Vurdering af DNA forurening i RNA prøver baseret på ribosomale DNA

Genetics
 

Summary

Vi præsenterer her, en protokol for sporing genomisk DNA (gDNA) forurening i RNA prøver. Metoden præsenteres udnytter primere specifikke for regionen indre transskriberede spacer (ITS) i ribosomale DNA (rDNA) gener. Metoden er velegnet til pålidelige og følsomme påvisning af DNA forurening i de fleste eukaryoter og prokaryoter.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hashemipetroudi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA. J. Vis. Exp. (131), e55451, doi:10.3791/55451 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

En metode, flittigt brugt til kvantificering af gen expression ændringer og udskrift mængder er omvendt-transskription kvantitative real-time PCR (RT-qPCR). Det giver præcise, følsomme, pålidelig og reproducerbare resultater. Flere faktorer kan påvirke følsomheden og specificiteten af RT-qPCR. Resterende genomisk DNA (gDNA) forurener RNA prøver er en af dem. I gen expression analyse, uspecifikke forstærkning på grund af gDNA forurening vil overvurdere overfloden af udskrift niveauer og kan påvirke RT-qPCR resultater. Generelt, gDNA registreres af qRT-PCR ved hjælp af primer par udglødning intergenic regioner eller en intron af gen af interesse. Desværre kendes intron/exon anmærkninger endnu ikke for alle gener fra hvirveldyr, bakterier, protist, svampe, plante og hvirvelløse metazoan arter.

Her præsenterer vi en protokol til påvisning af gDNA forurening i RNA prøver ved hjælp af ribosomale DNA (rDNA)-baserede primere. Metoden er baseret på de unikke kendetegn ved rDNA: deres multigene karakter, stærkt bevarede sekvenser og høj frekvens i genomet. Også som Case, et entydigt sæt af primere blev designet baseret på regionen bevarede ribosomale DNA (rDNA) i familien (Poaceae). Universel anvendelse af disse primer par blev testet ved at smelte kurve analyse og Agarosen gelelektroforese. Selv om vores metode forklarer hvordan rDNA-baserede primere kan anvendes til gDNA forurening assay i familien (Poaceae), det let kunne bruges til andre prokaryot og eukaryote arter

Introduction

Udforske transkriptionel regulering af interessant gen sæt eller signalering netværk er vigtigt at forstå de komplekse molekylære mekanismer involveret i biologiske hændelser1. I øjeblikket er qPCR analyse mest udbredte tilgang til gen expression undersøgelser, der kan målrette enten DNA (genomet) eller RNA (transkriptom) som tillader methylome og transkriptom analyse, henholdsvis. Reverse transkription (RT) efterfulgt af qPCR er almindeligt brugt til transkriptom analyse, der måler gen expression niveauer i forskellige områder af biologiske forskning2. Sammenlignet med andre metoder såsom den traditionelle nordlige hybridisering, væv specifik registrerings via in situ hybridisering, ribonuklease beskyttelse assays (RPA) og semi-RT-PCR, nøjagtigheden, bekvemmelighed, hastighed og bredt dynamikområde af qPCR-baserede assays er meget bemærkelsesværdig3,4. Der er flere vigtige faktorer, der skal anses for en pålidelig kvantificering af messenger RNA (mRNA), herunder kvaliteten og kvantiteten af RNA starter materiale. Derudover skal uspecifikke forstærkning, effektiviteten af RT-qPCR og PCR effektivitet overvejes5,6.

Tilstedeværelsen af gDNA er en iboende problem under RNA udvinding skyldes, dels at DNA og RNA7lignende fysiske og kemiske egenskaber. På grund af sekvens identitet gDNA og supplerende DNA (cDNA) afledt af mRNA prøver, kan der forekomme uspecifikke forstærkning, som vil påvirke nøjagtigheden af RT-qPCR resultater. De resterende gDNA vil føre til overvurdering af overfloden af målrette mRNA i gen expression analyse8.

Dybest set, uspecifikke amplikon hovedsagelig udspringer af primer-dimer dannelse eller uspecifik baggrund forstærkning på grund af gDNA, som begge kan vurderes ved hjælp af passende kontrolprøver. Prøverne er ingen template control (NTC) og ingen reverse transkriptase kontrol (NRT), henholdsvis. Da adskiler gDNA forureningsniveauer i prøverne undersøges og følsomhed overfor gDNA varierer meget mellem de gener, der er analyseret, er NRT kontrol påkrævet for hvert tabelpar, prøve/assay. Selv om dette øger betydeligt omkostninger og arbejdskraft i RT-qPCR profilering undersøgelser, er disse kontrolelementer påkrævet7,9.

Alternative metoder beskæftiger sig med gDNA forurening omfatter brug af primer par udglødning intergenic regioner eller en intron gen interesse10, og brugen af primere, der enten flankere en stor intron eller spænder over en exon-exon junction, dvs. de udgloedning websteder er fraværende i den modne mRNA sekvens1,4. Dog er intron/exon anmærkninger for alle gener fra mange hvirveldyr, bakterier, protist, svampe, plante og hvirvelløse metazoan arter kendt endnu. Derudover har mange Eukaryote organismer pseudogenes afledt af dobbeltarbejde begivenheder. Yderligere, primer design på tværs af introns kan ikke garantere ikke-forstærkning af gDNA. Som kromatin tilgængelighed af genomisk regioner til DNase jeg varierer, det anbefales at designe forskellige primer par målretter anderledes kromosomer10.

Genomer af Eukaryote organismer kan omfatte op til tusind eksemplarer af rDNA gener kodning ribosomale underenheder nødvendige for ribosomer dannelse. Disse rDNA gener er ofte organiseret i enkelt- eller tandem repeat arrays11. Polycistronic rRNAs (figur 1) herunder store subunit (LSU) og små subunit (SSU) er transskriberet af RNA polymerase jeg (RNA pol jeg). De resulterende pre-rRNAs behandles yderligere ved at fjerne de to interne transskriberede spacer regioner ITS1 og ITS2. Som færdige produkter, tre modne rRNAs, 17-18S rRNA (SSU), 5.8S og 25-28S rRNA (LSU) er genereret12. rDNA gener er typiske repræsentanter for en multigene familie med stærkt bevarede sekvenser. De forekommer med en høj frekvens i genomet og er potentielt til stede i mere end én kromosomale placering13. Behandling af rRNA og nedbrydningen af de transskriberede spacere er en hurtig proces i nucleolus. Den høje grad af repetitiveness, er forholdet mellem genomisk eksemplarnummer og påviselige uforarbejdede RNA premolecules lavere i forhold til lav-kopi intron sekvenser og unspliced prækursorer. Disse funktioner gør rDNA gener velegnet til pålidelig og yderst følsomme påvisning af gDNA forurening i de fleste eukaryoter og prokaryoter3.

Her er en roman procedure til påvisning af gDNA forurening i RNA prøver beskrevet. Et sæt af universal primere baseret på rDNA bevaret sekvens er præsenteret for gDNA assays i flere arter, græs-familien. Specificitet og universelle karakter af de foreslåede primere blev testet ved at smelte kurve analyse ved hjælp af DNA som en skabelon. Vores protokol er ikke kun gældende for græs-familien, men kan også let tilpasses til andre eukaryote og prokaryote arter.

Protocol

Bemærk: Alle væv kan bruges.

1. nukleinsyre udvinding

  1. Sætte 100 mg af vævsprøver i en 2,0 mL tube, tilføje to 5 mm rustfrit stål perler og homogeniseres væv på 25-30 Hz til 30 s (homogenisering varighed og hyppighed afhængig af vævstype) for både RNA og DNA.
  2. Isolere total RNA ifølge producentens anvisninger.
  3. Isolere samlede DNA ifølge producentens anvisninger.
  4. Kontrollere renhed og mængden af RNA prøver ved måling af absorbans ved 260 og 280 nm.
  5. Kontrollere renhed og mængden af DNA-prøver ved måling af absorbans ved 260 og 280 nm.
    Bemærk: Mens nukleinsyrer absorberer lys med en bølgelængde på 260 nm (A260), absorbansen af light ved bølgelængde 280 (A280) kan bruges til at kvantificere mængden af proteiner og phenoler til stede i prøven. Forholdet mellem A260/A280 nm kan derfor anvendes til at evaluere renheden af DNA og RNA udvundet fra en prøve. A260/280 værdier i rækken af ≥1.8 og > 2.0 er generelt anses for at være "ren" for DNA og RNA, henholdsvis. Lavere A260/280 værdier kan indikere kontaminering af protein eller organiske kemikalier.
  6. Test kvaliteten af DNA ved at køre en 0,7% Agarosen gelelektroforese. Forberede gel og køre i 1 x TRIS-borsyre EDTA-buffer (TBE: 89 mM Tris, 89 mM borsyre og 2 mM EDTA) på 100 V til 30 min. høj kvalitet gDNA synes som en skarp, høj molekylvægt (HMW) band med ingen udstrygningspræparater i rækken af lav molekylvægt (LMW) molekyler.
  7. Check isoleret RNA i mængde, renhed og integritet under denatureringen betingelser ved en guanidin kaliumthiocyanat (GTC) Agarosen gelelektroforese eller ved kapillær elektroforese chip, ifølge producentens anvisninger.
    1. Forbered GTC gel ved at tilføje 5 mM GTC til en standard 1 x TBE 1% agarosegel efter afkøling agar til 60 ° C.
      Bemærk: GTC er giftige, så undvære det i et stinkskab, og bære passende personlige værnemidler.
    2. Forberede RNA denatureringen loading bufferen: 95% formamid, 10 mM EDTA pH 8,0, 0,1% bromophenol blå, 0,1% xylen cyanole og 10 µL ethidiumbromid.
      Bemærk: Formamid og ethidium methylbromid er giftige, og skal udleveres i et stinkskab.
    3. Belastning 1-5 µg af total RNA i RNA denatureringen loading bufferen, varme blanding i 5 min. ved 70 ° C, anbringes på is før du lægger det op på en gel, og derefter adskille RNA på GTC gel på 100 V til 45 min. belastning DNA eller RNA molekylvægt markør som standard sammen med RNA-prøven.
    4. Pletten geler med ethidiumbromid og visualisere bands image capture systemer under ultraviolet lys. I eukaryoter, vil intakt total RNA køre ved denaturering betingelser vise mindst to skarpe og klare rRNA bands (28S og 18S) med forholdet 2:1 intensitet.
  8. Fjerne spor af gDNA ved behandling med DNase (DNase jeg RNase-fri). Tilføje til en RNase-fri rør i 10 µL samlede volumen: 0,1 - 1 µg af total RNA, en enhed af DNase jeg, og 1 µL af 10 x reaktion buffer med MgCl2. Inkuber blanding i 30 minutter ved 37 ° C. Opsige reaktionen ved at tilføje 1 µL af 50 mM EDTA og inkubere ved 65 ° C i 10 min.
  9. Fjerne spor af RNA fra gDNA ekstrakter bruger DNase gratis RNase A, efter producentens protokol. Tilsæt 5 µL af RNase 10 mg/mL til det samlede DNA og inkuberes ved 37 ° C i 1 h. butik RNA og DNA ekstrakter ved-80 ° C.

2. primer Design fra rDNA Region for gDNA Assay

Bemærk: RDNA fuld længde sekvensen indeholder to regioner (ITS1 og ITS2), som er fjernet i den modne rRNA molekyle af en serie af endonucleolytic splittelser og derefter forringet (figur 1).

  1. Hente rDNA nucleotidsekvensen fra NCBI (http://www.ncbi.nlm.nih.gov) for arterne af interesse. De bedste nøgleord til at søge i databasen er "interne transskriberede spacer."
  2. Input af target nucleotidsekvensen ind i en BLASTn søgning for at finde indre transskriberede spacer regioner (ITSs), SSU og LSU bevaret regioner.
  3. Vælg primere, enten flankere en ITSs sekvens eller at forstærke ITSs sekvenser, ikke der findes i den modne rRNA.
    1. Designe primere flankerer ITS1 eller ITS2 sekvenserne: justeres de bevarede dele fra forskellige arter af ClustalW. Design primere specifikke for sin flankerende region efter taxa specifikke/cross-arter analyse med AlleleID software. De to primer par forstærkende SSU-5.8S og 5.8S-LSU amplikoner kan være designet baseret på flanken regionerne ITS1 og ITS2, henholdsvis. Fordi disse amplikoner der spænder over hele regionen ITS, amplikon længde øges for mindst 300 bp i amplikoner fra gDNA. Denne stigning reducerer følsomheden.
      1. Flankerer ITS1: Vælg SSU og 5.8S rRNA sekvens. Valgte primere for græs-familien er: SSU, SF: CGTAACAAGGTTTCCGTAGGTG, R: GGTTCACGGGATTCTGCAAT. Denne primer par (SF: frem og R: omvendt) forstærker den delvise region af SSU, fuld længde af ITS1 og den delvise region 5.8S rDNA.
      2. Flankerer ITS2: Vælg 5.8S og LSU sekvens. Valgte primere for græs-familien er: F: ATTGCAGAATCCCGTGAACC LSU konsensus sekvens, LR: TGCTTAAAYTCAGCGGGTAGYC. Denne primer par forstærker den delvise region i 5.8S i fuld længde af ITS2, og den delvise region i LSU (figur 1).
        Bemærk: I tilfælde af primer design baseret på ITSs flankerende region, de yderst velbevarede områder af SSU, 5.8S og LSU blev identificeret. Frem og bak primere af 5.8S rRNA blev designet baseret på en bevaret motiv i blomsterplanter14. Frem og bak primere blev designet baseret på SSU og LSU bevaret regioner i græs-familien, henholdsvis. Afvigelse af SSU og LSU primere for hver art er givet i tabel 1.
    2. Primere forstærke en ITSs sekvens: I denne protokol, design ITS1 primere baseret på Aeluropus sin sekvens (NCBI taxid nummer: 110873). Primere, bruge: frem: GGTATGGCGTCAAGGAACACT, omvendt: ATAGCATCGCTGCAAGAGGT. Ifølge amplikoner genereret af primer par i siliciummangan, bør størrelsen spænder fra 60 til 200 bp. Dette er også den anbefalede størrelse for qPCR analyse.
  4. Plukke primere samtidig at overveje disse anbefalinger: GC indhold: 40-60%, primer længde: 18-23 base, PCR produkt længde: 60-160 bp (specielt for dens primer), smeltende temperatur (Tm): 60 ° C, den endelige Tm for begge primere ikke afviger mere end 5 ° C og prim ers ikke er komplementær til sig selv eller partner primere.
  5. Kontrollere primer specificitet og kopi nummer. Udføre i siliciummangan analyse af den valgte primer sekvens af primer-blast program (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).
    1. Åbne siden Primer-BLAST indsendelse. Angiv begge primer sekvenser i afsnittet primer parametre i formen. Primer par specificitet kontrol parametre sektion, Indtast en organisme navn (eller organisme gruppenavn) og vælg genom Database. Disse indstillinger giver specificitet oplysninger om target sekvens og primer parametre, herunder produkt længde, stilling på kromosom, og kopier nummer.

3. udføre qPCR skridt for validering af rDNA-baserede primere med DNA skabeloner

Bemærk: Funktionaliteten i de designede primere skal valideres ved at udføre qPCR bruger gDNA som en skabelon. For at udføre flere parallelle reaktioner og reducere pipettering fejl, anbefales udarbejdelse af en master mix. For en master mix, udarbejde et volumen svarende til det samlede antal mastermix plus ~ 10%.

  1. Forberede en master mix ved at blande alle reaktion komponenter undtagen skabelonen DNA i en PCR-reaktion tube. Opskalere efter behov fra en reaktion til at forberede Master mix: 5 µL SYBR green (SYBR) master mix (2 x), 0,3 µL primer (0,3 µM hver af forward og reverse primer), og justere den endelige rumfang til 10 µL med RNase-fri vand. Bruge ca ≤200 ng i 1 µL af skabelon gDNA analyse.
    Bemærk: Tø, samle og holde alle reagenser, komponenter og reaktion blander på is.
  2. Alikvot Master mix i en optisk 96-brønd plade. Afpipetteres 1 µL af gDNA til hver brønd, og derefter dække det med optisk plade forsegling film. Spin og sted i variator.
  3. Køre qPCR analysen på en real-time termisk cycler på følgende betingelser: 10 min. ved 95 ° C efterfulgt af 40 cyklusser af 95 ° C til 15 s og 60 ° C i 1 min. udføre dataopsamling på 60 ° C udglødning/udvidelse trin.
  4. Efter proceduren forstærkning underkaste alle PCR reaktioner på en smeltende kurve analyse med kontinuerlig fluorescens målingen fra 55 ° C til 95 ° C. Typisk, indsamle et datapunkt hver cyklus af en trinvis stigning af temperaturen ved 0,5 ° C pr. cyklus.
    Bemærk: Omfatte mindst 2 ikke-skabelon kontrolelementer (NTC) for hver primer par master mix. Udføre alle assays i mindst tre replikationer.
  5. Bekræfte primer specificitet via melt kurve analyse. Analysere kurver med fælles tærskel cyklus og fratrukkede curve fit metode.
    Bemærk: Udseendet af en skarp individuelle peak angiver en ensartet individuelle amplikon. Primer dimer produkter kan vises som enkelte toppe ved lavere temperaturer.
  6. Validere størrelsen af hver amplikon ved agarosegelelektroforese gelelektroforese.
    1. Forberede en 3%-agarosegel ved at blande 3 g Agarosen med 100 mL af TBE buffer (TBE: 89 mM Tris, 89 mM borsyre og 2 mM EDTA).
    2. Bland 5-10 µL af PCR produkt med DNA og 1-2 µL af 6 x loading bufferen. Indlæse PCR produktet sammen med en DNA ladder på 3% agarosegel. Udføre en elektroforetisk adskillelse i 1 x TRIS-borsyre EDTA-buffer på 100 V til 45 min.
    3. Pletten geler med ethidiumbromid eller enhver anden intercalating agent og visualisere bands image capture systemer under ultraviolet lys.
      Bemærk: DNA intercalating agenter (fx, ethidiumbromid) er udstødning og skal håndteres med omhu og separat udleveres. Udseendet af en unik skarp band (med hensyn til størrelse og uden primer-dimer eller kunstige baggrund forstærkning) bekræfter specificitet af amplikonen.

4. gDNA forurening analyseprocedure med RNA skabeloner

Bemærk: Efter behandling med DNase, den oprensede RNA prøven er testet af rDNA-specifikke primere. På grund af behandlingen af intron-lignende funktion af ITSs, når disse regioner anvendes til forstærkning, bør ingen forstærkning signal registreres i DNA-frie RNA prøver. Baseret på dette, hvis en forstærkning signal i qPCR opdages eller et band i agarosegel observeret med den forventede størrelse (anslået af i siliciummangan analyse), dette bør være på grund af gDNA forurening. Trin udføres i dette afsnit, er svarende til punkt 3, bortset fra at cDNA af alle prøver bruges som skabelon i stedet for gDNA.

  1. Forberede en master mix ved at blande alle reaktion komponenter undtagen RNA skabelon i et PCR-reaktion rør. Master mix kombination for én reaktion: 5 µL SYBR master mix (2 x), 0,3 µL primer (0,3 µM hver af forward og reverse primer mix), og justere den endelige rumfang til 10 µL med RNase-fri vand. Bruge ca 500 ng skabelon RNA i 1 µL volumen til analyse.
  2. Alikvot master mix i en optisk 96-brønd plade. Afpipetteres 1 µL RNA til hver brønd, og derefter dække det af optisk plade forsegling film. Centrifuge og sted i variator.
    Bemærk: Omfatte mindst to NTC kontrolelementer og to positive gDNA kontrolelementer for hvert assay. Udføre alle assays i tre tekniske replikationer.
  3. Køre qPCR analysen på en Real-time termisk cycler på følgende betingelser: 10 min. ved 95 ° C efterfulgt af 40 cyklusser af 95 ° C til 15 s og 60 ° C i 1 min. udføre dataopsamling på 60 ° C udglødning/udvidelse trin.
  4. Efter proceduren forstærkning underkaste alle PCR reaktioner på en smeltende kurve analyse med kontinuerlig fluorescens målingen fra 55 ° C til 95 ° C. Normalt, indsamle et datapunkt hver cyklus af en trinvis stigning af temperaturen ved 0,5 ° C pr. cyklus.
  5. Kontroller alle PCR produkter ved at køre på 3% Agarosen gel elektroforese.
    Bemærk: Udseendet af enhver band eller peak i NTC reaktion er formentlig relateret til primer-dimer formation, som normalt ses ved lave temperaturer i den smeltende kurve, mens tilstedeværelsen af enhver band eller peak i RNA prøver er resultatet af gDNA forurening. Det anbefales at først afprøve alle RNA prøver af rDNA-baserede primere, og derefter ikke-DNA forurenede prøver anvendes til downstream applikationer såsom cDNA syntese, gene expression analyse, osv.

5. RT-PCR skridt for cDNA syntese og qPCR analyse

  1. DNase-behandlet RNA og cDNA syntese reagenser ved stuetemperatur. Efter optøning, spin ned reagenserne. Tilføj 1 µg af RNA og 1 µL af Oligo (dT) 18 primer ind i en nukleasen-fri rør. Justere det samlede volumen af 12 µL med RNase-fri vand, blandes forsigtigt, og derefter gemme på is.
  2. Smelte sekundære strukturer af RNA skabelon ved at inkubere reaktion på 65 ° C i 5 min. Spin ned og cool hætteglas på is.
  3. Forberede reaktion master mix (endelige rumfang 20 µL for hver reaktion) som følger: 1 µL af reverse transkriptase (200 U/µL), 4 µL af reaktion buffer (5 x), 1 µL af RNase inhibitor (20 U/µL) og 2 µL af dNTP Mix (10 mM). Bland forsigtigt og cool hætteglas på is. Tilføje 19 µL ind i rede rør indeholdende RNA.
  4. Inkuber reaktion i 60 min på 42 ° C, og derefter inkuberes ved 70 ° C i 5 min at opsige reverse transkriptase aktivitet. Læg RT Reaktionerne på is og videre til gen expression analyse af rutinemæssig qPCR procedure (som forklaret i afsnit 3 og 4).

Representative Results

Vi foreslår anvendelsen af rDNA-baserede primere til at validere mangel af gDNA forurening i RNA prøver af blad væv. Flowchart af qPCR analyse og gDNA forurening assay er vist i figur 2. I præsenteret protokollen, to komplementære strategier blev brugt til rDNA-baserede primer design: 1) artsspecifikke primere blev valgt fra ITSs sekvenser og 2) universal primere blev valgt fra ITSs flankerende regioner. For test af koncept designet vi primere specifikke for Aeluropus littoralis, og universelle primere baseret på græs-familien arter, som anført i protokollen. 5.8S frem og bak primere blev udvalgt på grundlag af en bevaret 14 basepar (bp) motiv, der viser ligheden mellem blomstrende planter, mosser og flere ordrer af alger og svampe14. Funktioner designet primere er givet i tabel 2. Den universelle karakter af SSU, 5.8S og LSU primer blev kontrolleret af BLASTn, og primer homologi resultater er vist i figur 3 som et motiv logo. Listen over arter i homologi analyse samt de divergerende primere for hver art, der er anført i tabel 1. Primer specificitet var check af Primer-BLAST. For arter, hvor den samlede genom sekvens er tilgængelig, blev det anslået kromosomale placeringen af rDNA gener. For eksempel, i Oryza sativa og Arabidopsis thaliana, rDNA er gener placeret på to forskellige kromosomer og i Zea mays på tre forskellige kromosomer.

qPCR validering af rDNA-baserede primere blev udført med smeltende kurve analyse af ITS1 og ITS2-flanke amplikoner bruge DNA som en skabelon. Som præsenteres i figur 4 og figur 5, primer specificitet blev bekræftet eksperimentelt ved iagttagelse af en enkelt skarpe peak med ingen primer-dimer dannelse i forskellige (Poaceae) arter, herunder Triticum aestivum, Hordeum vulgare, Oryza sativa, og i dicots Medicago sativa, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, Vicia fabaog Arabidopsis thaliana. De yderligere test af forstærkning produkter ved elektroforese størrelse adskillelse viste en unik band. Som forventet, bandene afledt af prøver af forskellige arter varierede i størrelse (figur 6A og 6B). Interessant, brugen af de universelle primere specielt designet for de tre arter, græs-familien er ikke kun nyttig for andre (Poaceae) arter, men også for andre plantearter såsom A. thaliana, og for en endophytic svamp dvs. Piriformospora indica.

Gyldigheden af den designede specifikke primer (ITS1) blev også bekræftet af qPCR i A. littoralis bruger gDNA som skabelon. En enkelt peak med ingen primer-dimer dannelse blev observeret. Overraskende, A. littoralis ITS1 primer (som den specifikke primer) genereret en enkelt skarp band, ikke kun i A. littoralis, men også for alle andre arter, testet bortset fra Nicotiana tabacum og Trifolium alexandrinum, der produceres to bands (figur 6 c). GDNA forurening analyse blev udført af enten ITS eller ITS-flankerende primere i alle RNA prøver. En skematisk gengivelse af forstærkning plade i gDNA forurening analysen og fortolkningen af resultaterne er præsenteret i figur 7.

Figure 1
Figur 1: Den generelle mønster af eukaryote rDNA sekvens organisation.
Det eukaryote rDNA segment indeholder 17-18S (rød), 5.8S (blå) og 25-28S rRNA (lyserød). De interne transskriberede afstandsstykker (ITS) er angivet som sorte streger. 5´and 3´ angiver retningen af DNA-molekylet. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: arbejdsgang for en RT-qPCR og gDNA forurening assay. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: motiv logo af A. SSU, B. 5.8S og C. LSU primer homologi. For SSU, 5.8S, og LSU primere, motiv logo blev bygget af BLASTn baseret på 2.000 grøn plante poster (NCBI taxid nummer: 33090) med en cut-off e-værdi ≤10-10. A-adenin, T-thymin, G-guanin, C-cytosin. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: Den smelte kurve analyse af ledsageprogrammer på ITS1 amplikon i forskellige arter.
Denne amplikon, forstærket af SSU og 5.8S-R primere, indeholder en del af sekvensen fra regionen 17-18S kodning, hele sekvensen af ITS1 og delsekvens af 5.8S. Vist er de smeltende kurver af amplikoner genereret (pink) og NTC (rød) fra Triticum aestivum, Hordeum vulgare, Oryza sativa, Medicago truncatula, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, Vicia faba, Arabidopsis thaliana, og Piriformospora indica. Den flade fed linje angiver tærsklen baseline. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: Den smelte kurve analyse af ledsageprogrammer på ITS2 amplikon i forskellige arter.
Denne amplikon genereres ved hjælp af 5.8S-F og LSU primere. Den beskrevne amplikon indeholder sekvenser af del af 5.8 S, hele sekvensen af ITS2 og delsekvens af 25-28S. Vist er de smeltende kurver af amplikoner (grøn) og NTC (rød) genereret fra Triticum aestivum, Hordeum vulgare, Oryza sativa, Medicago truncatula, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, Vicia faba, Arabidopsis thaliana og Piriformospora indica. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6: Agarosen gel analyse af rDNA-baserede PCR produkt.
Amplikon af ITS1-flanker (A), ITS2-flanker (B), og ITS1 (C) blev kørt på 3% agarosegel. Venligst klik her for at se en større version af dette tal.

Figure 7
Figur 7: Intron-lignende funktioner af ITSs kan anses for at designe primere, som kan afsløre gDNA forurening.
Enhver peak eller bandet med den forventede størrelse i qPCR analyse viser gDNA forurening i eksemplet RNA. UNK: ukendt prøve, pos: positiv kontrol, NTC: ikke-skabelon kontrol. Venligst klik her for at se en større version af dette tal.

Primer Slægten Taxid-ID Arter Divergerende primer
SSU Arabidopsis 3701 kamchatica, thaliana og lyrata -
Vicia 3904 villosa, americana, unijuga, amoenane, amurensis, craccamal, pseudo-orobus, multicaulis, japonica, ramuliflora og faba
Trifolium 3898 alexandrinum, montanum, resupinatum og repens -
Nicotiana 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, glutinosa, noctiflora, petunioides, obtusifolia, miersii, pauciflora, dæmpe, acuminata, linearis, alata, sylvestris, rustica og suaveolens -
Agurk 3655 anguria, melo og sativus CGTAACAAGGTTTCCGTAGGKG
Aeluropus 110873 - Ingen primer fundet
Medicago 3877 sativa, Sneglebælg, pamphylica, lunata, rostrate, plicata og truncatula -
Oryza 4597 sativa, glumipatula, rufipogon barthii glaberrima punktformet, longistaminata, meridionalis, nivara, meridionalis og longistaminata -
Triticum 4564 aestivum, urartu og monococcum -
Hordeum 4512 vulgare, bulbosum, marinum, brevisubulatum og bogdanii -
LSU Arabidopsis 3701 Petraea, thaliana og lyrata TGCTTAAACTCAGCGGGTAATC
Vicia 3904 bøg, tetrasperma, sativa, haaret, sepium, parviflora, cracca, lathyroides, orobus, orobus, bithynica og faba TGCTTAAATTCAGCGGGTAGCC
Trifolium 3898 forstillelse, nigrescens, resupinatum, occidentale, subterraneum, strictum, ochroleucon, glomeratum, squamosum, ornithopodioides og repens TGCTTAAATTCAGCGGGTAGCC
Nicotiana 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, glutinosa, noctiflora, petunioides, obtusifolia, miersii, pauciflora, dæmpe, acuminata, linearis, alata, sylvestris og suaveolens TGCTTAAACTCAGCGGGTAGTC
Agurk 3655 Melo, ritchiei og javanica TGCTTAAACTCAGCGGGTAGTC
Aeluropus 110873 lagopoide, pungens og littoralis TGCTTAAATTCAGCGGGTAATC
Medicago 3877 ruthenica, sativa, Sneglebælg, arabica, levermos og minima TGCTTAAATTCAGCGGGTAGCC
pamphylica, lunata, rostrate og plicata TGCTTAAACTCAGCGGGTAGTC
Oryza 4597 sativa, glumipatula, rufipogon, barthiial, glaberrima, australiensis, officinalis, australiensis, ridleyi, malampuzhaensis, alta, nivara, rufipogon, meridionalis og longistaminata TGCTTAAACTCAGCGGGTAGTC
Triticum 4564 aestivum, spelta, turgidum, dicoccoides, petropavlovskyi, urartu og monococcum TGCTTAAACTCAGCGGGTAGTC
Hordeum 4512 vulgare, bulbosum, murinum, secalinum, brevisubulatum og bogdanii TGCTTAAACTCAGCGGGTAGTC
En degenereret primer er defineret som IUPAC system til nukleotid nomenklatur

Tabel 1: Liste over arter anses for picking rDNA-baserede primere.
SSU bindingssted i forhold til LSU bindingssted viste højere sekvens homologi givet slægten.

Amplikon længde Forstærkning område Sekvens Primer navn Amplikon
332 - 405 bp Delsekvens af SSU, hele sekvensen af ITS1 og delsekvens af 5.8S CGTAACAAGGTTTCCGTAGGTG SSU ITS1-flanker
GGTTCACGGGATTCTGCAAT 5.8S-RASMUSSEN
318 - 361 bp Delsekvens af 5.8S, hele sekvensen af ITS2 og delsekvens af LSU ATTGCAGAATCCCGTGAACC 5.8S-F ITS2-flanker
TGCTTAAAYTCAGCGGGTAGYC LSU
100 - 200 bp ITS1 GGTATGGCGTCAAGGAACACT ITS1-F ITS1
ATAGCATCGCTGCAAGAGGT ITS1-R

Tabel 2: Primer sekvenser.

Discussion

Gen expression analyse af kvantitativ PCR har været udbredt i de seneste år. Den største fordel ved denne hurtige, omkostningseffektive og automatiseret metode er dens præcise og nøjagtige resultat. At opnå optimal fordele fra disse fordele kræver imidlertid en klar forståelse af opsætningen af de parametre, der bruges til qPCR eksperiment. For at modtage et pålideligt resultat i qPCR gen expression analyse, er det nødvendigt at undgå de uspecifikke forstærkning, der udspringer af primer-dimer eller gDNA forurening i RNA prøve3,15. Det forventes, at RNA udskrift niveauer vil være overvurdere under gDNA forurening8. Her, de unikke kendetegn ved et rDNA-gen blev anset for en gDNA forurening assay i RNA prøver.

Grundlæggende egenskaber af rDNA bruges i denne protokol: Ribosomale gener består af de to ITSs, nemlig ITS1 og ITS2, og de tre rRNA kodning gener, 17-18S, 5.8S og 25-28S subunit12. De to ITS regioner indgår ikke i den kodende sekvens af de ribosomale underenheder. De er fjernet ved mindst tre enzymaktiviteter at behandle forløber for at modne rRNA: en endonuklease, helicase og exonuclease aktivitet. Som ribosomale RNA er transkriberet som en polycistronic udskrift, er et primærprodukt, der indeholder ITSs bestemt til stede. Behandlingen er meget hurtig og finder sted i nucleolus, og mængden af påviselige forløber molekyler, der indeholder ITS er under detektionsgrænsen for metoden qPCR. Derfor, når ITS1 eller ITS2 forstærkes af ITS flankerende primere, ingen forstærkning kan påvises i RNA prøver medmindre gDNA forurening er til stede. Antallet af rDNA gener i genomet af Eukaryote organismer blev anslået til at omfatte op til 1.000 eksemplarer, som er arrangeret i enkelt eller tandem arrays på på kromosomer11. I denne protokol foreslår vi en alternativ måde i stedet for NRT, at opdage gDNA forurening, som bruges i hver reaktion/assay.

Fordele og begrænsninger med hensyn til eksisterende metoder: NRT bruges typisk til at teste, om eksemplet rede RNA er ren eller forurenet af gDNA. Da gDNA forurening ikke er fordelt jævnt mellem forskellige RNA prøver, og reaktionen følsomhed over for gDNA påvirket væsentligt af de gener, der er analyseret, er NRT kontrol påkrævet for hver prøve/assay par7,15. Derved føjes væsentligt omkostninger og arbejdskraft ved håndtering af mange prøver samtidig3,9. Andre alternative metoder er dokumenteret i litteraturen omfatter anvendelse af intron specifikke primere til påvisning af gDNA eller designe primere, der enten flankere en intron eller spænder over en exon-exon junction. Begrænsninger af disse metoder stammer fra utilgængelighed intron sekvens oplysninger, ufuldstændige anmærkning af intron/exon struktur og fravær af introns i gener eller pseudogenes af interesse1,4,10 . På grund af udviklingen eksisterer rDNA gener som multigene og yderst velbevarede gen familier. De er meget rigelige i genomet og forekommer på forskellige kromosomer13. Sammenlignet med andre kodning eller nonconding gener, vise rDNA gener den bedste pasform til påvisning af gDNA forurening. I sammenlignende transkriptom analyser, normalisering af qPCR data af rRNA kalibrator anbefales ikke for nogle emner, som forskelle i cDNA forberedelse (polyA priming vs tilfældige hexamer grunding), store forskelle i overflod rRNA og mRNA , og forskellige Biogenese, som genererer vildledende resultater10,16. Men de problemer, vi har netop nævnt er en fordel for gDNA forurening assay. For eksempel med hensyn til højere målretning site overflod i genom og lokalisering på forskellige kromosomer forbedre rDNA-baserede primere væsentligt afsløring følsomhed gDNA i forhold til eksisterende metoder.

Versality af rDNA-baserede til andre organismer: rDNA gener er velundersøgte gen familie identificeret i de fleste organismer. Den foreslåede rDNA-baseret metode repræsenterer et enkelt, meget følsomme og økonomiske system for gDNA forurening assays, der nemt kan tilpasses andre eukaryote og prokaryote organismer (protokol 2 - 5). Som Case, har vi vist her nytten af denne metode i nogle Poceae arter (figur 4 og figur 5). De benyttede primere viser en høj Overførbarhed til andre Poceae arter på grund af den yderst velbevarede struktur af rDNA underenheder blandt arter. Problemet bliver endnu mere vigtigt, når tilstrækkelige genomisk sekvens oplysninger ikke er tilgængelige for primer design. ITS-flankerende primere designet til én art kan således bruges i en beslægtede arter. Også, 5.8S-F/R primere blev plukket baseret på en bevaret motiv, der viser stor lighed i de fleste blomstrende planter14. Selvom høj overførselshastighed sekventering teknikker permanent øger antallet af kendte genomer, exon-intron anmærkning af de fleste organismer er ikke afsluttet, og så er det ofte ikke muligt at designe primere til at spænde en exon-exon grænse. Vores metode forklarer hvordan rDNA-baserede primere kan anvendes til gDNA forurening assay i qPCR analyse af prokaryoter og eukaryoter med henblik på at eliminere dyre NRT kontrol i hvert assay/primer kombination.

Disclosures

Forfatterne har ingen konkurrerende finansielle interesser.

Acknowledgments

Denne forskning blev støttet af den genetiske og landbrugs bioteknologi Institute af Tabarestan (GABIT), Sari Jordbrugsforskning og naturressourcer Universitet (SANRU). Forskningsgruppen for junior abiotisk Stress genomforskning blev finansieret af IZN (tværfagligt center for afgrøde planteforskning, Halle (Saale), Tyskland. Vi takker Rhonda Meyer for kritisk læsning af manuskriptet.

Materials

Name Company Catalog Number Comments
Maxima SYBR Green / ROX qPCR Master Mix (2X) Thermo Scientific K0221
TissueLyser II QIAGEN 85300
RevertAid H Minus First Strand cDNA Synthesis Kit Thermo Scientific K1631
GeneRuler 100 bp Plus DNA Ladder Thermo Scientific SM0321
96 well WHT/CLR Bio-Rad HSP9601
Microseal B film Bio-Rad MJ-0558
Low tube strip CLR Bio-Rad TLS0801
Flat cap strips Bio-Rad TCS0803
NanoDrop 2000 Peqlab ND-2000
RNaseZAP Ambion 9780
Centrifuge Eppendorf 5810 R
Agilent RNA 6000 Nano Kit Agilent Technologies 5067-1511
2100 Electrophoresis Bioanalyzer Agilent Technologies G2939AA
RNase A, DNase and Protease-free Thermo Scientific EN0531
DNase I, RNase-free Thermo Scientific EN0523
TRIZOL Reagent Ambion 15596026
CFX96 Touch Real-Time PCR Detection System BIO RAD 1855195
PCR tube, 0.2 mL, RNase-free Stratagene Z376426
Guanidine thiocyanate for molecular biology Sigma-Aldrich G9277
Agarose - Nucleic Acid Electrophoresis Sigma-Aldrich A9414
Boric Acid for molecular biology AppliChem A2940
bromophenol blue AppliChem A2331
ethidium bromide AppliChem A1151
Gel documentation system BIO RAD Gel Doc 2000

DOWNLOAD MATERIALS LIST

References

  1. Bustin, S. A., Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J Biomol Tech. 15, (3), 155-166 (2004).
  2. Gutierrez, L., Mauriat, M., Pelloux, J., Bellini, C., Van Wuytswinkel, O. Towards a systematic validation of references in real-time RT-PCR. Plant Cell. 20, (7), 1734-1735 (2008).
  3. Hashemi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Identification and validation of Aeluropus littoralis reference genes for Quantitative Real-Time PCR Normalization. J Biol Res (Thessalon). 23, (1), 18 (2016).
  4. Bustin, S. A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, (2), 169-193 (2000).
  5. Andersen, C. L., Jensen, J. L., Orntoft, T. F. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, (15), 5245-5250 (2004).
  6. Bustin, S. A., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55, (4), 611-622 (2009).
  7. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, (7), e51 (2012).
  8. Galiveti, C. R., Rozhdestvensky, T. S., Brosius, J., Lehrach, H., Konthur, Z. Application of housekeeping npcRNAs for quantitative expression analysis of human transcriptome by real-time PCR. RNA. 16, (2), 450-461 (2010).
  9. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, e51 (2012).
  10. Caldana, C., Scheible, W. R., Mueller-Roeber, B., Ruzicic, S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 3, (1), 7 (2007).
  11. Lawrence, R. J., Pikaard, C. S. Perspectives Chromatin Turn Ons and Turn Offs of Ribosomal RNA Genes. Cell Cycle. 3, (7), 880 (2004).
  12. Boisvert, F. M., van Koningsbruggen, S., Navascues, J., Lamond, A. I. The multifunctional nucleolus. Nat Rev Mol Cell Biol. 8, (7), 574-585 (2007).
  13. Alvarez, I., Wendel, J. F. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 29, (3), 417-434 (2003).
  14. Jobes, D. V., Thien, L. B. A conserved motif in the 5.8 S ribosomal RNA (rRNA) gene is a useful diagnostic marker for plant internal transcribed spacer (ITS) sequences. Plant Mol Biol Report. 15, (4), 326-334 (1997).
  15. Padhi, B. K., Singh, M., Huang, N., Pelletier, G. A PCR-based approach to assess genomic DNA contamination in RNA: Application to rat RNA samples. Anal Biochem. 494, 49-51 (2016).
  16. Dheda, K., et al. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 37, (1), 112-114 (2004).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics