Генерация генетически модифицированных мышей посредством микроинъекции ооцитов

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Микроинъекция ооцитов мыши обычно используется как для классического трансгенеза ( т. Е. Для случайной интеграции трансгенов), так и для CRISPR-опосредованного гена. В этом протоколе рассматриваются последние разработки в области микроинъекции с особым акцентом на стратегии контроля качества и генотипирования.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Delerue, F., Ittner, L. M. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J. Vis. Exp. (124), e55765, doi:10.3791/55765 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Использование генетически модифицированных мышей значительно способствовало исследованиям как физиологических, так и патологических процессов in vivo . Пронуклеарная инъекция конструкций экспрессии ДНК в оплодотворенные ооциты остается наиболее часто используемым методом для генерации трансгенных мышей для сверхэкспрессии. С внедрением технологии CRISPR для нацеливания генов пронуклеарная инъекция в оплодотворенные ооциты была распространена на генерацию мышей с нокаутом и нокаутом. В этой работе описывается подготовка ДНК для инъекций и подготовка руководств CRISPR для ориентации генов с особым акцентом на контроль качества. Процедуры генотипирования, необходимые для идентификации потенциальных основателей, имеют решающее значение. Здесь представлены инновационные стратегии генотипирования, которые используют преимущества «мультиплексирования» CRISPR. Также описаны хирургические процедуры. Вместе этапы протокола позволят генерировать генерациюЭтически модифицированных мышей и для последующего создания колоний мыши для множества областей исследований, включая иммунологию, нейронауку, рак, физиологию, развитие и другие.

Introduction

Модели животных, как у позвоночных, так и у беспозвоночных, сыграли важную роль в изучении патофизиологии состояний человека, таких как болезнь Альцгеймера 1 , 2 . Они также являются бесценными инструментами для поиска модификаторов болезни и в конечном итоге разрабатывают новые стратегии лечения в надежде на лечение. Хотя каждая модель имеет внутренние ограничения, использование животных как целых системных моделей жизненно важно для биомедицинских исследований. Это связано с тем, что метаболическая и сложная физиологическая среда не может быть полностью смоделирована в культуре тканей.

На сегодняшний день мышь остается наиболее распространенным видом млекопитающих, используемым для генетической манипуляции, поскольку она имеет несколько преимуществ. Физиологические процессы и гены, связанные с заболеваниями, очень сохраняются между мышами и людьми. Мышь была первым млекопитающим, имеющим полный геном, секвенированный (2002), за год до генома человекаМеня (2003). Помимо этого богатства генетической информации мышь обладает хорошей способностью к размножению, быстрым циклом развития (6 недель от оплодотворения до отлучения) и разумным размером. Все эти преимущества в сочетании с физиологическими показателями, такими как различные цвета пальто (необходимые для перекрестных стратегий), сделали мышь привлекательной моделью для генетических манипуляций. Примечательно, что в самом раннем возрасте современной генетики Грегор Мендель начал работать над мышами, прежде чем переходить на растения 3 .

Методы переноса гена привели к генерации первой трансгенной мыши в течение трех десятилетий назад 4 , первоначально созданной с использованием вирусной доставки. Однако вскоре исследователи поняли, что одной из основных проблем трансгенеза мыши является невозможность контролировать судьбу экзогенной ДНК. Поскольку вирусная доставка трансгенов в ооциты мыши приводила к множественным копиям, случайным образом интегрированным в геном, возможноY установления последующих трансгенных линий было ограничено.

Одно из таких ограничений было преодолено, когда Гордон и др. Генерировали первую трансгенную линию мыши путем микроинъекции 5 , 6 . Это начало эры технологии рекомбинантной ДНК, и параметры, влияющие на результат сеанса микроинъекции, были широко изучены 7 . Хотя микроинъекция не позволяет контролировать сайт интеграции трансгена (что в конечном итоге приводит к определенным уровням экспрессии для каждой мыши-основателя), основным преимуществом пронуклеарного микроинъекции остается образование конкатемеров ( т. Е. Массивов множественных копий трансгена, Связанные последовательно) до геномной интеграции 5 . Эта характеристика использовалась на протяжении многих лет, чтобы установить тысячи трансгенных линий мыши, которые сверхэкспрессируют ген, представляющий интерес. С тех пор трансгенезис, aRtificial модификация генома организма, широко используется для определения роли одиночных генов в возникновении заболеваний.

Еще одно ключевое достижение в манипуляции с геномом мыши было достигнуто, когда Марио Капечи успешно разрушил один ген мыши, открыв эру нацеливания гена 8 . Тем не менее, основные недостатки быстро возникали из нацеленного на ЭС клеточного гена, включая проблемы культивирования ES-клеток, несколько изменчивую степень химеризма и длину процесса ( т. Е. 12-18 месяцев, минимум, чтобы получить мышь) ,

Недавно появились новые технологии, такие как инженерные эндонуклеазы ( например, нуклеазы цинковых пальцев (ZFN), активатор-подобные эффекторные нуклеазы транскрипции (TALEN) и кластеризованные регулярно промежуточные короткие палиндромные повторы (CRISPR / Cas9)), как альтернативные методы Ускорить процесс нацеливания генов в микрофонE 9 , 10 . Эти эндонуклеазы могут быть легко введены в ооциты мыши путем микроинъекции, что позволяет генерировать ген-целевых мышей всего за 6 недель.

Начиная с первого отчета об использовании CRISPR для редактирования генома 11 , эта бактериальная адаптивная иммунная система заменила ZFN и TALEN из-за ее многочисленных преимуществ, в том числе легкости синтеза и способности сразу нацеливать несколько локусов (называемых «мультиплексированием» «). CRISPR был впервые использован для нацеливания генов у мышей 12 и с тех пор применяется к бесчисленным видам, от растений до людей 13 , 14 . На сегодняшний день нет отчета об одном виде, устойчивом к редактированию генома CRISPR.

Двумя основными предельными стадиями генерации трансгенных мышей являются инъекция ооцитов и реимплантацияИз этих ооцитов в псевдо-беременных женщин. Хотя эта методика была описана нами 15 и другими 16 , последние технические усовершенствования эмбриологии мыши и методов переноса генов коренным образом изменили процесс генерации генетически модифицированных мышей. Эти улучшения будут описаны здесь.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все процедуры были одобрены Комитетом по уходу за животными и этикой Университета Нового Южного Уэльса.

1. Получение трансгена (случайная интеграция)

  1. Аналитический агарозный гель-электрофорез.
    1. Дайджест плазмиды для извлечения трансгена с использованием соответствующих ферментов (инкубация 1 ч) или ферментов с быстрым перевариванием (инкубация с 15-30 мин) в термоциклере в соответствии с рекомендациями производителя (см . Рисунок 2А и его легенда).
    2. Вливают 1% агарозный гель трис-ацетат-этилендиаминтетрауксусной кислоты (ЭДТА) (ТЭА), окрашенный 0,5-1,0 мкг / мл этидиябромида (EtBr).
      ПРИМЕЧАНИЕ. Соблюдайте осторожность при использовании EtBr; Это мощный мутаген. Используйте соответствующие средства индивидуальной защиты (см. Паспорт безопасности материала).
    3. Загрузите маркер молекулярной массы 1 kb.
    4. Загрузите линеаризованные фрагменты ( т. Е. Трансген и позвоночник). Проведите электрофорез при 100 В в течение 45 мин.
    5. Визуализируйте гель на ультрафиолетовом (УФ) трансиллюминаторе, чтобы проверить, что пищеварение завершено, и чтобы подтвердить правильный размер трансгена ( т. Е. 7,338 б.п., см . Рисунок 2А ).
  2. Препаративный агарозный гель-электрофорез.
    1. Лить 1% -ного агарозного геля TAE, окрашенного пятном с низкой токсичностью геля. Загружайте 8 аликвот (по 1 мкг каждый) линеаризованного трансгена без маркера молекулярного веса и проводите электрофорез при 100 В в течение 45 мин. Используйте скальпель для резки всех 8 полос, соответствующих линеаризованному трансгену.
    2. Извлеките ДНК, используя комплект для экстракции геля, следуя рекомендациям производителя (см. Таблицу материалов ).
      1. Растопить гель-фрагменты при 50 ° С в 1,5-мл пробирках в течение не менее 15 мин. Осадить его изопропанолом и затем добавить буфер связывания.
      2. Объедините весь DNA, пипетируя все это в одну колонку. Элюат в буфер для микроинъекции без нуклеазы (8 мМ Трис-HCl и 0,15 мМ ЭДТА). Фильтруют через микроцентрифужный фильтр 0,22 мкм и центрифугируют в течение 60 с при 12000 х г.
    3. Измерьте концентрацию и качество ДНК с помощью спектрофотометра. Убедитесь , что соотношение A260 / A280 составляет около 1,8 ( т. Е. Никакого загрязнения белками), а соотношение A260 / A230 составляет не менее 2,0 ( т.е. отсутствие загрязнения органическими растворителями). Разбавьте до 3 нг / мкл в беснуклеазном микроинъекционном буфере, аликвоте (20-50 мкл) и замораживайте при -20 ° C.

2. Синтез компонентов CRISPR (нацеливание генов)

  1. Cas9 мРНК.
    1. Разбавьте мРНК Cas9 (полученную из коммерческого источника, см. Таблицу материалов ) до концентрации 1 мкг / мкл в беснуклеазном микроинъекционном буфере.
    2. Аликвоту в 2 мкл и свободный Ze при -80 ° C.
  2. Однонаправленная РНК (SgRNA).
    1. Определите желаемые геномные последовательности (направляющие) с двумя мишенями, используя вычислительный инструмент проектирования, позволяющий минимальную потенциальную неактивную активность 17 .
      1. Для нокаута гена систематически выбирают два направляющих, расположенных в несколько сотен пар оснований (bp) в противоположных направлениях и включают в себя начальный кодон представляющего интерес гена. Для прямого ремонта гомологии выберите две наложенные направляющие (по возможности) в противоположных направлениях.
        ПРИМЕЧАНИЕ. В качестве примера, недавно были успешно совместно введены следующие руководства для разрушения первого экзона гена TPM4.2 :
        Руководство 1: 5 «CGCCATCCAGTTCGCGCTGC 3»;
        Руководство 2: 5 'CAGAACGATTGAGCTATGGC 3'
    2. Закажите набор праймеров, как описано в таблице 1 .
    3. Синтезируйте линейный шаблон ДНК.
      1. Разбавьте px330Ref "> 12 плазмиды до 10 нг / мкл в воде, свободной от нуклеазы.
      2. Подготовьте мастер-микс, как показано в таблице 1 . Добавьте полимеразу в конце и держите смеситель на льду.
      3. Смешайте и разделите его на 8 ПЦР-пробирок (19 мкл / пробирка). Добавьте 1 мкл px330 на пробирку и запустите ПЦР в следующих условиях: 1 мин при 98 ° C; 40 циклов 98 ° С в течение 10 с, 64 ° С в течение 30 с и 72 ° С в течение 15 с; И конечное удлинение при 72 ° С в течение 5 мин. Держите при 4 ° C.
      4. Очистите продукты ПЦР с помощью набора для очистки ПЦР (см. Таблицу материалов ), коллектора и источника вакуума (для более быстрой обработки). Примените максимальную силу вакуума ( т. Е. 8 мбар).
        1. Добавьте 5 объемов (100 мкл) связывающего буфера в 1 объем образца ПЦР и смесь.
        2. Поместите (предоставленную) спин-колонку из кремнеземной мембраны в (поставляемую) 2-мл коллекционную трубку для центрифугирования или на коллекторе для вакуумного процессаING. Для связывания ДНК последовательно применяют все 8 образцов к колонке и вакуум или центрифугу в течение 60 с при 12000 мкг для каждой нагрузки.
        3. Для промывки добавляют 0,75 мл промывочного буфера (буфер PE) в колонку и вакуум или центрифугируют в течение 60 с при 12000 × g. Центрифугируйте колонку в течение 60 с при 12000 xg для удаления остаточного этанола.
        4. Поместите колонку в чистую микроцентрифужную пробирку объемом 1,5 мл. Чтобы элюировать ДНК, добавьте 30 мкл воды без нуклеазы в центр мембраны, дайте колонке на 1 минуту и ​​центрифугируйте в течение 60 с при 12000 г.
      5. Измерьте концентрацию с помощью спектрофотометра; Обычно концентрация должна составлять 100 нг / мкл или выше. Убедитесь , что соотношение A260 / A280 составляет около 1,8 ( т. Е. Никакого загрязнения белками), а соотношение A260 / A230 составляет не менее 2,0 ( т.е. отсутствие загрязнения органическими растворителями).
    4. Транскрипция in vitro с использованием набора для синтеза РНК Т7.
      1. Подготовьте tОн, как указано в таблице 1 , инкубируют в течение 3 ч при 37 ° С в термоциклере. Добавить 28 мкл свободной от нуклеазы воды и 2 мкл ДНКазы I и инкубировать еще 15 мин при 37 ° С в термоциклере.
    5. Очистка РНК с использованием спиновых колонок.
      1. Растворите порошок, содержащийся в предоставленной спиновой колонке, в 650 мкл буфера для микроинъекции без нуклеазы, тщательно удалив все пузырьки воздуха. Закройте трубку и гидратируйте в течение 5-15 мин при комнатной температуре.
      2. Снимите синюю крышку снизу и поместите колонку в пробирку объемом 2 мл. Центрифуга в течение 2 мин при 750 xg и комнатной температуре. Поместите колонку в свежую пробирку объемом 1,5 мл и по каплям поместите 50 мкл раствора РНК в центр, не касаясь стенки колонны. Вращайте колонку в течение 2 мин при 750 х g.
      3. Измерьте концентрацию РНК с помощью спектрофотометра (типичный выход одной реакции составляет 30-50 мкг). Убедитесь, что коэффициент A260 / A280 равенКруглый 2.0 ( т.е. отсутствие загрязнения белками), а соотношение A260 / A230 составляет не менее 2,0 ( т.е. отсутствие загрязнения органическими растворителями). Храните sgRNAs при -80 ° C до использования.
      4. Оцените качество РНК с использованием 1% TAE гелей, обычно используемых для электрофореза ДНК. Проведите 200-400 нг ДНК-матрицы и соответствующей sgRNA параллельно. Полоса РНК (≈ 100 б.п.) должна быть немного больше, чем полоса ДНК (см . Рис. 3А ).

3. Шаблон донора

  1. Заказать коммерчески синтезированные одноцепочечные олигонуклеотиды (ssOligos, см. Таблицу материалов ) для точечных мутаций или для интеграции небольших последовательностей до 50 bp; Гомологическое оружие обычно составляет 60-90 б.п.
  2. Для больших вставок используйте донорскую плазмиду в качестве шаблона. Генерируют подходящую плазмиду, используя либо классический метод клонирования, либо синтез de novo изКоммерческий источник.
    ПРИМЕЧАНИЕ. Рекомендуется минимум 800 б.п. на руку для гомологии. Размер позвоночника не влияет на эффективность прямого ремонта гомологии (HDR).

4. Инжекционный микс

  1. Разбавьте мРНК Cas9 до 50 нг / мкл и sgRNAs до 12,5 нг / мкл (всего 25 нг / мкл) с использованием буфера для микроинъекции без нуклеазы для экспериментов с нокаутом генов. Добавьте донорскую матрицу (ssOligo или плазмиду) в концентрации 200 нг / мкл для экспериментов по редактированию генома, основанных на прямом восстановлении гомологии.
    ПРИМЕЧАНИЕ. Объемы разбавления можно легко определить с помощью онлайн-инструментов, таких как калькулятор 18 ресуспендирования.
  2. Держите каждую аликвоту на льду во время сеанса микроинъекции и отбросьте потом (не повторно замораживайте инъекционный микс).

5. Скротальная вазэктомия

ПРИМЕЧАНИЕ. Два типа вазэктомии обычно выполняются у мышей: брюшной полости и мошонки. ПоследнийМенее инвазивна и ранее была описана 15 .

  1. Автоклавируйте все хирургические инструменты из нержавеющей стали.
  2. Определите вес мыши с помощью весовой шкалы и обезболивайте самцов путем внутрибрюшинной инъекции инъекционных анестетиков (кетамин 100 мг / кг, ксилазин 10 мг / кг).
  3. Контролируйте потерю рефлекса пальца и после того, как мышь успокоилась, положите его поверх нагревательной подушки.
  4. Дезинфицируйте кожу вокруг яичек чередующимися салфетками местного антисептика, такого как хлоргексидин и 70% этанол.
  5. Вставьте семенники в мошонку и сделайте разрез кожи с помощью скальпеля.
  6. Визуализируйте яички, cauda epididymis и vas deferens.
  7. Возьмите семявыносящий проток с помощью щипцов, держите его и прижигайте с каждой стороны щипцов, чтобы удалить 3 мм семявыносящего протока.
  8. Выполните ту же процедуру на втором семеннике.
  9. Закройте разрезы кожи с помощью зажимов для раны иМышь близко до полного восстановления.

6. Суперовуляция (доноры ооцитов) и время-спаривание (Псевдо-беременные самки)

ПРИМЕЧАНИЕ. Методика получения подходящего количества оплодотворенных ооцитов и закупоренных приемных самок для реимплантации была описана в другом месте 15 .

  1. Внесите 10 самок ip с 5 МЕ сывороточного гонадотропина беременной кобылы (PMSG, в 100 мкл) примерно в 12 часов дня 1-го дня.
  2. Внесите самки ip с 5 МЕ хорионического гонадотропина человека (hCG, в 100 мкл) через 46-48 часов (примерно в 11 часов утра в день 3).
  3. Немедленно спасите самок с одиночными мужчинами в одночасье.

7. Проядерная (случайная интеграция) и цитоплазматическая (ген-нацеливающая) инъекция

  1. Вычистите суперовеллированных мышей шейным дислокацией, выставите живот и получите доступ к яичникам и яйцеводам, как описано ранее 15 . Рассеивать oViducts и собирать кумулюс-ооцит-комплексы (COC) под стереомикроскоп 15 . Поместите их в каплю среды для оптимизации симптом калия, дополненной аминокислотами (KSOMaa), следуя традиционному методу 15 .
  2. Очистите ооциты, добавив приблизительно 1 мкл гиалуронидазы (10 мг / мл) к капле среды KSOMaa, используя кусочек устья аспиратора, и поместите блюдо в инкубатор 37 ° C / 5% CO 2 в течение 30 с - 1 мин.
  3. Вымойте ооциты 4 свежими каплями среды KSOMaa, используя кусочек рта аспиратора, и перенесите их до конечной капли среды KSOMaa, покрытой минеральным маслом (около 2 мл). Поместите блюдо в инкубатор 37 ° C / 5% CO 2 до тех пор, пока ооциты не будут готовы к инъекции.
  4. Ядерная инъекция (случайная интеграция).
    1. Визуализируйте яйца под стереоскопическим микроскопом и перенесите приблизительно 50 яиц в камеру инъекции (a droP среды M2, наложенной на минеральное масло) с использованием части устья аспиратора.
    2. Перенесите инъекционную камеру в инвертированный микроскоп и добавьте оплодотворенные ооциты (две видимые пронуклеусы) несколькими пиколитрами инъекционной смеси, нацеливаясь на пронуклеус (любой из пронуклеусов может быть нацелен). Визуализируйте успешную инъекцию, наблюдая набухание пронуклеуса.
  5. Цитоплазматическая инъекция (нацеливание генов).
    1. Перенесите приблизительно 50 яиц в каплю KSOMaa, содержащей 5 мкг / мл цитохалазина В, с использованием части рта и инкубируйте в течение 5 мин в инкубаторе 37 ° C / 5% CO 2 .
    2. Перенесите яйца в камеру для инъекций с помощью рта.
    3. Внесите несколько пиколитров инъекционной смеси в цитоплазму при очень низком давлении (50-100 гПа), используя, по возможности, компенсационное давление автоматизированного микроинъектора.
    4. После инъекции переносите ооциты обратно в каплю KSOMaa (используя кусочек рта) и удерживайте их в инкубаторе 37 ° C / 5% CO 2 , пока он не будет загружен для реимплантации в яйцевод с псевдо-беременными самками.

8. Реимплантация

  1. Автоклавируйте все хирургические инструменты из нержавеющей стали.
  2. Определите вес мыши с помощью весовой шкалы и обезболивайте самки путем внутрибрюшинной инъекции (инъекции) инъекционными анестетиками (кетамин 100 мг / кг, ксилазин 10 мг / кг).
  3. Контролируйте потерю рефлекса пальца и после того, как мышь успокоилась, положите его поверх нагревательной подушки.
  4. Закрепите большую область меха вокруг спинной срединной линии женской мыши.
  5. Дезинфицируйте обнаженную кожу чередующимися салфетками местного антисептика, такого как хлоргексидин и 70% этанол.
  6. Выставить репродуктивный тракт по традиционному методу 15 . Сделайте разрез кожи длиной 1 см параллельно спинной срединной линии, отрежьте мышцу и возьмите жироуловитель wiПинцет, затем осторожно вытащите завязь, пока ее прикрепленный яйцевод и матка не будут хорошо видны.
  7. Закрепите жироуловитель с помощью хомута. Визуализируйте яйцевод в стереоскопическом микроскопе и используя пару микро-ножниц, сделайте надрез в стенке яйцевода на несколько миллиметров выше по течению от ампулы.
  8. Под стереоскопическим микроскопом загрузите 25 микроинъекционных яиц в стеклянный капилляр, соединенный с частью рта (внутренний диаметр капилляра должен быть около 120 мкм). Вставьте стеклянный капилляр в яйцевод и выпустите, пока в ампуле не появится воздушный пузырь.
  9. Осторожно удалите стеклянный капилляр и поместите репродуктивный тракт обратно в живот. Швы нарезать с помощью 3-0 неабсорбируемых хирургических швов, затем закрыть зажимы для раны. Контролируйте мышь близко до полного восстановления.

9. Стратегии генотипирования / секвенирование

ПРИМЕЧАНИЕ. Изолируйте геномнуюДНК из 2-мм хвостовых или ушных биопсий, следуя соответствующим правилам этики животных.

  1. Быстрая геномная экстракция ДНК (случайная интеграция).
    1. Lyse образцы тканей (~ 2 мм) при 95 ° C в течение 1 часа в 100 мкл щелочного лизисного реагента (25 мМ гидроксида натрия и 0,2 мМ ЭДТА, pH = 12).
    2. Добавить 100 мкл нейтрализующего реагента (40 мМ Трис-HCl, pH = 5).
    3. Центрифугируют в течение 5 мин при 12000 г и 4 ° С.
  2. Высококачественная экстракция геномной ДНК (нацеливание генов).
    1. Добавить 500 мкл хвостового буфера (50 мМ Трис, рН = 8, 100 мМ ЭДТА, pH = 8, 100 мМ NaCl, 1% SDS и 0,5 мг / мл протеиназы K, свежеприготовленный).
    2. Инкубируйте в течение ночи при 55 ° C.
    3. Смешать в течение 5 мин путем инвертирования (не вихря).
    4. Добавляют 250 мкл насыщенного NaCl (6 М) и перемешивают в течение 5 мин путем инвертирования (не вихря).
    5. Спин в течение 5-10 мин при 12000 xg и 4 ° C и выливают супернатант в новую пробирку. Добавьте 500 мкл изопропанола и перемешайте в течение 5 мин путем инвертирования (не вихрь).
    6. Спин в течение 10 мин при 12000 × г и комнатной температуре.
    7. Декантируют супернатант (таблетка невидима и прилипает к трубе).
    8. Промыть 1 мл 70% этанола.
    9. Спин в течение 5-10 мин при 12000 × г и комнатной температуре. Удалите супернатант с осторожностью, так как белая таблетка больше не липнет и может быть потеряна.
    10. Воздух высохнет в течение ~ 1 часа.
    11. Добавить 400 мкл ТЕ-буфера (10 мМ Трис и 1 мМ ЭДТА, рН = 8).
    12. Растворить ДНК при 55-60 ° С в течение 2 часов.
  3. Дизайн грунтовки.
    1. Проектные праймеры длиной не менее 20 б.п. с использованием вычислительного инструмента 19 .
      ПРИМЕЧАНИЕ. Для случайной интеграции праймеры должны гибридизоваться с трансгеном, генерируя отдельный фрагмент 200-800 б.п. Для нацеливания генов разрабатывайте праймеры так, чтобы они гибридизировались с геномной ДНК,Разброс нескольких сотен б.п. вокруг участков разреза. Для больших вставок праймеры могут сидеть на трансгене, но впоследствии подтверждение целевого интегрирования должно выполняться с помощью праймерной ходьбы или аналогичной методики.
  4. ПЦР-генотипирование.
    1. Для каждой геномной модификации создайте новый протокол ПЦР и протестируйте его эмпирически. Рассмотрим длину сгенерированного фрагмента и температуру плавления (Tm) каждой пары праймеров.
  5. Последовательность действий.
    1. Для ориентации генов отправьте продукты ПЦР поставщику услуг секвенирования Sanger.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ниже описаны рабочие процессы для микроинъекции в случае случайного интегрирования и нацеливания на CRISPR-ген ( Рисунок 1 ).

Рисунок 1
Рисунок 1: Типичный рабочий процесс для генерации генетически модифицированных мышей. Для случайного интегрирования очищенный трансген вводится в пронуклеус оплодотворенных ооцитов до переноса яйцевода в закупоренные приемные самки. Анализ потомства проводят с помощью ПЦР после быстрой геномной ДНК-экстракции. Для нацеливания гена CRISPR sgRNAs синтезируют с использованием описанного здесь метода не клонирования, а два гида совместно вводят (вместе с мРНК Cas9) в цитоплазму оплодотворенных ооцитов. Эта стратегия используется для последующего ПЦР-анализа потомства, для которого требуется высокоочищенная gЭнномную ДНК. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Хотя микроинъекция ооцитов и реимплантация этих инъецированных яиц являются двумя основными предельными стадиями, требующими технических навыков и подготовки, качество инъекционной смеси имеет первостепенное значение для успешного создания генетически модифицированных мышей. Для анализа аналитических агарозных гелей следует систематически оценивать качество трансгенной очистки ( рисунок 2A ) и синтез sgRNAs ( рисунок 3A ). Потенциальные загрязнения смеси также следует проверять при измерении концентраций на спектрофотометре, так как различные значения поглощения напрямую зависят от степени чистоты раствора (см. Шаги 1.2.3, 2.2.3.5 и 2.2.5.3).

рисунок 2B ), так и для нацеливания генов ( рисунок 3B ). Протоколы экстракции ДНК также различаются в зависимости от типа экспериментов; Последующие ПЦР полагаются на праймеры, которые гибридизуются либо на трансгене, либо на геномной ДНК, соответственно. Представленные здесь стратегии позволяют легко устранить и оптимизировать каждый шаг, необходимый для производства генетически модифицированных мышей.

Хотя количественный результат сеанса микроинъекции варьируется в зависимости от опыта экспериментатора, как только каждый шаг протокола оптимизирован, процент полученных трансгенных щенков обычно должен составлять 10-25% для случайных интеграловКак показано на рисунке 2B (4 основателя из 15 родившихся щенков = 26,6%). Эта «низкая» эффективность контрастирует с надежной способностью компонентов CRISPR редактировать геном мыши. Действительно, количество созданных основателей, как правило, выше при использовании CRISPR для нацеливания генов и составляет от 25 до 100% (см . Рис. 3B ; 3 основателя из 13 щенков = 23%). Это не редкость для получения целого потомства, которое успешно гомозиготно, когда они редактируются с помощью CRISPR.

фигура 2
Рисунок 2: Стратегия контроля качества и генотипирования для успешного производства трансгенных мышей для сверхэкспрессии. ( A ). Плазмиду расщепляют в течение 1 часа с помощью PvuI и NotI. Полное переваривание и правильные размеры ( т. Е. Трансген = 7 338 пар оснований, магистраль = 1,440+ 896 пар оснований) проверяют на аналитическом геле (1). Извлечение нескольких продуктов пищеварения из препаративного геля (2) приводит к увеличению концентрации трансгена. Следует избегать длительного воздействия УФ-излучения, и рекомендуется использовать синий свет вместо УФ-трансиллюминатора. (B) Стратегия генотипирования (1): праймеры должны сидеть на трансгене и должны быть спроектированы для генерации фрагмента 200 - 800 пар оснований. Когда выполняется генотипирование (2), рекомендуется включать положительный контроль ( т. Е. Инъекционную смесь, используемую для микроинъекции) и отрицательный контроль ( т. Е. Геномную ДНК от мыши WT). Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 3
Рисунок 3: Контроль качества и генотипирование StraДля успешного производства мышей с генами (КО). ( A ) Качество sgRNAs, продуцируемых транскрипцией in vitro, оценивается путем запуска шаблона ДНК и сгенерированной РНК параллельно для каждого гида. Размер РНК немного больше, чем у ДНК. Если качество должно быть удовлетворительным ( т. Е. Без полос мазка), измеряются концентрации. ( B ) (1) Конструкция двух направляющих (противоположных направлений), включающих кодон начала в Exon 1. Праймеры выбирают для гибридизации с геномной ДНК вне области, в конечном итоге вырезаемой двумя направляющими. Как правило, эта стратегия позволяет прямо идентифицировать гетерозиготных (# 5 и 9) и гомозиготных (№ 3) основателей КО с использованием ПЦР (2). ПЦР-продукты гомозиготных животных не показывают ни одной полосы WT. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

реакция Компоненты объем Заметка Синтез линейной матрицы ДНК
(2.5) Свободная вода из нуклеазы 97,2 мкл 5x буфер HF 36 мкл MgCl2 9 мкл 10 мМ dNTP 9 мкл 10 мкМ fwd праймера 9 мкл 5'TTAATACGACTCACTATAGN 20
gttttagagctagaaatagcaagttaaaata
Aggctagtc 3 ' 10 мкМ оборотный праймер 9 мкл 5 'AAAAGCACCGACTCGGTGCC 3' PrПолимерная полимераза 1,8 мкл IVT с использованием набора для синтеза РНК Т7
(2.6) Свободная вода из нуклеазы X мкл Максимальный объем до 20 мкл NTP буферная смесь 10 мкл Шаблонная ДНК ≈ 300 нг РНК-полимераза Т7 2 мкл

Таблица 1: Состав различных основных смесей, используемых в этом исследовании. Синтез линейной матрицы ДНК: минимальная последовательность промотора Т7 (TTAATACGACTCACTATAG) находится выше последовательности 20 п.о. (направляющая, N 20, идентифицированная с использованием инструмента для проектирования CRISPR), и последовательность, комплементарную вектору экспрессии (gttttagagctagaaatagcaattaaaataaggctagtc). In vitroТранскрипция (IVT): в зависимости от концентрации ДНК-матрицы конечный объем должен быть доведен до 20 мкл водой без нуклеазы.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Критические шаги в протоколе

Известно, что генерация генетически модифицированных мышей технически сложна. Однако представленный здесь протокол представляет собой оптимизированный и упрощенный метод, позволяющий осваивать и устранять эту технику в рекордные сроки. Для успешного завершения методики необходимо выполнить два шага. Во-первых, синтез линейных шаблонов ДНК (для синтеза sgRNAs) может быть достигнут без хлорида магния (MgCl 2 ). Тем не менее, настоятельно рекомендуется систематически добавлять MgCl 2 в основной микс, поскольку частичная гибридизация прямого праймера часто предотвращается в отсутствие MgCl 2 . Кроме того, крайне важно, чтобы целенаправленная геномная последовательность не присутствовала ни в одной части шаблона донора (в случае целевой интеграции), в противном случае нуклеаза Cas9 сократит ее, предотвращая возникновение HDR.

измененияИ устранение неполадок

Хотя этот протокол для генерации генетически модифицированных мышей был оптимизирован и оптимизирован на протяжении многих лет, есть некоторые соображения, касающиеся выхода ооцитов хорошего качества для микроинъекции и скорости закупоривания приемных самок. Выбор фонового напряжения имеет решающее значение в отношении количества живых щенков, возникающих в результате сеанса микроинъекции. C57BL / 6 является наиболее часто используемым фоном для мышиных моделей заболеваний. Однако он также является одним из менее эффективных слоев с точки зрения устойчивости к микроинъекции 20 . Кроме того, возраст самки также имеет решающее значение для получения большого количества ооцитов; Рекомендуется избегать мышей в возрасте 5-8 недель независимо от фона, так как это наименее благоприятный период ответа на гормональную стимуляцию 21 . По нашему опыту, мышей C57BL / 6 с 3-х до 4-недельными препаратами надежно дают 20-30 яиц на одну женщину. Это важноЧто новая методика (называемая ультра-суперовуляцией) произвела до 100 яиц на одну женщину и недавно использовалась для получения ооцитов для микроинъекции 22 . Однако использование ультра-суперовуляции для микроинъекции обычно затруднено необходимостью искусственного оплодотворения (экстракорпоральное оплодотворение) такого большого количества яиц.

Для получения подключенных приемных самок, подходящих для реимплантации, мышей-самцов соединяют с вазэктомированными самцами (фон этих мышей не является критическим). Чтобы увеличить количество подключенных получателей, можно провести тщательное изучение стадии эструса и выбора подходящих самок 23 . Синхронизация циклов самок также может быть вызвана путем воздействия на самцов вазэктомированных мужчин за два дня до спаривания (так называемый «эффект Уитена») 24 .

Ограничения техники

Очень небольшие геномные модификации, такие как точечные мутации, относительно легко генерируются, но их трудно идентифицировать. Когда выполняется генотипирование, продукты ПЦР непосредственно секвенируются секвенированием Сэнгера. Однако прямая микроинъекция компонентов CRISPR в ооцитах мыши часто генерирует мозаичных животных, потому что Cas9 остается активным в течение довольно долгого времени, и после первого деления ооцита могут возникать различные геномные модификации. Этот смешающий эффект усложняет идентификацию дискретных мутаций среди различных аллелей, а последовательность секвенирования следующего поколения (NGS) может помочь в сложных показаниях. Чувствительные методы, такие как тетра-праймерARMS-PCR, 25 также может помочь в генотипировании колонии после идентификации основателей путем секвенирования.

И наоборот, вставлять большие фрагменты ДНК целенаправленным способом остается сложной задачей. Чем больше экзогенная ДНК, тем меньше эффективность HDR. Следовательно, в настоящее время разрабатываются новые стратегии, такие как использование длинных доноров ssOligos (вместо плазмид) 26 или HDR-независимая целевая интеграция 27 .

Значение протокола

Этот протокол представляет собой значительный прогресс, поскольку четыре основные этапы ( например, подготовка компонентов трансгена или CRISPR, микроинъекция, реимплантация и генотипирование) были оптимизированы, протестированы и подтверждены в нашей лаборатории.

Случайная интеграция трансгенов широко используется для исследований сверхэкспрессии по двум основным причинам. Во-первых, avoКак потенциальный «позиционный эффект», целевая интеграция трансгена с использованием CRISPR в локусах «безопасной гавани», таких как локус Rosa26 28 и Col1a 29 , остается печально сложной, поскольку эффективность HDR низкая. Стратегии преодоления этой проблемы приводятся 26 , 27 , но случайная интеграция до сих пор оказалась более эффективной. Кроме того, генерация множественных трансгенных линий, сверхэкспрессирующих один и тот же трансген с различными уровнями экспрессии, представляет интерес для исследований, включающих стратегии лечения, чтобы обратить фенотип 30 . Трансгены на основе плазмиды генерируются путем клонирования с использованием специальных рестрикционных ферментов для сбора необходимых фрагментов для выражения интересующего белка. Как правило, трансген состоит из по меньшей мере трех элементов: подходящий промотор (иногда добавляют области энхансера); КодированиеПоследовательность (кДНК), с или без интронных областей; И хвост PolyA для стабилизации экспрессии мРНК 31 .

После сборки трансген вводится в плазмиду, содержащую элементы репликации бактерий, и после трансформации расширяется в культуре (как правило, на основе теплового шока). Важным является метод очистки трансгенов для микроинъекции. В этой работе описывается использование пятен ДНК нового поколения (с низкой токсичностью) для более точной визуализации интересующего фрагмента на геле (по сравнению с традиционным кристаллическим фиолетовым) и низкой мутагенной экспозиции (по сравнению с бромидом этидия).

Описанный здесь метод не клонирования для нацеливания генов очень быстрый и позволяет синтезировать несколько sgРНК всего за 5-6 часов. Требуются только четыре этапа: идентификация целевой последовательности, синтез линейной матрицы ДНК, содержащей промотор T7 и выбранную целевую последовательность, синтез oF sgRNA транскрипцией in vitro (IVT) и очисткой sgRNA с использованием спиновых колонок.

В раннем возрасте редактирования генома мыши CRISPR потенциальный эффект вне цели был систематически оценен, хотя он был показан очень ограниченным в эмбрионах 32 мыши и может быть легко разбавлен по схеме разведения, в которой выделенные мыши переносят только Желательная геномная модификация. Активность на целевых участках также систематически предварительно оценивалась in vitro , используя разные направляющие и выбирая более активный (ые) элемент (ы) 12 . Эта практика сейчас менее распространена по нескольким причинам. Во-первых, активность на мишени оценивают с помощью трансфекции иммортализованных линий клеток мыши (как правило, N2a или NIH3T3) с CRISPR-кодирующими плазмидами. Это другой метод, чем инъекция компонентов РНК CRISPR в мышиные ооциты. Поэтому результаты, найденные in vitro , не всегда переводятся одинаковоК ооцитам. Кроме того, эксперименты с высокой пропускной способностью показали, что большинство направляющих активно 33 . Следовательно, активность на мишени не оценивается, и до сих пор не было доказательств руководства, показывающего отсутствие активности в ооцитах мыши. Вместе с методом не клонирования для синтеза sgRNAs, представленным здесь, это значительно упрощает и упрощает рабочий процесс, а несколько активных направляющих могут быть легко синтезированы за один день.

CRISPR считается «разрушительной технологией», которая представляет собой новшество, которое изменяет способ осуществления методов. Когда была установлена ​​микроинъекция, Brinster et al. Показали, что цитоплазматический трансгенез, хотя и достижимый, оставался в основном неэффективным. Следовательно, пронуклеарная микроинъекция оставалась единственной обычной практикой почти 30 лет, до первой демонстрации успешного гена CRISPR, нацеленного на мышей. Это исследование показало, что цитоплазматический микроинъект Ион может генерировать аналогичный или превосходный результат по сравнению с пронуклеарной доставкой 12 . Очевидно, что, поскольку компоненты CRISPR обычно состоят из РНК, очевидно, что цитоплазма нацелена. Однако даже при введении в цитоплазму, шаблоны-доноры также могут успешно индуцировать HDR. Высокая цитоплазматическая концентрация шаблонов позволяет их диффузию в ядро. Более того, использование пьезоциклированной цитоплазматической микроинъекции 16 не является требованием. Короткий инкубация ооцитов с ингибитором цитоскелета, такой как цитохалазин B, увеличивает выживаемость ооцитов 34 , 35 , что делает его достаточным для выполнения цитоплазматических инъекций без системы пьезо-ударного воздействия. Аналогично, использование улучшенной культуральной среды, такой как KSOMaa, уменьшает блокировку на двухклеточной стадии и улучшает способности развития эмбрионов по сравнению с средой M16Xref "> 36.

Одноклеточные или двухклеточные (когда культивируемые в течение ночи) эмбрионы могут быть перенесены в яйцевод. Обычная процедура довольно инвазивная, так как требует разрыва бурсы, которая защищает яичник. Это также технически сложно, потому что стеклянный капилляр необходимо вставить в воронку 15 . Представленный здесь метод намного легче изучать, не вызывает потенциального кровотечения и сохраняет целостность яичника. Он основан на работе, разработанной в Университете Кумамото 37 .

Стратегии генотипирования и методы секвенирования имеют решающее значение для выявления потенциальных основателей. Для случайного интегрирования извлечение геномной ДНК основано на простом способе, адаптированном из Truett et al. 38 . Такой метод быстрой экстракции является достаточным для выявления потенциальных основателей, поскольку праймеры предназначены для гибридизации с трансгеном (часто интегрируютКак многократные копии). Напротив, для нацеливания генов требуется высокоочищенная геномная ДНК, поскольку продукт ПЦР охватывает модифицированную геномную область.

Для нокаута генов традиционный метод инъекции единственной sgRNA генерирует небольшие делеции (indels) или вставки, в конечном итоге выбивая интересующий ген 12 . Эти небольшие модификации трудно идентифицировать и часто требуют много времени, лигаза-независимого клонирования и последовательности, чтобы подтвердить характер этих мутаций.

В этом протоколе мы использовали мультиплексирование CRISPR для разработки систематической совместной инъекции двух sgRNAs, охватывающих стартовый кодон представляющего интерес гена. Это не только увеличивает вероятность выпадения гена, но также вырезает кусок геномной ДНК предопределенного размера (100-300 п.о.), что позволяет легко идентифицировать основателей простой ПЦР. Следует отметить, что щенки, не несущие ожидаемых геномныхXcision все еще может быть проанализирован для небольших мутаций с изменением рамки, когда активна только одна sgRNA. Аналогично, в случае редактирования генов систематическая совместная инъекция двух перекрывающихся sgRNAs в противоположных направлениях должна повысить эффективность HDR, поскольку механизмы восстановления клеток предпочтительно используют одну из двух нитей 39 .

Будущие приложения

В настоящем протоколе используются последние разработки в области эмбриологии и генного нацеливания 40 для упрощения и упорядочения процесса создания различных сложных моделей мышц человека. Эти модели играют ключевую роль в содействии развитию нашего понимания патомеханизмов, в конечном счете содействуя разработке терапевтических стратегий 2 . Оптимизация и рационализация реагентов, необходимых для нацеливания генов или случайной интеграции, широко и легко применяютсяК любым другим млекопитающим, таким как крысы, кролики и даже крупным животным, таким как крупный рогатый скот.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы предоставляют услуги академического трансгенеза у мышей через аналитический центр Университета Нового Южного Уэльса Марк Уэйнрайт.

Acknowledgments

Авторы выражают благодарность персоналу животного объекта (BRC) за их постоянную поддержку. Эта работа финансировалась Национальным советом по здравоохранению и медицинским исследованиям и Австралийским исследовательским советом.

Materials

Name Company Catalog Number Comments
Micropipette 0.1-2.5 μL Eppendorf 4920000016
Micropipette 2 - 20 μL Eppendorf 4920000040
Micropipette 20 - 200 μL Eppendorf 4920000067
Micropipette 100 - 1,000 μL Eppendorf 4920000083
Molecular weight marker  Bioline BIO-33025 HyperLadder 1 kb
Molecular weight marker  Bioline BIO-33056 HyperLadder 100 bp
Agarose Bioline BIO-41025
EDTA buffer Sigma-Aldrich 93296 10x - Dilute to 1x
Ethidium bromide Thermo Fisher Scientific 15585011
SYBR Safe gel stain Invitrogen S33102
Gel extraction kit Qiagen 28706
PCR purification kit (Qiaquick) Qiagen 28106
Vacuum system (Manifold) Promega A7231
Nuclease-free microinjection buffer  Millipore MR-095-10F
Ultrafree-MC microcentrifuge filter  Millipore UFC30GV00
Cas9 mRNA Sigma-Aldrich CAS9MRNA
CRISPR expressing plasmid (px330) Addgene 42230
Nuclease free water Sigma-Aldrich W4502
Phusion polymerase New England Biolabs M0530L
T7 Quick High Yield RNA kit New England Biolabs E2050S
RNA purification spin columns (NucAway) Thermo Fisher Scientific AM10070
ssOligos Sigma-Aldrich OLIGO STANDARD
Donor plasmid Thermo Fisher Scientific GeneArt
Hyaluronidase Sigma-Aldrich H3884
KSOMaa embryo culture medium Zenith Biotech  ZEKS-100
Mineral oil Zenith Biotech  ZSCO-100
M2 Medium Sigma-Aldrich M7167
Cytochalasin B Sigma-Aldrich C6762
Mouthpiece Sigma-Aldrich A5177
Glass microcapillaries Sutter Instrument BF100-78-10
Proteinase K Applichem A3830.0100
Dumont #5 forceps Fine Science Tools  91150-20
Iris scissors Fine Science Tools  91460-11
Vessel clamp Fine Science Tools  18374-43
Wound clips  Fine Science Tools  12040-01
Clips applier  Fine Science Tools  12018-12
Micro-scissors  Fine Science Tools  15000-03
Cauterizer Fine Science Tools  18000-00
Non-absorbable surgical sutures (Ethilon 3-0) Ethicon 1691H
5% CO2 incubator MG Scientific Galaxy 14S
Spectrophotometer Thermo Fisher Scientific Nanodrop 2000c
Thermocycler Eppendorf 6321 000.515
Electrophoresis set up BioRad 1640300
UV Transilluminator BioRad 1708110EDU
Thermocycler Eppendorf 6334000069
Stereoscopic microscope Olympus SZX7
Inverted microscope Olympus IX71
2x Micromanipulators Eppendorf 5188000.012
Oocytes manipulator Eppendorf 5176000.025
Microinjector (Femtojet) Eppendorf 5247000.013
Mice C57BL/6J strain Australian BioResources C57BL/6JAusb 

DOWNLOAD MATERIALS LIST

References

  1. Ittner, L. M. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell. 142, (3), 387-397 (2010).
  2. Ittner, A. Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice. Science. 354, (6314), 904-908 (2016).
  3. Marantz Henig, R. The Monk in the Garden. Mariner books. (2000).
  4. Jaenisch, R., Mintz, B. Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad Sci U S A. 71, (4), 1250-1254 (1974).
  5. Gordon, J. W., Ruddle, F. H. Integration and stable germ line transmission of genes injected into mouse pronuclei. Science. 214, (4526), 1244-1246 (1981).
  6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A. 77, (12), 7380-7384 (1980).
  7. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A. 82, (13), 4438-4442 (1985).
  8. Capecchi, M. R. Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet. 6, (6), 507-512 (2005).
  9. Carbery, I. D. Targeted genome modification in mice using zinc-finger nucleases. Genetics. 186, (2), 451-459 (2010).
  10. Sung, Y. H. Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol. 31, (1), 23-24 (2013).
  11. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  12. Wang, H. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  13. Kang, X. Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing. J Assist Reprod Genet. 33, (5), 581-588 (2016).
  14. Liang, P. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 6, (5), 363-372 (2015).
  15. Ittner, L. M., Götz, J. Pronuclear injection for the production of transgenic mice. Nat Protoc. 2, (5), 1206-1215 (2007).
  16. Yang, H., Wang, H., Jaenisch, R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 9, (8), 1956-1968 (2014).
  17. CRISPR DESIGN. Available from: http://crispr.mit.edu (2017).
  18. Integrated DNA Technologies. Resuspension Calculator. Available from: https://sg.idtdna.com/calc/resuspension/ (2017).
  19. BioTools at UMass Medical School. Primer3: WWW primer tool. Available from: http://biotools.umassmed.edu/bioapps/primer3_www.cgi (2017).
  20. Auerbach, A. B. Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12, (1), 59-69 (2003).
  21. Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months. Biol Reprod. 86, (2), 49 (2012).
  22. Nakagawa, Y., et al. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice. Biol Open. 5, (8), 1142-1148 (2016).
  23. Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. Mouse estrous cycle identification tool and images. PLoS One. 7, (4), e35538 (2012).
  24. Whitten, W. K. Modification of the oestrous cycle of the mouse by external stimuli associated with the male. J Endocrinol. 13, (4), 399-404 (1956).
  25. Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, (17), E88 (2001).
  26. Yoshimi, K., et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 7, 10431 (2016).
  27. Suzuki, K., et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. (2016).
  28. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-71 (1999).
  29. Liu, X., et al. A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling. J Cell Biol. 130, (1), 227-237 (1995).
  30. Ke, Y. D. Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. Acta Neuropathol. 130, (5), 661-678 (2015).
  31. Auerbach, A. B. Production of functional transgenic mice by DNA pronuclear microinjection. Acta Biochim Pol. 51, (1), 9-31 (2004).
  32. Iyer, V., et al. Off-target mutations are rare in Cas9-modified mice. Nat Methods. 12, (6), 479 (2015).
  33. Zhou, Y. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509, (7501), 487-491 (2014).
  34. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. Translation of globin messenger RNA by the mouse ovum. Nature. 283, (5746), 499-501 (1980).
  35. Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. Mitochondria transfer into mouse ova by microinjection. Transgenic Res. 6, (6), 379-383 (1997).
  36. Biggers, J. D., Summers, M. C. Choosing a culture medium: making informed choices. Fertil Steril. 90, (3), 473-483 (2008).
  37. Nakagata, N. Embryo transfer through the wall of the fallopian tube in mice. Jikken Dobutsu. 41, (3), 387-388 (1992).
  38. Truett, G. E. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  39. Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 34, (3), 339-344 (2016).
  40. Delerue, F., Ittner, L. M. Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects. Clon. Transgen. 4, (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics