkubation bei 37 ° C in einem Inkubator Injizieren von 5% CO 2 und 95% Luft, der Kulturüberstand in einem sterilen 1,5 ml - Röhrchen sammeln.
  11. Übertragen Sie 500 ul Kulturüberstand in zwei Vertiefungen einer 24-Well-Platte.
  12. Impfen E. coli (1000 KBE) in Überstand Kolon Organkultur als für jede Bedingung in Abschnitt 3 beschrieben impfen E. coli in einem einzigen gut. Die andere gut enthaltende Organkulturüberstand ohne E. coli wird als Kontrolle für bakterielle Kontamination dienen.
  13. Inkubiere die gleiche Menge Bakterien in Kulturmedium ohne Antibiotika als Kontrolle.
  14. Inkubieren bei 37 ° C für 1 h.
  15. Man gibt 50 & mgr; l jeder Probe tropfenweise auf MacConkey-Agar-Platten. Inkubieren der MacConkey-Agar-Platten über Nacht bei 37 ° C.
  16. Zähle die Anzahl der Kolonien und die Berechnung der cfu / ml (Abbildung 4).
e_title "> 5. Die Messung der Expression von Genen Antimicrobial

  1. Nach Inkubation über Nacht (12 h) von Kolon Organkultur wie in den Abschnitten 2 und 4, waschen Sie die Kolon-Stücke mit 2 ml eiskaltem PBS (2x) beschrieben.
  2. Sammeln Sie die Kolon Stücke in ein 2 ml RNase / DNase frei Schraubverschluss Rohr. Die Röhrchen auf Eis.
  3. 1 mL kommerzielle Trizolreagenz und Lysismatrix Perlen in die Röhre.
  4. Lyse das Gewebe eines automatisierten Gewebe-Homogenisator.
  5. Sammeln Sie die Gewebelysat in ein neues Reaktionsgefäß.
  6. Isolieren RNA-Standard-Protokoll.
  7. Messen Sie RNA-Konzentration.
  8. Verdünnte RNA in geeigneter Weise mit entsalztem Wasser und verwenden 500 ng RNA cDNA zu synthetisieren.
  9. Verwenden Sie die cDNA für real-time RT-PCR-Analyse von gezielten antimikrobiellen Genen, Zytokine, Chemokine und andere Gene von Interesse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ein repräsentatives Bild von Doppelpunkte in Organkultur ist in Abbildung 1 dargestellt. Die Doppelpunkt Stücke in der Kultur bleiben metabolisch und physiologisch aktiv. Sie reagieren effizient auf exogene Stimuli zu den Kulturmedien hinzugefügt. Eine schematische Arbeitsablauf der Herstellung des Kolongewebe für ex vivo - Kultur und Stimulation mit exogenen Stimuli, wie zB IL-1β und IL-18, ist in Abbildung 2 dargestellt. Die repräsentativen Daten in Figur 3 zeigen , dass Doppelpunkte in Organkultur antimikrobielle Peptide exprimieren , wie beispielsweise β-Defensin 2 (BD2), Reg3γ, S100A8, S100A9 und iNOS in Reaktion auf IL-1β und IL-18.

Die Mediatoren durch die Doppelpunkt - Implantate freigesetzt zeigen eine antimikrobielle abtötende Wirkung wie durch den deutlich reduzierten Wachstum von E. coli inkubiert mit dem Organkulturüberstand nachgewiesen ( 4B). Solche coli E. Tötungsaktivität wird durch die Stimulation der IL-1β und IL-18 (4A und 4B) potenziert. Colon Organkulturüberstand inkubiert ohne E. coli zeigen keine Bakterienwachstum nach Kultur auf MacConkey - Agar (4C und 4D). Diese Ergebnisse legen nahe, dass weiter die Inflammasoms spielt eine wichtige Rolle in der Darm antimikrobielle Wirtsabwehr.

Insgesamt deuten die hier präsentierten Daten , dass ex vivo colonic Organkultur eine sehr nützliche Technik ist intestinalen antimikrobielle Immunantwort in vitro zu studieren.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCG
β-Defensin 2 (BD2) _F TGACCACTGCCACACCAATG
β-Defensin 2 (BD2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Tabelle 1: Liste der Maus - Primer für die real-time PCR.


Abbildung 1: Repräsentative Bild der Maus Kolon Stücke in der Kultur. (A) Die Inkubation von Kolon Stücke auf einem Zellsieb (100 um) , die auf einer Platte mit 6 Vertiefungen. Colon Stücke werden in 2 ml Kulturmedium mit Antibiotika ergänzt getaucht. (B) Nach 2 h Inkubation, Dickdarm- Stücke werden in die Vertiefung einer neuen Kulturplatte mit 12 Vertiefungen Zelle , die Antibiotika-freiem Medium übertragen. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2: Schematische Darstellung der Schritte zur Herstellung von Dick Geweben und ex vivo Stimulation mit IL-1β und IL-18. Der Doppelpunkt von einer Maus ist longi tudinally in drei Teile zerlegt. Jedes Teil wurde in kleine Stücke geschnitten und gewogen. Die Doppelpunkt Stücke von jedem Abschnitt des Kolons werden auf Zell strainers auf Vertiefungen einer Platte mit 6 Vertiefungen FBS und Antibiotika, enthaltend 2 ml DMEM / F12-Medium plus 5% aufgestellt übertragen. Nach einer 2 h Inkubation colon Stücke aus einer einzigen Zelle Sieb in eine einzige Vertiefung einer Platte mit 12 Vertiefungen Zellkultur überführt. DMEM / F12 plus 5% FBS (keine Antibiotika) wird in jede Vertiefung zugegeben, und das Volumen des Mediums eingestellt wird entsprechend dem Gewicht des Gewebes (1 mL Medium für 100 mg Gewebe). Colon Gewebe werden mit IL-1β (20 ng / ml) und IL-18 (20 ng / ml) für 12 h stimuliert. Kulturüberstände werden für E. coli Tötungsassay und / oder andere Immunassays zentrifugiert und verwendet. Die Doppelpunkt Gewebe werden für die RNA-Isolierung und anschließender Analyse der antimikrobiellen Genexpression durch real-time PCR in kommerzielle Trypsin-Reagenz gesammelt..jpg "target =" _ blank "> Bitte hier klicken, um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3: Maus Kolon Gewebe Zytokine und antimikrobielle Peptide in Reaktion auf IL-1β oder IL-18 während der ex vivo Kultur auszudrücken. Colon Organkulturen wurden für 12 h mit IL-1β (20 ng / ml) oder IL-18 (20 ng / ml) stimuliert. Die Expression von BD2, Reg3γ, S100A8, S100A9 und iNOS wurde mittels real-time RT-PCR (Tabelle 1) gemessen. Die Daten stellen den Mittelwert ± SD; * P <0,05, ** p <0,01. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4: Überstand von Maus Kolon Orgel Kulture zeigt bakterizide Aktivität. Colon Stücke wurden kultiviert ex vivo in Gegenwart oder Abwesenheit von IL-1β (20 ng / ml) oder IL-18 (20 ng / ml) für 12 h. 500 & mgr; l der Kulturüberstände wurden bei 37 ° C mit E. coli (1.000 cfu) für 1 Stunde inkubiert. Colon Organkulturüberstand ohne E. coli wurde ebenfalls als Kontrolle inkubiert. Folg 1 h Inkubation wurden 50 & mgr; l jeder Probe wurden tropfenweise auf MacConkey-Agar-Platten gelegt und bei 37 ° C über Nacht inkubiert. (A) Bild von E. coli - Kolonien auf MacConkey - Agar zeigt antimikrobielle Aktivität der Darmorgankultur. (B) E. coli Zählung zeigt Tötung Wirksamkeit von IL-1β- und IL-18-behandelten Kolon Organkulturüberstand. (C) Bild von MacConkey - Agar - Platte kein Bakterienwachstum in Kolon Organkultur ohne E. coli inkubiert zeigt. (D) Nr E. coli - Kolonien wurden in Kolon Organ c identifiziertulture inkubiert ohne E. coli, das Fehlen von kontaminierenden Bakterien in der Probe anzeigt. Die Daten stellen den Mittelwert ± SD; ** P <0,01, *** p <0.001. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Die intestinalen Epithelzellen sind sehr empfindlich in Bezug auf ihre Wachstumsanforderungen und daher schwierig zu kultivieren. Die Epithelzellen isoliert durch EDTA - Behandlung nicht überleben in konventionellen Zellkulturmedien , wie beispielsweise DMEM 8. Daher Wirt-Pathogen-Interaktion Studien isoliert Krypta oder primäre Epithelzellen sind sehr anspruchsvoll. Vor kurzem Sato et al. eine Krypta organoiden Kultursystem beschrieben , die für Studien im Zusammenhang mit Darm Pathophysiologie 13 sehr viel versprechend und sinnvoll ist. Während Organoiden viele Eigenschaften von Darm-Krypta darstellen, gibt es Bedenken, ob die Immunantworten der organoiden - Zellen, die in einer sterilen Umgebung angebaut werden, die Antworten von intestinalen Epithelzellen in vivo rekapitulieren. Die genauen Techniken, die für Isolierung und Kultivierung von epithelialen Stammzellen und Anforderung von teuren Reagenzien für die Kultur von Organoiden verhindern many Laboratorien von Vorteil dieses Systems nehmen. Während die Verwendung von ex vivo Organkultur keine Alternative zu organoiden Kultur ist, bietet dieses System eine einfache und kostengünstige Methode der antimikrobiellen Reaktionen von Darmepithel zu studieren.

Der Hauptvorteil dieser Technik ist, dass die Gewebearchitektur des Darmes aufrechterhalten wird, während in den Schalen kultiviert werden. Wir beobachteten, dass die Doppelpunkt Gewebe mindestens 24 Stunden nach ihrer Kultur physiologisch aktiv sind. Während der Kultur des Dickdarms, reagieren die Kolon-Epithelzellen auf exogene Stimuli, wie durch die Expression von Zytokinen und antimikrobielle Peptide gemessen. Die Lebensfähigkeit der Epithelzellen des intakten Gewebes kann durch die Zugabe von geeigneten Wachstumsfaktoren und Inhibitoren der Zelltod im Kulturmedium erhöht werden. Frühere Berichte deuten darauf hin , dass das normale menschliche Dickdarmgewebe Organ ex vivo gehalten werden konnte mehrere Tage 8 sup>, 23, 24.

Das Protokoll für die ex vivo - Kultur von Maus - Kolon - organ kann viele Anwendungen in Studien haben antimikrobielle Immunreaktionen des Darmepithels verwandt. Die Krankheitserreger und ihre PAMPs werden durch PRRs wie Toll-like Rezeptoren (TLR) und NOD-like Rezeptoren (NLR) in epithelialen und Immunzellen erkannt. Fehlerhafte Expression und Funktion vieler TLR und NLRs mit Anfälligkeit für IBD, colorectal Tumorigenese und bakterielle Infektionen. Da verewigte epithelialen Zelllinien nicht alle Merkmale der Darm-Nische darstellen, die ex vivo Kolon Organkultur ist ein sehr nützliches experimentelles Werkzeug. Mit diesem System können wir die Wirkung verschiedener PAMPs oder Reize auf die Induktion antimikrobieller Effektormoleküle in den Darmepithelzellen untersuchen. In dem repräsentativen Experiment haben wir gezeigt, dass Zytokine wieIL-1β und IL-18 - Trigger die Expression von antimikrobieller Peptide (Abbildung 3). Wir zeigen auch hier , dass antimikrobielle Peptide , die durch Doppelpunkt Gewebe erzeugt wird, kann E. coli wirksam töten (Abbildung 4). Diese Techniken können angewendet werden, um den Einfluss von Lipopolysaccharid (LPS) zu testen, Peptidoglycan (PGN), Muramyldipeptid (MDP) und andere PAMPs in antimikrobiellen Wirtsabwehrreaktionen im Darm.

Wir haben ein wenig den Darm Organkultur - Protokoll modifiziert , wie zuvor beschrieben 12, 16, 20, 25. Wir kultiviert den Darm in zwei Phasen. Zunächst inkubiert wir den Darm Gewebe in Antibiotika enthaltenden Medium für 2 h. Wir entfernten dann die Antibiotika mit mehrmaligem Waschen der Kolon Stücke gefolgt von einer Inkubation mit Antibiotika freien Medien. So ist aus der Übernachtkultur von der Kulturüberstand gewonnenDoppelpunkt weist nur die Wirkung von sezernierten antimikrobiellen Peptiden , wenn es mit E. coli inkubiert. Dieser Ansatz kann die bakterizide Wirkung von Kolon oder Darm abgeleitet antimikrobieller Peptide auf alle Bakterien von Interesse zu sehen, verwendet werden. Ein geeignetes Selektiv-Agar-Medien sollten die Bakterien Kultur verwendet werden.

Wie die meisten anderen Techniken gibt es Einschränkungen der ex vivo - Organkultursystem. Erstens, im Gegensatz zu einer Zellkultur oder organoide Kultur, die Organe nicht wachsen und sich vermehren und daher nicht erweitert werden kann. Zweitens sind die intestinalen Epithelzellen sehr empfindlich und sterben relativ schnell und ohne zusätzlichen Wachstumsfaktoren und Apoptose-Inhibitoren, die für Krypta organoiden Kultur verwendet werden. Drittens, die Immunantwort aus der Organkultur beobachtet wurde, ist eine gemeinsame Antwort von verschiedenen Arten von Zellpopulationen. Daher kann die Rolle der einzelnen Zelltyp in der Expression von antimikrobieller und Effektor-Gene nicht beurteilt werden. Additional, anders als in Zelllinien und organoiden Kultur, die die Expression der antimikrobiellen Peptide und andere Effektormoleküle in den Doppelpunkte von Maus zu Maus gleichen genetischen Hintergrund variieren.

Zusammenfassend beschreiben wir hier ein einfaches Protokoll für ex vivo Kolon Organkultur , die zur Untersuchung von Darm antimikrobielle Immunreaktionen sehr nützlich ist. Dieser Ansatz kann die Rolle der verschiedenen angeborenen Immungene in der Expression von antimikrobiellen Peptiden durch Züchten Doppelpunkte aus genetischen mutanten Mäusen von Interesse zu testen, verwendet werden. die intestinale antimikrobielle Reaktionen von IBD-Patienten zu untersuchen, durch die Durchführung der Organkultur von Kolon Biopsieproben Ferner kann dieses Protokoll zur Verwendung in klinischen Studien angepasst werden.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Cancer Prevention Research Institute of Texas (CPRIT; RP160169) und UT Southwestern Medical Center zu MHZ gegeben; Diese Arbeit wurde durch die Finanzierung von Morbus Crohn und Colitis Foundation of America (3711 CCFA) unterstützt

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats