Det

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Tarmen viser en arkitektur af repetitive crypt strukturer bestående af forskellige typer af epitelceller, lamina propia indeholdende immunceller, og stroma. Alle disse heterogene celler bidrager til intestinal homeostase og deltage i antimikrobielt værtsforsvar. Derfor identificerer en surrogat model til undersøgelse immunrespons og antimikrobielle aktivitet af tarmen i et in vitro indstilling er ekstremt udfordrende. In vitro-studier ved hjælp udødeliggjort tarm epitelial cellelinjer eller endda primær krypt organoide kultur ikke repræsenterer den nøjagtige fysiologi normal tarmen og dens mikromiljø. Her diskuterer vi en fremgangsmåde til dyrkning muse colon væv i en dyrkningsskål og hvordan dette ex vivo organ dyrkningssystem kan implementeres i undersøgelser vedrørende antimikrobielle værtsforsvarsmekanismer responser. I repræsentative eksperimenter, viste vi, at koloner i orgel kultur udtrykker antimikrobielle peptider i hhvonse til exogent IL-1β og IL-18. Endvidere er de antimikrobielle effektormolekyler produceret af kolon væv i organkultur effektivt dræbe Escherichia coli in vitro. Denne fremgangsmåde kan derfor anvendes til at dissekere rolle pathogen- og fare-associeret molekylære mønstre og deres cellulære receptorer i reguleringen intestinale medfødte immunresponser og antimikrobielle værtsforsvarsmekanismer responser.

Introduction

Tarmen repræsenterer et dynamisk system, der virker som en barriere for kommensale mikroorganismer, kæmper mod invaderende patogener, og regulerer den mikrobielle sammensætning 1. De intestinale epitelceller, der består af enterocytter, slimceller, Paneth celler og enteroendocrine celler, er de store cellepopulationer, der giver værtsforsvarsceller responser mod intestinale mikroflora. De bægerceller producere muciner, der skaber en demilitariseret zone på toppen af epitel lag 2. De Paneth celler og enterocytter producerer antimikrobielle peptider, cytokiner og reaktive ilt og kvælstof arter, der udgør antimikrobielle vært forsvar svarene og bidrage til at forme den intestinale mikrobielle sammensætning 3, 4. Ud over epitelceller, immuncellerne herunder makrofager, dendritiske celler, neutrofiler, naturlige dræberceller, lymfocytter og inna te lymfoide celler i lamina propria og submucosa spiller en kritisk rolle i intestinale antimikrobielle værtsforsvarsmekanismer responser ved producerende cytokiner, kemokiner og andre mediatorer 5 - 7. For at forstå, hvordan det mucosale immunsystem regulerer mikroflora og yder beskyttelse mod mikrobiel infektion, er det vigtigt at overveje det komplekse samspil af de heterogene cellepopulationer i tarmen. Men en in vitro model, der omfatter alle trækkene i tarmen er ikke tilgængelig. Derfor molekylære undersøgelser af vært-patogen interaktion i tarmen er meget udfordrende.

I de seneste år har adskillige modelsystemer, der efterligner aspekter af tarmslimhinden blevet udviklet til undersøgelse af patofysiologiske processer involveret i inflammatoriske tarmsygdomme (IBD) og andre gastrointestinale lidelser 8 -= "xref"> 14. Immortaliserede intestinale epiteliale cellelinier anvendes ofte til at studere epithelial cellespecifikke responser. Men på grund af differentiel genekspression og funktion i immortaliserede celler, data opnået fra anvendelse af disse celler ikke matcher ofte med dem, der observeres i in vivo-undersøgelser. Intestinal krypt organoide kultur har for nylig vist sig som en potentiel værktøj til vurdering af svaret fra tarmepitelet til forskellige stimuli 13. I dette system er krypt stamceller lov til at vokse og udvikle en 3D organoide struktur. Mens det organoide dyrkningssystem er meget nyttigt til at studere mange aspekter af tarmepitelet, betyder det ikke efterligne det komplicerede samspil af immunceller, epitelceller og mikrobielle produkter. Ex vivo kultur af tarmvævet tilbyder en bedre repræsentation af in vivo værtsforsvarsmekanismer responser. Ved denne fremgangsmåde en del af tarmen dyrkes i en cellekultur plade with passende medier tillader de forskellige typer af cellepopulationer i tarmen til at være metabolisk aktive i mindst 48 timer. Således kan en ex vivo kultur af organet anvendes til at måle ekspressionen af antimikrobielle gener og værtsforsvarsceller responser i tarmen til en bestemt stimulus.

Forskere har været ved hjælp af ex vivo organkultur til undersøgelse værtsforsvarsceller reaktioner mod mikrobiel infektion i tarmen 15 -. 21 Vi har for nylig vedtaget orgel kultur-systemet til at studere rolle inflammasome i antimikrobielle vært forsvar reaktioner i muse koloner 22. Inflammasome er en molekylær platform for aktiveringen af ​​caspase-1, som er nødvendig til produktion af modnet IL-1β og IL-18. Vi viste, at IL-1β og IL-18 inducerer antimikrobielle peptider som effektivt dræber kommensale pathobionts såsom E. coli E. coli byrde i Inflammasome-defekte mus koloner 22. Dette system kan derfor anvendes til at undersøge den rolle, mønstergenkendelse receptorer (PRRS) og andre medfødte immunmolekyler i intestinale antimikrobielle værtsforsvarsmekanismer responser samt patogenesen af ​​intestinale lidelser, såsom inflammatorisk tarmsygdom (IBD) og kolorektal cancer (CRC). Der er mere end 200 IBD modtagelighed gener og mutationer i mange af disse gener er associeret med ændret mikrobielle sammensætning i tarmen. Det er af stor klinisk betydning for at bestemme den præcise mekanisme, hvorigennem IBD-modtagelighed gener regulerer gut mikrobiota. Det overordnede mål med denne metode er at indføre en grundlæggende protokol af ex vivo colon organkultur og vise, hvordan denne kultur metode kan anvendes til at studere antimikrobielle værtsforsvarsmekanismer responser i tarmen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle forsøgene beskrevet her blev udført ved hjælp af 6-8 uger gammel mand vildtype (C57BL6 / J) mus holdt i en specifik patogen fri (SPF) facilitet på Animal Resource Center (ARC), UT Southwestern Medical Center. Alle undersøgelser blev godkendt af Institutional Animal Care og brug Udvalg (IACUC) og blev gennemført i overensstemmelse med de IACUC retningslinjer og National Institutes of Health Guide til Pleje og anvendelse af forsøgsdyr.

1. Indsamling og klargøring af Colon

  1. Aflive mus med CO 2 kvælning efterfulgt af cervikal dislokation.
  2. Spray mus med 70% ethanol og pin lemmer til en pinning bord holde musen dorsale side ned på brættet.
  3. Brug af præ-steriliseret dissekere saks og pincet, lave en midterlinie incision i peritoneum af maven. Åbn maven ved at folde bughinden med pincet.
  4. Fjern tarmen fra bughulen with dissekere pincet og saks. Adskil tyktarmen fra tyndtarmen ved at skære i bunden af ​​coecum, og den anden ende ved endetarmen.
  5. Placer colon i en steril petriskål indeholdende iskold PBS. Skylle indholdet af lumen af ​​colon med iskold PBS under anvendelse af en 20 ml sprøjte holder en 20 G nål eller en oral sondeernæring nål indtil afføringen i lumenet i tyktarmen er helt fjernet.
  6. Skær tyktarmen med en saks i længderetningen. Vask tyktarmen ved at ryste kraftigt i iskoldt PBS i en steril petriskål.
  7. Skær colon væv i stykker ca. 1 cm lange anvendelse af en steril skalpel eller saks.
  8. Noterer vægten af ​​tyktarmen stykker.
    BEMÆRK: kan udføres Alle trinene i Afsnit 1 enten i eller uden for en biologisk sikkerhedsskab. Når koloner er klar til kultur, skal udføres alle trin i et biologisk sikkerhedsskab til at opretholde sterilitet.

2. Colon Orgen kultur

  1. Placer en cellesigte (100 um) på en 6-brønds celledyrkningsplade. Overfør hele af tyktarmen stykker indsamlet fra en mus i cellen si.
  2. Tilsæt 5 ml DMEM / F12-medium indeholdende 5% FBS, penicillin-streptomycin (1x), og Gentamycin (20 ug / ml). Helt dække kolon stykker med medierne.
  3. Inkuber i 2 timer ved 37 ° C i en inkubator med 5% CO2 og 95% luft.
  4. Løft celle si og aspireres medierne.
  5. Placer cellesigte tilbage på brønden, og der tilsættes 5 ml frisk medium uden antibiotika. Løft celle si og aspireres medierne.
  6. Gentag ovenstående vasketrin (trin 2.5) to gange mere (i alt 3x) for at fjerne al den resterende antibiotika.
  7. Overfør kolon stykker fra en enkelt celle si i en enkelt brønd på en steril 12-brønds celledyrkningsplade.
  8. Tilføj DMEM / F12-medium indeholdende 5% FBS (uden antibiotika). Juster lydstyrken af ​​mediet med Weight af tyktarmen stykker, fx 1 ml medium i 100 mg væv. Inkuber i 12 timer ved 37 ° C i en inkubator injicere 5% CO2 og 95% luft.
  9. Saml kultursupernatanten i et sterilt 1,5 ml rør.
  10. Der centrifugeres ved 12.000 xg ved 4 ° C i 5 min. Adskil supernatant til et nyt 1,5 ml rør til anvendelse i bakterier drab assay og / eller andre immune assays. Supernatanten kan opbevares ved -80 ° C indtil analysen.
  11. Saml colon stykker i et rør til RNA-isolering.

3. E. coli Killing Assay

  1. Inokulere E. coli i 5 ml Luria-Bertani (LB) bouillon i et 15 ml rør og inkuberes ved 37 ° C under omrystning ved 200 rpm natten over. Hold hætten af ​​kulturen rør lidt løs.
  2. Centrifugeres bakteriekulturen røret ved 1200 xg i 10 min ved 4 ° C. Fjern supernatanten og resuspender bakterielle pellet i 5 ml iskold PBS.
  3. Overfør 1 ml af Bacterial suspension i en kuvette og foranstaltning OD ved 600 nm. Brug PBS som en blank.
  4. Beregn kolonidannende enhed (CFU) anvendelse af en forudbestemt standardkurve. Her, antager, at 1 OD = 2 x 10 9 cfu / ml (ca.).
  5. Fortynd bakteriesuspensionen at gøre råmassesuspensionen 1 x 10 5 cfu / ml.
  6. Overfør tyktarmen orgel kultursupernatanten (500 pl / brønd) indsamlet i afsnit 2.10 i duplikerede brønde af en 24-brønds celledyrkningsplade.
  7. Tilsæt 10 pi E. coli kultur (1.000 CFU) i en brønd indeholdende 500 uL colon orgel kultursupernatant. Efterlad den anden godt uden nogen E. coli inokulering for at bekræfte at colon orgel kultursupernatanten ikke indeholder nogen kontaminering.
  8. Inkubér det samme antal bakterier (1.000 CFU) i dyrkningsmedierne (DMEM / F12 plus 5% FBS) uden antibiotika som en kontrol.
  9. Der inkuberes ved 37 ° C i 1 time.
  10. Placer 50 pi af hver prøve drop-wiSE på MacConkey agarplader. Inkubér MacConkey agarplader ved 37 ° C natten over.
  11. Tæl antallet af kolonier og beregne cfu / ml.

4. Virkning af ydre og indre faktorer på colonic Antimikrobielle værtsforsvar Responses

BEMÆRK: Den antimikrobielle drab assay som beskrevet her, kan vedtages at undersøge effekten af ​​patogen forbundet molekylære mønstre (PAMPs) og cytokiner på baktericid aktivitet af orgel kultursupernatanten. Et eksempel på sådan forsøg under anvendelse IL-1β og IL-18 er beskrevet nedenfor.

  1. Saml koloner fra mus, som beskrevet i afsnit 1.
  2. Placer colon på et sterilt stykke køkkenrulle. Skær colon længderetningen i tre dele med en saks (figur 2).
  3. Vask hver del af tyktarmen i iskold PBS, som beskrevet i afsnit 1.
  4. Skær hver del af tyktarmen i små stykker og vejes aseptisk. Overfør stykker af hver delaf tyktarmen i tre separate celle sier (100 um) placeret på tre brønde i en 6-brønds celledyrkningsplade (figur 2).
  5. Der tilsættes 2 ml DMEM / F12-medium indeholdende 5% FBS, penicillin-streptomycin (1x), og Gentamycin (20 ug / ml).
  6. Inkuber i 2 timer ved 37 ° C i en inkubator injicere 5% CO2 og 95% luft.
  7. Vask kolon stykker som beskrevet i 2,4-2,6. Overfør kolon stykker af en enkelt celle si i en enkelt brønd på en steril 12-brønds celledyrkningsplade. De tre brønde indeholdende tre dele af colon fra en enkelt mus bør betegnes som ubehandlet, IL-1β og IL-18 (figur 2).
  8. Tilføj DMEM / F12-medium indeholdende 5% FBS (uden antibiotika). Juster volumenet af mediet med vægten af colon stykker, fx 1 ml medium i 100 mg væv.
  9. Stimulere tyktarmen organkultur med IL-1β (20 ng / ml) eller IL-18 (20 ng / ml) i 12 timer. Det ubehandlede kolon organkultur tjener som kontrol.
  10. Efter 12 timers inkubation ved 37 ° C i en inkubator injicere 5% CO2 og 95% luft, indsamle kultursupernatanten i et sterilt 1,5 ml rør.
  11. Overfør 500 uL kultursupernatant i dobbelte brønde i en plade med 24 brønde.
  12. Inokulere E. coli (1.000 CFU) i colon organkultur supernatant som beskrevet i afsnit 3. For hver betingelse, inokulere E. coli i en enkelt brønd. Den anden brønd indeholdende samme orgel dyrkningssupernatant uden E. coli vil tjene som kontrol for bakteriel forurening.
  13. Inkubér den samme mængde af bakterier i dyrkningsmedier uden antibiotika som en kontrol.
  14. Der inkuberes ved 37 ° C i 1 time.
  15. Placer 50 pi af hver prøve dråbevis på MacConkey agarplader. Inkubér MacConkey agarplader natten over ved 37 ° C.
  16. Tæl antallet af kolonier og beregne cfu / ml (figur 4).
e_title "> 5. Måling af Angivelse af antimikrobielle gener

  1. Efter inkubation natten over (12 h) i colon organkultur som beskrevet i afsnit 2 og 4, vaske kolon stykker med 2 ml iskold PBS (2x).
  2. Saml kolon stykker i en 2 ml RNase / DNase gratis skruelåg rør. Anbring glassene på is.
  3. Tilsæt 1 mL kommercielle Trizol reagens og lyserende matrix perler ind i røret.
  4. Lyse vævet anvendelse af en automatiseret vævshomogenisator.
  5. Indsamle vævet lysat til en ny mikrocentrifugerør.
  6. Isoler RNA ved anvendelse af en standardprotokol.
  7. Mål RNA koncentration.
  8. Fortynd RNA passende med deioniseret vand og bruge 500 ng RNA til at syntetisere cDNA.
  9. Brug cDNA for real-time RT-PCR-analyse af målrettede antimikrobielle gener, cytokiner, kemokiner og andre gener af interesse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Et repræsentativt billede af koloner i organkultur er vist i figur 1. Colon stykker i kulturen stadig metabolisk og fysiologisk aktivt. De reagerer effektivt på eksogene stimuli føjet til kultur medier. En skematisk arbejde flow af præparatet af tyktarmen væv til ex vivo kultur og stimulering med exogene stimuli, fx IL-1β og IL-18, er vist i figur 2. De repræsentative data i figur 3 viser, at koloner i organkultur udtrykker antimikrobielle peptider, såsom β-defensin 2 (BD2), Reg3γ, S100a8, S100a9, og iNOS som respons på IL-1β og IL-18.

De mediatorer frigivet af kolon implantater udviser en antimikrobiel dræbende virkning som demonstreret ved den signifikant reducerede væksten af E. coli inkuberet med organet kultursupernatanten ( 4B). Sådan E. coli celledræbende aktivitet yderligere forstærkes af stimuleringen af IL-1β og IL-18 (figur 4A og 4B). Colon orgel kultursupernatanter inkuberet uden E. coli viser ingen bakterievækst efter dyrkning på MacConkey agar (figurerne 4C og 4D). Disse resultater antyder endvidere, at inflammasome spiller en vigtig rolle i den intestinale antimikrobielt værtsforsvar.

Samlet set her præsenterede data antyder, at ex vivo colon organkultur er en meget nyttig teknik til at undersøge intestinale antimikrobielle immunresponser in vitro.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCG
β-defensin 2 (BD2) _F TGACCACTGCCACACCAATG
β-defensin 2 (BD2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Tabel 1: Liste over mus primere til real-time PCR.


Figur 1: repræsentativt billede af muse colon stykker i kulturen. (A) Inkubation af kolon stykker på en cellesigte (100 um) placeret på en plade med 6 brønde. Colon stykker er nedsænket i 2 ml kulturmedie suppleret med antibiotika. (B) Efter 2 timer inkubation kolon stykker overført til brønd i en ny 12-brønds cellekultur plade indeholdende antibiotika-frit medium. Klik her for at se en større version af dette tal.

Figur 2
Figur 2: Skematisk præsentation af de skridt til forberedelse af kolon væv og ex vivo stimulation med IL-1β og IL-18. Tyktarmen fra én mus er Longi tudinally dissekeret i tre dele. Hver del blev skåret i små stykker og vejet. Colon stykker fra hvert afsnit af tyktarmen er overført til celle sier placeret på brønde i en 6-brønds plade indeholdende 2 ml DMEM / F12-medium plus 5% FBS og antibiotika. Efter en 2 h inkubation kolon stykker fra en enkelt celle si overført til en enkelt brønd på en 12-brønds celledyrkningsplade. DMEM / F12 plus 5% FBS (ingen antibiotika) tilsættes til hver brønd, og volumenet af mediet justeres efter vægten af ​​vævet (1 ml medier til 100 mg væv). Colonvæv stimuleres med IL-1β (20 ng / ml) og IL-18 (20 ng / ml) i 12 timer. Kultursupernatanter centrifugeres og anvendes til E. coli dræbe assay og / eller andre immune assays. De kolon væv indsamles i kommerciel trypsin reagens til RNA isolering og efterfølgende analyser af antimikrobielle genekspression ved real-time PCR..jpg "target =" _ blank "> Klik her for at se en større version af dette tal.

Figur 3
Figur 3: Mouse colonvæv udtrykke cytokiner og antimikrobielle peptider som respons på IL-1β eller IL-18 under ex vivo-dyrkning. Colon organkulturer blev stimuleret med IL-1β (20 ng / ml) eller IL-18 (20 ng / ml) i 12 timer. Ekspressionen af BD2, Reg3γ, S100a8, S100a9, og iNOS blev målt ved real-time RT-PCR (tabel 1). Data repræsenterer middelværdier ± SD; * P <0,05, ** p <0,01. Klik her for at se en større version af dette tal.

Figur 4
Figur 4: Supernatant af muse colon orgel culture udviser baktericid aktivitet. Colon stykker blev dyrket ex vivo i nærvær eller fravær af IL-1β (20 ng / ml) eller IL-18 (20 ng / ml) i 12 timer. 500 pi kultursupernatanterne blev inkuberet med E. coli (1.000 cfu) i 1 time ved 37 ° C. Colon orgel kultursupernatant uden E. coli blev også inkuberet som en kontrol. Efter 1 h inkubation blev 50 pi af hver prøve anbringes dråbevis på MacConkey agarplader og inkuberet ved 37 ° C natten over. (A) Billede af E. coli kolonier på MacConkey agar udviser antimikrobiel aktivitet af colon organkultur. (B) E. coli viser drab effektiviteten af IL-1β- og IL-18-behandlede colon orgel kultursupernatant. (C) Billede af MacConkey agarplade viser ingen bakterievækst i colon organkultur inkuberet uden E. coli. (D) Ingen E. coli kolonier blev identificeret i tyktarmen orgel cULTUR inkuberes uden E. coli, hvilket indikerer mangel af forurenende bakterier i prøven. Data repræsenterer middelværdier ± SD; ** P <0,01, *** p <0,001. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De intestinale epitelceller er meget følsomme med hensyn til deres vækstkrav og derfor vanskelige at dyrke. Epitelcellerne isoleret ved EDTA-behandling ikke overlever i konventionelle celledyrkningsmedier såsom DMEM 8. Derfor værtspatogene interaktionsundersøgelser anvendelse af isolerede krypt eller primære epitelceller er meget udfordrende. For nylig, Sato et al. beskrev en krypt organoide kultur, som er meget lovende og nyttigt for undersøgelser i forbindelse med tarm patofysiologi 13. Mens organoids repræsenterer mange funktioner i tarm krypt, der er bekymring om, hvorvidt immunreaktioner i de organoide celler, som bliver dyrket i et sterilt miljø, rekapitulere svarene fra intestinale epitelceller in vivo. De præcise teknikker, der kræves til isolering og dyrkning af epitelceller stamceller og krav om dyre reagenser til kulturen af ​​organoids forhindre maNY laboratorier fra at drage fordel af dette system. Mens anvendelsen af ex vivo organkultur ikke er et alternativ til organoide kultur, dette system tilbyder en nem og billig metode til at undersøge de antimikrobielle reaktioner af tarmepitelet.

Den største fordel ved denne teknik er, at vævet arkitektur af tarmen opretholdes mens dyrkning i skålene. Vi observerede, at de colonvæv er fysiologisk aktive i mindst 24 timer efter deres kultur. Under dyrkningen af ​​tyktarmen, de colon epitelceller svare exogene stimuli som målt ved ekspression af cytokiner og antimikrobielle peptider. Levedygtigheden af ​​epitelceller i det intakte væv kan yderligere forøges ved tilsætning af egnede vækstfaktorer og inhibitorer af celledød i dyrkningsmediet. Tidligere rapporter tyder på, at normalt humant colonvæv organ kunne opretholdes ex vivo i flere dage 8 sup>, 23, 24.

Protokollen for ex vivo kultur af mus colon orgel kan have mange anvendelser i undersøgelser i forbindelse med antimikrobielle immunreaktioner af tarmens epitel. De patogener og deres PAMPs er anerkendt af PRRS såsom Toll-lignende receptorer (TLRs) og NOD-lignende receptorer (NLRs) til stede i epitel og immunceller. Defekt ekspression og funktion af mange TLR'er og NLRs er forbundet med modtagelighed for IBD, kolorektal tumorigenese, og bakterieinfektioner. Da udødeliggjort epitelial cellelinjer ikke repræsenterer alle funktionerne i den intestinale niche, ex vivo kolon orgel kultur er et meget nyttigt eksperimentel værktøj. Med dette system kan vi undersøge virkningen af ​​forskellige PAMPs eller stimuli på induktionen af ​​antimikrobielle effektormolekyler i de intestinale epitelceller. I det repræsentative eksperiment viste vi, at cytokiner kan lideIL-1β og IL-18 udløser ekspressionen af antimikrobielle peptider (figur 3). Vi viser også her, antimikrobielle peptider fremstillet ved kolon væv effektivt kan dræbe E. coli (figur 4). Disse teknikker kan anvendes til at teste indflydelsen af ​​lipopolysaccharid (LPS), peptidoglycan (PGN), muramyldipeptid (MDP), og andre PAMPs i antimikrobielle værtsforsvarsmekanismer responser i tarmen.

Vi har ændret lidt tyktarmen orgel kultur protokol som beskrevet tidligere 12, 16, 20, 25. Dyrkede vi colon i to faser. Ved første, inkuberede vi colon væv i antibiotikaindeholdende medium i 2 timer. Vi fjernede dernæst antibiotika med gentagen vask af colon stykker efterfulgt af inkubation med antibiotika frie medier. Således kultursupernatanten opnået fra overnatskultur af denkolon udstiller kun effekten af udskilte antimikrobielle peptider, når de inkuberes med E. coli. Denne fremgangsmåde kan anvendes til at se den baktericide virkning af colon eller tarm afledt antimikrobielle peptider på eventuelle bakterier af interesse. En passende selektiv agar medier bør anvendes til dyrkning af bakterier.

Ligesom de fleste teknikker, der er begrænsninger i ex vivo organ dyrkningssystem. Først, i modsætning til cellekultur eller organoide kultur, organerne ikke vokse og proliferere og derfor ikke kan udvides. For det andet, intestinale epitelceller er meget følsomme og de dør forholdsvis hurtigt uden yderligere vækstfaktorer og apoptoseinhibitorer, som anvendes til krypt organoide kultur. Tredje, immunresponset observeret fra organkultur er en kollektiv reaktion af forskellige former for cellepopulationer. Derfor kan det ikke vurderes, hvilken rolle de enkelte celletype i udtrykket af antimikrobielle og effektor gener. Additionally, i modsætning til i cellelinier og organoide kultur, kan ekspressionen af ​​antimikrobielle peptider og andre effektormolekyler i koloner variere fra mus til mus af samme genetiske baggrund.

Sammenfattende beskriver vi her en enkel protokol til ex vivo colon organkultur som er meget nyttigt til at studere intestinale antimikrobielle immunresponser. Denne fremgangsmåde kan anvendes til at teste rollen af ​​forskellige medfødte immun gener i ekspressionen af ​​antimikrobielle peptider ved dyrkning koloner fra genetisk mutant mus af interesse. Endvidere kan denne protokol tilpasses til anvendelse i kliniske forsøg til undersøgelse af intestinale antimikrobielle svarene fra IBD patienter ved at gennemføre organkultur af colon biopsiprøver.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Dette arbejde blev støttet af midler fra Crohns og Colitis Foundation of America, (CCFA, 3711) Cancer Prevention og Research Institute of Texas (CPRIT, RP160169), og UT Southwestern Medical Center givet til MHZ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats