los

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

El intestino muestra una arquitectura de cripta estructuras repetitivas que consisten en diferentes tipos de células epiteliales, lámina propia que contiene células del sistema inmune, y el estroma. Todas estas células heterogéneas contribuyen a la homeostasis intestinal y participar en la defensa del huésped antimicrobiana. Por lo tanto, la identificación de un modelo sustituto para el estudio de la respuesta inmune y la actividad antimicrobiana del intestino en un entorno in vitro es extremadamente difícil. Los estudios in vitro con líneas de células epiteliales intestinales inmortalizadas o incluso cripta primaria organoid cultura no representan la fisiología exacta del intestino normal y su microambiente. Aquí, se discute un método de tejido de colon cultivo ratón en una placa de cultivo y cómo este ex vivo sistema de cultivo de órganos se puede implementar en estudios relacionados con las respuestas de defensa del huésped antimicrobianos. En experimentos representativos, se demostró que dos puntos en cultivo de órganos expresan péptidos antimicrobianos en respOnse a exógenos IL-1β y IL-18. Además, las moléculas efectoras antimicrobianos producidos por los tejidos de colon en el cultivo de órganos matan eficientemente Escherichia coli in vitro. Este enfoque, por lo tanto, puede ser utilizado para diseccionar el papel de patrones moleculares de patógenos y asociado de peligros y sus receptores celulares en la regulación de la respuesta inmune innata intestinales y las respuestas de defensa del huésped antimicrobianos.

Introduction

El intestino representa un sistema dinámico que actúa como una barrera para los microorganismos comensales, lucha contra los patógenos invasores, y regula la composición microbiana 1. Las células epiteliales intestinales, que consta de los enterocitos, células caliciformes, células de Paneth y células enteroendocrinas, son las principales poblaciones de células que proporcionan las respuestas de defensa del huésped contra microbiota intestinal. Las células caliciformes producen mucinas que crean una zona desmilitarizada en la parte superior de la capa epitelial 2. Las células de Paneth y enterocitos producen péptidos antimicrobianos, citoquinas, y las especies de oxígeno y nitrógeno reactivos que constituyen las respuestas de defensa del huésped antimicrobianos y contribuyen a la formación de la composición microbiana intestinal 3, 4. Además de las células epiteliales, las células inmunes incluyendo macrófagos, células dendríticas, neutrófilos, células asesinas naturales, linfocitos y inna células linfoides de TE en la lámina propia y la submucosa juegan un papel crítico en las respuestas de defensa del huésped antimicrobianos intestinales por citoquinas que producen, quimiocinas, y otros mediadores de 5 - 7. Con el fin de entender cómo el sistema inmune de la mucosa regula microbiota y proporciona protección contra la infección microbiana, es importante tener en cuenta la compleja interacción de las poblaciones de células heterogéneas de la tripa. Sin embargo, un modelo in vitro que abarca todas las características del intestino no está disponible. Por lo tanto, los estudios moleculares en la interacción huésped-patógeno en el intestino son muy desafiante.

En los últimos años, varios sistemas de modelos que imitan aspectos de la mucosa intestinal han sido desarrollados para la investigación de los procesos fisiopatológicos implicados en las enfermedades inflamatorias del intestino (IBD) y otros trastornos gastrointestinales 8 -= "xref"> 14. líneas de células epiteliales intestinales inmortalizadas son a menudo utilizados para estudiar las respuestas específicas de células epiteliales. Sin embargo, debido a la expresión diferencial de genes y la función en las células inmortalizadas, los datos obtenidos del uso de esas células no suelen coincidir con los observados en los estudios in vivo. Cripta intestinal organoid cultura recientemente ha surgido como una herramienta potencial para la evaluación de la respuesta del epitelio intestinal a diferentes estímulos 13. En este sistema, se permitió que las células madre de la cripta para crecer y desarrollar una estructura organoid 3D. Mientras que el sistema de cultivo organoide es muy útil para el estudio de muchos aspectos del epitelio intestinal, que no imita la compleja interacción de las células inmunes, células epiteliales y productos microbianos. El cultivo ex vivo del tejido intestinal ofrece una mejor representación de las respuestas de defensa en vivo de acogida. En este método, una parte del intestino se cultiva en una placa de cultivo celular ingenioh medios adecuados que permitan a los diferentes tipos de poblaciones de células en el intestino para ser metabólicamente activo durante al menos 48 h. Por lo tanto, un cultivo ex vivo del órgano se puede utilizar para medir la expresión de genes antimicrobianos y las respuestas de defensa del huésped del intestino a un estímulo particular.

Los investigadores han estado utilizando el sistema de cultivo de órganos ex vivo para estudiar las respuestas de defensa del huésped frente a la infección microbiana en el intestino 15 de - 21 años. Recientemente hemos adoptado el sistema de cultivo de órganos para estudiar el papel de la inflamasoma en las respuestas de defensa del huésped antimicrobianos en colones de ratones 22. El inflamasoma es una plataforma molecular para la activación de la caspasa-1, que se requiere para la producción de IL-1β madura y IL-18. Hemos demostrado que la IL-1β e IL-18 inducen péptidos antimicrobianos que matan con eficacia pathobionts comensales tales como E. coli de E. coli en colones de ratones inflamosoma-22 defectuosa. Este sistema, por lo tanto se puede utilizar para estudiar el papel de los receptores de reconocimiento de patrones (PRRS) y otras moléculas inmunes innatas en las respuestas de defensa del huésped antimicrobianos intestinales, así como la patogénesis de los trastornos intestinales tales como la enfermedad inflamatoria del intestino (IBD) y el cáncer colorrectal (CRC). Hay más de 200 genes de susceptibilidad IBD, y mutaciones en muchos de estos genes están asociados con la composición microbiana alterada en el intestino. Es de gran importancia clínica para determinar el mecanismo preciso por el que los genes de susceptibilidad IBD-regulan microbiota intestinal. El objetivo general de este método es introducir un protocolo básico de ex vivo de cultivo de órganos de colon y demostrar cómo este método de cultivo se puede utilizar para estudiar las respuestas de defensa del huésped antimicrobianos del intestino.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos los experimentos aquí descritos se realizaron con ratones de 6-8 semanas de edad de tipo salvaje macho (C57BL6 / J) mantenido en una instalación libre de patógenos específicos (SPF) en el Centro de Recursos Animales (ARC), de UT Southwestern Medical Center. Todos los estudios fueron aprobados por el Comité de Cuidado y Uso de Animales Institucional (IACUC) y se llevaron a cabo de acuerdo con las directrices del IACUC y los Institutos Nacionales de Salud de Guía para el Cuidado y Uso de Animales de Laboratorio.

1. Recogida y preparación del colon

  1. La eutanasia a los ratones con asfixia de CO 2 seguido por dislocación cervical.
  2. Pulverizar ratones con 70% de etanol y el pin extremidades para fijar una placa de mantenimiento de la cara dorsal del ratón sobre la tabla.
  3. El uso de tijeras y pinzas de disección pre-esterilizados, hacer una incisión de línea media en el peritoneo del abdomen. Abrir el abdomen por plegado el peritoneo con fórceps.
  4. Retire el intestino desde el wi cavidad abdominalº pinzas de disección y tijeras. Separar el colon desde el intestino delgado mediante el corte en la parte inferior del ciego y el otro extremo en el recto.
  5. Coloque el colon en una placa petri estéril que contenía PBS enfriado en hielo. Enjuague el contenido de la luz del colon con PBS enfriado con hielo utilizando una jeringa de 20 ml que sostiene una aguja G 20 o una aguja de sonda oral hasta que la materia fecal dentro de la luz del colon es eliminado por completo.
  6. Cortar el colon con tijeras longitudinalmente. Lavar el colon agitando vigorosamente en PBS enfriado con hielo en una placa de Petri estéril.
  7. Cortar el tejido del colon en trozos de aproximadamente 1 cm de longitud utilizando un bisturí o tijeras estériles.
  8. Anotar el peso de las piezas de colon.
    NOTA: Todos los pasos de la sección 1 se pueden realizar ya sea dentro o fuera de una cabina de seguridad biológica. Una vez que los dos puntos están listos para la cultura, todos los pasos se deben realizar dentro de una cabina de seguridad biológica para mantener la esterilidad.

2. Colon Orguna cultura

  1. Coloque un filtro de células (100 micras) en una placa de cultivo de 6 pocillos. Transferencia de todas las piezas de colon obtenidos de un ratón en el filtro de células.
  2. Añadir 5 ml de medio DMEM / F12 que contenía 5% de FBS, penicilina-estreptomicina (1x), y gentamicina (20 mg / ml). Cubra completamente las piezas de colon con los medios de comunicación.
  3. Incubar durante 2 horas a 37 ° C en una incubadora con 5% de CO2 y 95% de aire.
  4. Levante el filtro de células y aspirar los medios de comunicación.
  5. Coloque el filtro de células de nuevo en el pozo y añadir 5 ml de medio fresco sin ningún antibiótico. Levante el filtro de células y aspirar los medios de comunicación.
  6. Repita el paso anterior de lavado (Paso 2.5) dos veces más (3x total) para eliminar todos los antibióticos residuales.
  7. La transferencia de las piezas de colon de un solo filtro de células en un solo pocillo de una placa de cultivo celular estéril de 12 pocillos.
  8. Añadir medio DMEM / F12 que contenía 5% de FBS (sin antibióticos). Ajuste el volumen del medio con el Weight de las piezas de colon, por ejemplo, 1 ml de medio para 100 mg de tejido. Incubar durante 12 horas a 37 ° C en una incubadora inyección de 5% de CO2 y 95% de aire.
  9. Recoger el sobrenadante del cultivo en un tubo estéril de 1,5 ml.
  10. Centrifugar a 12.000 xga 4 ° C durante 5 min. Separar el sobrenadante a un nuevo tubo de 1,5 ml para su uso en las bacterias matar ensayo y / u otros ensayos inmunológicos. El sobrenadante se puede almacenar a -80 ° C hasta el ensayo.
  11. Recoger las piezas de colon en un tubo para aislamiento de ARN.

3. Ensayo de E. coli Killing

  1. Inocular E. coli en ml Luria-Bertani (LB) caldo de 5 en un tubo de 15 ml y se incuba a 37 ° C con agitación a 200 rpm durante la noche. Mantenga la tapa del tubo de cultivo ligeramente suelto.
  2. Centrifugar el tubo de cultivo bacteriano a 1200 xg durante 10 min a 4 ° C. Eliminar el sobrenadante y resuspender el sedimento bacteriano en PBS 5 ml de hielo-frío.
  3. Transferencia de 1 ml de la BACTsuspensión erial en una cubeta y OD medida a 600 nm. Utilice PBS como blanco.
  4. Calcular la unidad formadora de colonias (ufc) utilizando una curva estándar predeterminada. Aquí, se supone que 1 DO = 2 x 10 9 ufc / ml (aproximadamente).
  5. Diluir la suspensión bacteriana para hacer la suspensión de acciones 1 x 10 5 ufc / mL.
  6. Transferir el sobrenadante de cultivo de órganos de colon (500 l / pocillo) recogidos en la Sección 2.10 en pocillos duplicados de una placa de cultivo celular de 24 pocillos.
  7. Añadir 10 l de cultivo de E. coli (1.000 ufc) en un pocillo que contiene 500 l de órganos de colon sobrenadante del cultivo. Deje el otro bien sin ninguna inoculación E. coli para confirmar que el sobrenadante de cultivo de órganos de colon no contiene ninguna contaminación.
  8. Incubar el mismo número de bacterias (1.000 ufc) en el medio de cultivo (DMEM / F12 más 5% FBS) sin antibióticos como un control.
  9. Incubar a 37 ° C durante 1 h.
  10. Colocar 50 l de cada muestra de gota-wiSE en placas de agar MacConkey. Se incuban las placas de agar MacConkey a 37 ° C durante la noche.
  11. Contar el número de colonias y calcular el ufc / ml.

4. El efecto de los factores extrínsecos e intrínsecos de colon antimicrobianos Las respuestas de defensa del huésped

NOTA: El ensayo de destrucción antimicrobiana como se describe aquí se pueden adoptar para examinar el efecto de los patrones de patógenos asociados moleculares (PAMPs) y citoquinas sobre la actividad bactericida de sobrenadante de cultivo de órganos. Un ejemplo de tal experimento usando IL-1β y IL-18 se describe a continuación.

  1. Suma dos puntos de los ratones como se describe en la Sección 1.
  2. Coloque los dos puntos sobre una toalla de papel estéril. Cortar los dos puntos longitudinalmente en tres partes con unas tijeras (Figura 2).
  3. Lavar cada parte del colon en PBS frío como se describe en la Sección 1.
  4. Corta cada parte del colon en trozos pequeños y se pesa asépticamente. La transferencia de las piezas de cada partede los dos puntos en tres tamices de células separadas (100 M) colocados en tres pocillos de una placa de cultivo celular de 6 pocillos (Figura 2).
  5. Añadir 2 ml de DMEM medio / F12 que contenía 5% de FBS, penicilina-estreptomicina (1x), y gentamicina (20 mg / ml).
  6. Incubar durante 2 horas a 37 ° C en una incubadora inyección de 5% de CO2 y 95% de aire.
  7. Lavar las piezas de colon como se describe en 2,4-2,6. La transferencia de las piezas de colon de un solo filtro de células en un solo pocillo de una placa de cultivo celular estéril de 12 pocillos. Los tres pocillos que contienen tres partes del colon de un solo ratón deben ser designados como no tratada, IL-1β, IL-18 y (figura 2).
  8. Añadir medio DMEM / F12 que contenía 5% de FBS (sin antibióticos). Ajustar el volumen del medio con el peso de las piezas de colon, por ejemplo, 1 ml de medio para 100 mg de tejido.
  9. Estimular el cultivo de órganos de colon con IL-1β (20 ng / ml) o IL-18 (20 ng / ml) durante 12 h. El colon sin tratar cultivo de órgano sirve como control.
  10. Después de 12 h de incubación a 37 ° C en una incubadora inyección de 5% de CO2 y 95% de aire, recoger el sobrenadante del cultivo en un tubo estéril de 1,5 ml.
  11. Transferir 500 l del sobrenadante del cultivo en pocillos duplicados de una placa de 24 pocillos.
  12. Inocular E. coli (1.000 ufc) en el órgano de colon sobrenadante de cultivo como se describe en la Sección 3. Para cada condición, inocular E. coli en un solo pozo. El otro pocillo que contiene sobrenadante del cultivo mismo órgano sin E. coli servirá como control para la contaminación bacteriana.
  13. Incubar la misma cantidad de bacterias en medios de cultivo sin antibióticos como un control.
  14. Incubar a 37 ° C durante 1 h.
  15. Colocar 50 l de cada muestra gota a gota sobre placas de agar MacConkey. Se incuban las placas de agar MacConkey durante la noche a 37 ° C.
  16. Contar el número de colonias y calcular el ufc / ml (Figura 4).
e_title "> 5. La medición de la expresión de genes antimicrobianos

  1. Después de la incubación durante la noche (12 h) de cultivo de órganos del colon como se describe en las secciones 2 y 4, lavar las piezas de colon con 2 ml de PBS enfriado con hielo (2x).
  2. Reunir las piezas de colon en un tubo con tapón de rosca libre de 2 ml de RNasa / DNasa. Colocar los tubos en hielo.
  3. Añadir 1 ml de reactivo Trizol comercial y de lisis perlas de matriz en el tubo.
  4. Lyse el tejido utilizando un homogeneizador de tejidos automatizada.
  5. Recoger el lisado de tejido en un nuevo tubo de microcentrífuga.
  6. Aislar el ARN utilizando el protocolo estándar.
  7. Medir la concentración de ARN.
  8. Diluir RNA apropiadamente con agua desionizada y el uso de 500 ng de ARN para sintetizar cDNA.
  9. Utilice el ADNc para análisis en tiempo real de RT-PCR de genes dirigidos antimicrobianos, citocinas, quimiocinas y otros genes de interés.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Una imagen representativa de dos puntos en cultivo de órganos se muestra en la Figura 1. Las piezas de colon en la cultura siguen siendo metabólicamente y fisiológicamente activo. Responden de manera eficiente a los estímulos exógenos añadidos al medio de cultivo. Un flujo de trabajo esquemática de la preparación del tejido del colon para el cultivo ex vivo y la estimulación con estímulos exógenos, por ejemplo, IL-1β y IL-18, se muestra en la Figura 2. Los datos representativos en la Figura 3 muestran que los dos puntos en cultivo de órganos expresan péptidos antimicrobianos tales como β-defensin 2 (BD2), Reg3γ, S100A8, S100A9, y iNOS en respuesta a IL-1β y IL-18.

Los mediadores liberados por los implantes de colon exhiben un efecto letal antimicrobiano como se ha demostrado por el reducido significativamente el crecimiento de E. coli se incubaron con el sobrenadante de cultivo de órganos ( 4B). Tal actividad de eliminación de E. coli se potencia adicionalmente por la estimulación de IL-1β y IL-18 (Figuras 4A y 4B). Colon sobrenadantes de cultivo de órganos incubadas sin E. coli no muestran crecimiento bacteriano tras el cultivo en agar MacConkey (Figuras 4C y 4D). Estos resultados sugieren además que la inflamasoma juega un papel importante en la defensa del huésped antimicrobiano intestinal.

En general, los datos presentados aquí sugieren que ex vivo de cultivo de órganos de colon es una técnica muy útil para estudiar las respuestas inmunes antimicrobianas intestinales in vitro.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCGRAMO
β-defensinas 2 _F (BD2) TGACCACTGCCACACCAATG
β-defensinas 2 _R (BD2) CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Tabla 1: Lista de los cebadores de ratón para PCR en tiempo real.


Figura 1: imagen representativa de las piezas de colon de ratón en la cultura. (A) Incubación de piezas de colon en un filtro de células (100 micras) colocado en una placa de 6 pocillos. piezas de colon se sumergen en 2 ml de medios de cultivo suplementado con antibióticos. (B) Después de 2 h de incubación, piezas de colon se transfieren en el pozo de una nueva placa de cultivo celular de 12 pocillos que contenía medio-antibióticos libres. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2: Representación esquemática de los pasos para la preparación de tejidos de colon y ex vivo la estimulación con IL-1β y IL-18. Los dos puntos de un ratón es longi tudinally diseccionado en tres partes. Cada parte se cortó en trozos pequeños y se pesa. Las piezas de colon de cada sección del colon se transfieren a filtros de células colocadas en pocillos de una placa de 6 pocillos que contiene 2 ml de DMEM / F12, más el 5% de FBS y antibióticos. Después de un 2 h de incubación, las piezas de colon de un solo filtro de células se transfieren a un solo pocillo de una placa de cultivo celular de 12 pocillos. DMEM / F12 más 5% de FBS (sin antibióticos) se añade en cada pocillo y se ajusta el volumen del medio de acuerdo con el peso del tejido (1 ml de medio de 100 mg de tejido). tejidos de colon son estimuladas con IL-1β (20 ng / ml) e IL-18 (20 ng / ml) durante 12 h. Los sobrenadantes de cultivo se centrifugan y se utilizan para E. coli ensayo de matar y / u otros ensayos inmunológicos. Los tejidos de colon se recogen en tripsina reactivo comercial para el aislamiento de ARN y los análisis posteriores de la expresión de genes antimicrobianos por PCR en tiempo real..jpg "target =" _ blank "> Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3: los tejidos de colon de ratón expresan citocinas y péptidos antimicrobianos en respuesta a IL-1β o IL-18 durante el cultivo ex vivo. cultivos de órganos de colon se estimularon con IL-1β (20 ng / ml) o IL-18 (20 ng / ml) durante 12 h. La expresión de BD2, Reg3γ, S100A8, S100A9, y iNOS se midió por tiempo real de RT-PCR (Tabla 1). Los datos representan la media ± SD; * P <0,05, ** p <0,01. Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4: sobrenadante de ratón culto órgano de colonUre muestra actividad bactericida. Piezas de colon se cultivaron ex vivo en presencia o ausencia de IL-1β (20 ng / ml) o IL-18 (20 ng / ml) durante 12 h. 500 l de los sobrenadantes de cultivo se incubaron con E. coli (1.000 ufc) durante 1 hora a 37 ° C. Colon órgano sobrenadante de cultivo sin E. coli también se incubó como control. Después de 1 h de incubación, 50 l de cada muestra se colocó gota a gota sobre placas de agar MacConkey y se incubó a 37 ° C durante la noche. (A) Imagen de colonias de E. coli en agar MacConkey que muestran actividad antimicrobiana de cultivo de órganos de colon. (B) E. coli que muestra el recuento de matar eficiencia de tratados con IL-18 IL-1β- y el sobrenadante de cultivo de órganos de colon. (C) Imagen de la placa de agar MacConkey que no muestra crecimiento bacteriano en el cultivo de órganos de colon incubada sin E. coli. (D) No colonias de E. coli se identificaron en el colon órgano cULTURA incubó sin E. coli, lo que indica la ausencia de cualquier bacteria contaminante en la muestra. Los datos representan la media ± SD; ** P <0,01, *** p <0,001. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Las células epiteliales intestinales son muy sensibles en cuanto a sus necesidades de crecimiento y por lo tanto difíciles de cultivar. Las células epiteliales aisladas por tratamiento con EDTA no sobreviven en medios de cultivo celular convencionales, tales como DMEM 8. Por lo tanto, huésped-patógeno estudios de interacción utilizando cripta aislado o células epiteliales primarias son muy difíciles. Recientemente, Sato et al. se describe un sistema de cultivo organoid cripta, que es muy prometedora y útil para los estudios relacionados con la fisiopatología intestinal 13. Mientras organoides representan muchas características de la cripta intestinal, existe la preocupación en cuanto a si las respuestas inmunes de las células de organoides, que se cultivan en un ambiente estéril, recapitulan las respuestas de las células epiteliales intestinales in vivo. Las técnicas precisas requeridas para el aislamiento y cultivo de células madre epiteliales y requisito de reactivos costosos para el cultivo de organoides prevenir malaboratorios ny de tomar ventaja de este sistema. Aunque el uso de ex vivo de cultivo de órganos no es una alternativa a la cultura organoide, este sistema ofrece un método sencillo y barato para estudiar las respuestas antimicrobianas de epitelio intestinal.

La principal ventaja de esta técnica es que la arquitectura del tejido del intestino se mantiene mientras el cultivo en los platos. Hemos observado que los tejidos de colon son fisiológicamente activo durante al menos 24 horas después de su cultura. Durante el cultivo del colon, las células epiteliales de colon responden a estímulos exógenos tal como se mide por la expresión de citocinas y péptidos antimicrobianos. La viabilidad de las células epiteliales del tejido intacto se puede mejorar aún más por la adición de factores e inhibidores de la muerte de las células de crecimiento apropiados en el medio de cultivo. En informes anteriores sugieren que el órgano tejido colónico humano normal podría ser mantenida ex vivo durante varios días 8 sup>, 23, 24.

El protocolo para el cultivo ex vivo de órganos de colon de ratón puede tener muchas aplicaciones en estudios relacionados con las respuestas inmunes antimicrobianas del epitelio intestinal. Los agentes patógenos y sus PAMP son reconocidos por los derechos y responsabilidades parentales tales como los receptores tipo Toll (TLRs) y los receptores NOD-como (NLRs) presentes en las células epiteliales e inmunológico. expresión y función de muchas TLRs y NLRs defectuosos están asociados con la susceptibilidad a EII, la tumorigénesis colorrectal, y las infecciones bacterianas. Dado que las líneas de células epiteliales inmortalizadas no representan todas las características del nicho intestinal, la ex vivo de cultivo de órganos de colon es una herramienta experimental muy útil. Usando este sistema, podemos examinar el efecto de diversos PAMP o estímulos sobre la inducción de moléculas efectoras antimicrobianos en las células epiteliales intestinales. En el experimento representativo, hemos demostrado que las citoquinas gustaIL-1β y IL-18 de activación de la expresión de péptidos antimicrobianos (Figura 3). También se muestra aquí que los péptidos antimicrobianos producidos por el tejido del colon pueden matar con eficacia E. coli (Figura 4). Estas técnicas pueden aplicarse para probar la influencia de lipopolisacárido (LPS), peptidoglicanos (PGN), muramildipéptido (MDP), y otros PAMP en las respuestas de defensa del huésped antimicrobianos en el intestino.

Hemos modificado ligeramente el protocolo de cultivo de órganos de colon como se ha descrito previamente 12, 16, 20, 25. Nos cultivadas del colon en dos fases. En un primer momento, que se incubaron con el tejido de colon en antibióticos que contienen medio durante 2 h. a continuación, hemos eliminado los antibióticos con el lavado repetido de las piezas de colon seguido de incubación con antibióticos medios de comunicación libres. Por lo tanto, el sobrenadante del cultivo obtenido a partir de cultivo de una noche de laexposiciones de colon sólo el efecto de los péptidos antimicrobianos secretadas cuando se incubaron con E. coli. Este enfoque se puede utilizar para ver el efecto bactericida de colon o intestino péptidos antimicrobianos derivados de cualquier bacteria de interés. Un medio de agar selectivo apropiado debe utilizarse para cultivar las bacterias.

Como la mayoría de las técnicas, existen limitaciones del sistema de cultivo de órganos ex vivo. Primero, a diferencia de cultivo de células o cultivo organoide, los órganos no crecen y proliferan y por lo tanto no se pueden ampliar. En segundo lugar, las células epiteliales intestinales son muy sensibles y mueren de forma relativamente rápida y sin factores de crecimiento adicionales y los inhibidores de la apoptosis, que se utilizan para el cultivo de organoide cripta. En tercer lugar, la respuesta inmune observada desde el cultivo de órganos es una respuesta colectiva de diferentes tipos de poblaciones de células. Por lo tanto, el papel del tipo de célula individual en la expresión de genes antimicrobianos y efectoras no se puede evaluar. additionalmente, a diferencia de las líneas celulares y la cultura organoide, la expresión de péptidos antimicrobianos y otras moléculas efectoras en los dos puntos puede variar de ratón a ratón de los mismos antecedentes genéticos.

En resumen, se describe aquí un protocolo sencillo para ex vivo de cultivo de órganos de colon que es muy útil para estudiar las respuestas inmunes antimicrobianas intestinales. Este enfoque puede ser empleado para probar el papel de diversos genes de inmunidad innata en la expresión de péptidos antimicrobianos mediante el cultivo de dos puntos de ratones mutantes genético de interés. Además, este protocolo se puede adaptar para su uso en estudios clínicos para examinar las respuestas antimicrobianas intestinales de pacientes con EII mediante la realización de cultivo de órganos de muestras de biopsia de colon.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Este trabajo fue apoyado por fondos de la enfermedad de Crohn y Colitis Foundation of America, (CCFA; 3711) Prevención del Cáncer y el Instituto de Investigación de Texas (CPRIT; RP160169), y UT Southwestern Medical Center dan a MHZ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats