Yeni Bir Dünyadan Rekombinant Virüsün Kurtarılması ve Karakterizasyonu Zika Virüsü Bulaşıcı Klon

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Bu protokol, iki-plazmid bulaşıcı bir cDNA klonundan bulaşıcı Zika virüsünün iyileşmesini tanımlıyor.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Weger-Lucarelli, J., Duggal, N. K., Brault, A. C., Geiss, B. J., Ebel, G. D. Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone. J. Vis. Exp. (124), e55857, doi:10.3791/55857 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Enfeksiyöz cDNA klonları bir virüsün genetik manipülasyonuna izin verir, böylece aşılar üzerinde çalışma, patogenez, replikasyon, bulaşma ve viral evrimi kolaylaştırır. Burada Zika virüsü (ZIKV) için şu anda Amerika'da patlayıcı bir salgına neden olan bulaşıcı bir klonun yapımını anlatıyoruz. Flavivirüs kaynaklı plazmidlerle sıkça görülen bakterilere toksisiteyi önlemek için genomu NS1 geninde ayıran ve mutasyonsuz başarıyla kurtarılamayan tam uzunluktaki yapılardan daha kararlı olan iki plazmid sistemi ürettik. İki parçaya katılmak için sindirim ve ligasyondan sonra, T7 RNA polimeraz ile in vitro transkripsiyon ile tam uzunluktaki viral RNA üretilebilir. Transkribe RNA'nın hücrelere elektroporasyonundan sonra sırasıyla farelerde ve sivrisineklerde benzer in vitro büyüme kinetikleri ve in vivo virülans ve enfeksiyon fenotiplerini sergileyen virüs bulunmuştur.

Introduction

Zika virüsü (ZIKV; Aile Flaviviridae : Genus Flavivirus ), 2013-14 yılları arasında Brezilya'ya gelen sivrisinek taşıyan bir flavivirüs olup, daha sonra Amerika Birleşik Devletleri'nde yaygınlaşan ateşli bir hastalık patlamasıyla ilişkilendirilmiştir 1 . Buna ek olarak, ZIKV, yetişkinlerde Guillain-Barré sendromu ve fetüsler ve yenidoğanlarda mikrocefali gibi ağır hastalık sonuçlarıyla bağlantılıdır2. Batı yarımkürede hızla yayılmadan önce ZIKV hakkında pek az şey biliniyordu. Bu, moleküler araçların eksikliğini içeriyordu, bu yüzden mekanistik araştırmayı engelledi. Bulaşıcı cDNA klonları gibi virüsler için moleküler araçlar aşı ve antiviral terapötik gelişmeyi kolaylaştırır ve farklı viral patogenez, bağışıklık yanıtı ve viral evrim ile ilgili viral genetik faktörlerin değerlendirilmesine izin verir.

Flavivirüs bulaşıcı klonların bakterilerde cr nedeniyle oldukça kararsız olduğu bilinmektedirGenomlarında bulunan yptik prokaryotik hızlandırıcılar 3 . Bu sorunu hafifletmek için çeşitli yaklaşımlar kullanılmıştır; Virütik dizilerin 4 üst akışında tandem tekrarların yerleştirilmesi, varsayılan prokaryotik promoter dizilerinin 5 mutasyonu, genomun birden çok plazmid 6'ya bölünmesi, düşük kopya sayı vektörleri (bakteri yapay kromozomlar dahil) 7,8 ve viral genomda intronların sokulması da dahil olmak üzere 9 . ZIKV için modifikasyonsuz bir tam uzunluklu sistem tanımlanmıştır; Bununla birlikte, bu klonun hücre kültüründe ve farelerde zayıfladığı görülmüştür. Diğer gruplar ZIKV genomuna intronlar tasarladılar ve in vitro memeliler hücrelerinde enfeksiyöz virüsün üretilmesi için eklenebilen bakterilerdeki istikrarsız dizilerin bozulmasına izin verdi 11, 12 . Ek olarak, ZIKV 13'ün prototip MR766 suşunu kurtarmak için İnfeksiyöz-Subgenomik-Amplikon başlıklı bir PCR tabanlı sistem başarıyla kullanılmıştır. Burada açıklanan yaklaşım, yabancı sekanslara ihtiyaç duymamakta, daha önce sarı humma 6 , dang 14 , 15 ve Batı Nil virüsleri 16 ile başarıyla kullanılan çok sayıda plazmid kullanarak yüksek instabilite bölgesinde genomu bozmaktadır. Dahası, viral genomik uçtaki hepatit D ribozim dizisinin eklenmesi, bir doğrusallaştırma bölgesi eklenmesine gerek kalmadan otantik bir 3 'ucunun oluşturulmasını kolaylaştırır. Buna ek olarak, her iki plazmid, herhangi bir artık toksisite 17 azaltmak için düşük kopya sayısı vektör (pACYC177, hücre başına ~ 15 kopya) inşa edilmiştir. Geri kazanılan virüs,Hem anne hem de böceklerden türeyen çeşitli hücre tiplerini içeren 8 hücre hattındaki in vitro büyüme eğrilerinde ebeveyn virüs bulaştırdı ve farelerde aynı patojenik profilleri, sivrisineklerde enfeksiyon, yayılım ve iletim oranlarını sergiledi.

Burada, bulaşıcı klon plasmidlerin büyümesini , in vitro olarak tam uzunlukta viral RNA (viral genom) üretmek ve hücre kültüründe bulaşıcı virüsün nasıl toplanacağını açıklayan bir protokol açıklanmaktadır. İlk olarak bakterilerdeki plazmidlerin çoğalmasını veya yuvarlanan daire amplifikasyonunu (RCA) kullanarak bakteri içermeyen amplifikasyonunu anlatacağız. Sonra, iki plazmitin nasıl sindirildiğini ve ardından tam uzunlukta virüs üretmek için birlikte bağlandığını gösteriyoruz. Son olarak, transkripsiyon RNA üretimini ve daha sonra Vero hücrelerine elektroporasyonunu, ardından geri kazanılan virüs titrasyonunu tarif ediyoruz ( Şekil 1 ). Açıklanan yaklaşım hızlıdır,Enfeksiyonlu virüs stoklarının 1-2 hafta içinde toparlanması.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Enfeksiyoz klon plasmidlerinin transformasyonu ve geri kazanımı

  1. Bazı değişikliklerle birlikte ticari bir dönüştürme protokolü ( örn. , NEB 5 Dakikada Dönüştürme Protokolü) kullanarak her iki plazmayı da (ayrı ayrı) transforme edin. Her iki plazmid ampisilin direncini kodlayan bir gen içerdiğinden, seçim için ampisilin veya karbenisilin kullanın. Karbenisilin daha kararlı olduğu için tercih edilir.
    1. -80 ° C derin dondurucudan hücreleri çıkarın (Malzeme Tablosuna bakın) ve buz üzerinde 5-10 dakika eritin. 37 ° C'de, lösojen broy (LB) (10 g / L NaCl ve 25 μg / mL karbenisilin içeren; LB-karben) plakaları ve katabolit baskılanmış suyu (antibiyotik içermeyen SOC) yerleştirin.
    2. 50 μL yetkili hücre içeren bir tüp içine 1 μL plazmid DNA'sında 100 pg - 10 ng ekleyin; Tüpü hafifçe oynatarak karıştırın.
    3. Tüpleri 5 dakika boyunca buzda inkübe edin.
    4. Isı şok tüpleri 42 ° C'de 30 saniyeBir su banyosunda. Isı şokunu takiben hemen buza 2 dakika dönün.
    5. Her tüpe oda sıcaklığında SOC'yi 950 μL pipetleyin ve pipetleme ile karıştırın. Bakteri karışımının 100 μL'sini bir LB-carb plakasına yayın ve gece boyunca 37 ° C'de (kabaca 12-14 saat) inkübe edin.
  2. 12-14 saat inkübasyondan sonra plakaları 37 ° C inkübatörden çıkarın. Kolonilerin büyümeye devam etmesini sağlamak için plakları oda sıcaklığında koyu renkli bir çekmeceye koyun (kabaca 8-9 saat).
  3. 5 mL Terrific broth (TB, carbamycillin içeren 25 μg / mL carbenicillin içeren) kullanarak, bakteriyel bir çalkalayıcıda (kabaca 14-16 saat) 30 ° C'de her plazmid için 5-10 küçük koloni oluşturun.
    NOT: Küçük koloniler plazmitin bozulmamış olduğunun bir göstergesidir; Delesyonlar, düzenlenmeler veya mutasyonlar içeren (burada instabilite olayları olarak da adlandırılan) plazmitlere sahip koloniler daha hızlı büyür ve böylece daha büyük olurlar. Dolayısıyla, plakadaki en küçük kolonileri seçmeye çalışmalı, özellikle de hayırT mevcut en büyük kolonileri seçmek. Tamamlanması için bazı orta boy koloniler de seçilebilir. Kullanılan düşük sıcaklık, hücrelerin aşırı büyümek olasılığını azaltır (OD 600 , 0.6-0.8'den büyük). Çoğu araştırmacı, bir gecede büyüme gerçekleştirdiğinden, daha fazla kontrol ve aşırı büyüme ihtimalini düşürür.
  4. Sıvı kültürleri bulanıklık açısından kontrol edin (kabaca OD 600 , 0.6-0.8). Herhangi bir bulanık boruyu 4 ° C'ye yerleştirin ve diğer tüplerin daha uzun süre büyüyerek bulanık hale gelmesine izin verin.
    NOT: Plazmid instabilite olayları oluşabileceği için, bakterileri OD 600 değerlerine göre daha fazla büyütmeyin.
  5. Plazmid DNA'yı, ticari bir plasmid miniprep kiti ile bakterilerden ayırabilirsiniz (Malzeme Tablosuna bakınız). 15 μL önceden ısıtılmış (bir ısıtma bloğunda 70 ° C'ye kadar) elüsyon tamponu içinde elute edin. Seyreltme tamponunun, santrifüje tabi tutulmadan önce 5 dakika sütun üzerinde inkübe edilmesine izin verin.
    NOT: Bu başlangıç ​​kültüründen en az 1 mL 4 ° C'de saklanmalıdır.Bir sonraki adımda daha fazla kullanabilirsiniz.
  6. Plazmid instabilite olaylarının kültür esnasında oluşup oluşmadığını değerlendirmek için geri kazanılmış plazmidlerin 10 uL'ini sindirin.
    NOT: SalI / NheI ile p2'yi ve BamHI / Hindlll ile p2'yi 37 ° C'de 1 saat boyunca özümleyin. Jel elektroforeziyle sindirim sonrasında doğru bantların varlığını teyit edin ( Şekil 2a ) ve 2. adıma geçin. Yuvarlanan daire amplifikasyonu (RCA) ile plazmid DNA hazırlarken, bazı miniprep eluatın bir şablon görevi için rezerve edin.

2. Bağlama için Yeterli Plazmid DNA'nın Hazırlanması

NOT: Bağlama ve sonraki elektroporasyon, maxiprep veya RCA vasıtasıyla üretilmesi gereken yeterli miktarda plazmid DNA'sı gerektirir. Maxiprep, geleneksel olarak kullanılan bir yaklaşım olsa da, RCA, bakterilere ihtiyaç duymamakta ve dolayısıyla istikrarsızlık olaylarına neden olabilecek plazmid kaynaklı toksisite potansiyelini ortadan kaldırmaktadır.

  1. Önceki bölümde doğru kısıtlama enzimi sindirim modelini gösteren her bir plazmid için 1 L TB-Carb (25 ug / mL karbenisilin) ​​et suyuna 500 mcL marş kültürü ilave edin ve gece boyunca 30 ° C'de çalkalayın (kabaca 14-16 saat , Kabaca OD 600 0.6-0.8).
    Not: kültürü, bu OD 600 değeri üzerinde büyümesine izin vermeyin. Bu, plasmidler içindeki potansiyel olarak istikrarsızlık olaylarıyla sonuçlanır.
  2. Bakterileri hasat edin ve üreticinin protokolüne göre maxipreps yapın (Bkz. Malzeme Tablosu).
  • Adım 1.6'dan kaydedilen miniprep'i kullanarak, RCA yordamı için aşağıdakileri yapın.
    1. 1 mcL plazmid DNA'sını 50 uL numune tamponu içeren bir tüp içine aktarın.
    2. Numuneyi 95 ° C'de 3 dakika boyunca ısıyla denature edin ve sonra kullanıma hazır olana kadar 4 ° C'de inkübe edin.
    3. Ticari amplifikasyonu hazırlayınPremiks (Bkz. Malzeme Tablosu ). Buz üzerinde ayarlanmış bir tüp içinde 50 uL reaksiyon tamponu ile 2 uL enzim karışımı birleştirin.
      NOT: Amplifikasyon ön karışımı, kullanıma hazır oluncaya kadar buzda tutulmalıdır. Gerekli sayıda amplifikasyon reaksiyonu için yeterli tepkin maddeleri birleştirerek bir ana karışım hazırlamak uygundur. Kullanılmayan herhangi bir ön karışım atılmalıdır.
    4. Düzeltilmiş numuneye 50 μL hazırlanmış amplifikasyon ön karışımı aktarın.
    5. Reaksiyon tüplerini 30 ° C'de 18 saat inkübe edin.
    6. Ø29 DNA polimerazını devre dışı bırakmak için tüpleri 65 ° C'de 10 dakika inkübe edin.
    7. Reaksiyon tüplerini kullanıma hazır olana kadar 4 ° C veya -20 ° C'de saklayın.
      NOT: Bu noktada, her iki yöntemle hazırlanan plazmid DNA'sı (260 nm'de emilim kullanılarak) nicelendirilmelidir ve hazırlama sırasında herhangi bir istikrarsızlık olayı (silme ve yeniden düzenlemeler) oluştuğunu doğrulamak için ZIKV genomu Sanger dizilimi olmalıdır.
  • Astar Adı Sıra (5 '- 3')
    ZIKV PRVABC59 1For. AGTTGTTGATCTGTGTGAATCAGAC
    ZIKV Korunmuş 632For. GCCCTATGCTGGATGAGG
    ZIKV Korunmuş 692Rev. GGTTCCGTACACAACCCAAGTTG
    ZIKV Conserved 1313Rev. CTCCCTTTGCCAAAAAGTCCACA
    ZIKV Conserved 1201For. CCAACACAAGGTGAAGCCTAC
    ZIKV Korunan 1663For. GCAGACACCGGAACTCCACACT
    ZIKV 2008'de Korundu. CAGATGGCGGTGGACATGC
    ZIKV Korunmuş 2350Rev. GTGAGAACCAGGACATTCCTCC
    ZIKV Korundu 2605For. TACAAGTACCATCCTGACTCCC
    ZIKV Korunan 3499Rev. GCCTTATCTCCATTCCATACCA
    ZIKV Korunmuş 3961Rev. TTGCCAACCAGGCCAAAG
    ZIKV Korunmuş 4132For. CATTTGTCATGGCCCTGG
    ZIKV Conserved 4561Rev. CTATTGGGTTCATGCCACAGAT
    ZIKV Korunmuş 4665For. GACCACAGATGGAGTGTACAGAGT
    ZIKV Conserved 5189Rev. AAGACAGTTAGCTGCTTCTTCTTCAG
    ZIKV Korunmuş 5219For. GAGAGTTCTTCCTGAAATAGTCCGTGA
    ZIKV Conserved 6086Rev. CTTGCTTCAAGCCAGTGTGC
    ZIKV Korunmuş 6119For. GCCTCATAGCCTCGCTCTATCG
    ZIKV Korunmuş 6721Rev. CCATTCCAAAGCCCATCTTCCC
    ZIKV Korunmuş 6769For. CCAGCCAGAATTGCATGTGTCC
    ZIKV Conserved 7209Rev. ATCATTAGCAGCGGGACTCCAA
    ZIKV Korunan 7343For. GTTGTGGATGGAATAGTGGT
    ZIKV Korunan 8243For. TGCCCATACACCAGCACTATGA
    ZIKV PRVABC59 8893Rev. TGCATTGCTACGAACCTTGTTG
    ZIKV korundu 9133For. AGCCCTTGGATTCTTGAACGAGGA
    ZIKV PRVABC59 9673Rev. AACGCAATCATCTCCACTGACT
    ZIKV Korunmuş 9686For. GATGATAGGTTTGCACATGCC
    ZIKV Conserved 10321Rev. GTCCATGTACTTTTCTTCATCACCTAT
    ZIKV Korunmuş 10455For. CAGGAGAAGCTGGGAAACC
    ZIKV Conserved 10621Rev. CAGATTGAAGGGTGGGGAAGGTC

    Tablo 1: cDNA klonlarının dizilimi için primerler. Plazmidler listelenen primerler ile sıralanabilir. "Korunan" olarak işaretlenmiş astarlarZIKV'in tüm genotiplerini sıralama / yükseltme olasılıklarının yüksek olduğunu belirtin. "PRVABC59" olarak etiketlenen primerler bu suşa özeldir ancak diğer Asya genotip türleri ve muhtemelen diğer genotipler için de çalışabilir.

    3. In Vitro Transkripsiyon RNA Hazırlanması

    1. Maxiprep veya RCA hazırlanmış DNA'nın sindirim reaksiyonunu ayarlayın.
      1. P1 sindirimi için 10 uL 10x reaksiyon tamponu, 3 uL ApaLI, 3 μL BamHI-HF, 3 uL rSAP veya CIP ve 3,3 μg p1 DNA karıştırın. 100 uL'ye ddH20 ilave edin.
      2. P2 sindirimi için, 10 uL 10x reaksiyon tamponu, 3 uL ApaLI, 3 uL EcoRI-HF ve 13.3 μg p2 DNA'yı karıştırın. 100 uL'ye ddH20 ilave edin.
      3. 1-2 saat boyunca 37 ° C'de inkübe edin.
      4. Ticari bir jel ve PCR temizleme seti kullanarak arındırın (Malzeme Tablosuna bakın). Isıtma bloğunda 70 ° C'ye önceden ısıtılmış 30 uL elüsyon tamponu içinde elute edin (inkübe edinSütun 5 dak.).
        NOT: Daha sonra bir jel üzerinde çalışmak için 1 uL tutun.
    2. Ligasyon reaksiyonu hazırlayın.
      1. 10 uL 10x T4 DNA ligasyon reaksiyon tamponu, 3 μL T4 DNA ligaz (400 U / μL), saflaştırılmış p1 29 uL ve 29 μL saflaştırılmış p2'yi birleştirin. 100 uL'ye ddH20 ilave edin.
      2. Oda sıcaklığında 2 saat veya gece boyunca 16 ° C'de inkübe edin.
      3. Ticari bir jel ve PCR temizleme seti kullanarak arındırın (Malzeme Tablosuna bakın). Isıtma bloğunda 70 ° C'ye önceden ısıtılmış 10 uL elüsyon tamponunda elute edin (eğrilmeden önce 5 dakika kuluçka sütunu).
        NOT: Daha sonra bir jel üzerinde çalışmak için 1 uL tutun.
    3. Sindirilmemiş plasmidleri, sindirilmiş plasmidleri ve bir agaroz jelinde bağlayın. Ligasyon ürününün, ligasyonun başarılı olduğunu gösteren tek başına sindirilmiş plazmitten daha yüksek bir moleküler ağırlık bandına (yaklaşık 11 kb) sahip olması gerekir ( Şekil 2b ).
    4. T7 in vitro transkripsiyon reaksiyonu oluşturun.
      1. 10 uL 2x ARCA / NTP Mix, 2 μL T7 RNA polimeraz karışımı ve 8 μL saf ligasyon reaksiyonu ile 20 uL son bir hacim birleştirin.
        NOT: Karışıma dahil edilen ARCA, yalnızca doğru yönlendirmeyle birleştirilen bir kap analogudur. Standart kap analogları, transkriptlerin yalnızca ~% 50'sinde doğru oryantasyonda bir başlık oluşturabilir.
      2. 37 ° C'de 4 saat inkübe edin.
      3. Bir UV spektrofotometre yardımıyla RNA konsantrasyonunu ölçün. İsteğe bağlı olarak, RNA transkriptinin uzunluğunu teyit etmek için bir denatüre edici agaroz jeli çalıştırın.

    4. Elektroporasyon ile Bulaşıcı Virüs Kurtarma

    1. Elektroporasyondan önceki günlerde, kurtarılacak olan yapı başına 1 T182 şişesiVero hücresi (T150 ile T182 arasında kabul edilebilir; DMEM +% 10 Fetal sığır serumu (FBS) içinde yetiştirilir) hazırlayın. Sahte bir transfeksiyon kontrolü olarak 1 T182'yi ekleyin. CeLl% 70-80 konfluende kullanılmalıdır.
    2. Hücreler hazır olduğunda, 12 mL / DMEM reaksiyonu +% 15 FBS + 10 mM HEPES'i 37 ° C'ye kadar ısıtılan su banyosuna yerleştirin.
    3. Standart bir protokol ile tripsinizasyon ile hücreleri ayırın ve tripsin inaktive etmek için% 10 FBS ile ortamda hücreleri kurtarmak; 4 ° C'de 5 dakika 150 x g'de santrifüj hücreleri.
    4. 1 x fosfat tamponlu salin (PBS), hücreleri pelet hücreleri 150 xg'de 5 dakika 4 ° C'de yıkayın. Bu adımı toplam üç yıkama için iki kere tekrarlayın.
    5. Örneklerin sayısı başına 200 mcL RPMI 1640 + 10 mM HEPES (steril) hücreleri tekrar süspansiyon haline getirin. Steril bir tüpe 200 uL hücre süspansiyonu aktarın. Hücreler ~ 0.5 x 107 hücre / mL olmalıdır.
    6. Adım 3.4'te üretilen 20 μL su (sahte negatif kontrol) veya 20 μL RNA (tercihen 5-10 μg) hücrelerin her setine ekleyin. Tüpü hafifçe oynatarak karıştırın ve tüpün içeriğini 2 mm'lik boşluk elektroporasyon küvetine aktarın.
    7. Elektrarı ayarlaOporator 170 V LV, omega (direnç) 0 ve 950 μF'de (kabaca 625 V / cm ve diğer makineler için 20 ms zaman sabiti). Mümkün olan en düşük mevcut ayara direnç ayarlayın, varsa 0 veya ∞.
    8. Pulse bir kez ve hemen adım 4.2'de ısıtılmış DMEM +% 15 FBS + 10 mM HEPES 600 mcL ekleyin. Tüm hücreleri çıkarmak için küvetin içine iyice yıkayın. 10 mL önceden ısıtılmış ortam içeren bir T75 doku kültürü şişesine hücreler ekleyin. Küvette bulunan damlalık kullanarak ilave ortamı küvetlerden çıkarın. Steriliyeti korumaya dikkat edin.
    9. Ortamı ve hücreleri karıştırmak için 37 ° C inkübatöre yerleştirilen Swirl şişesi.
    10. Ertesi gün hücre canlılığı olup olmadığını kontrol edin ve her gün bunu% 50-75 hücre ölümüne kadar bekleyin. Alınan elektroporasyonlu kontrol ile karşılaştırıldığında hücre ölümü gözlemlenir.
      NOT: Vero hücrelerinde ZIKV sitopatik etki (CPE) oldukça belirgindir ve kültür ortamında yüzen hücreleri parçalayıp yuvarlatır. SahibizHasat için ideal olarak 8-10 gün aralığı gözlemledi.
    11. Konik bir tüp içinde süpernatantı hasat edin ve 4 ° C'de 10 dakika süreyle> 3000 xg'deki hücre döküntülerini gidermek için santrifüjleyin.
    12. Berraklaştırılmış süpernatanı yeni bir tüple ve% 20 FBS son konsantrasyonuyla takviye edin (% 100 stoktan). Ayrıca, dondurulmuş haldeyken (1 M steril bir stoktan) virüs enfeksiyonunu korumak için bir tamponlayıcı madde olarak 10 mM'lik nihai konsantrasyonda steril HEPES ekleyin.
    13. Vorteks ve alikot ile vidalı kap şişelerine karıştırın. Gelecekteki kullanım için -80 ° C'de saklayın.

    5. Kurtarılan Virüsün Titrasyonu

    1. Titrasyonun yapılmasından bir gün önce Vero hücrelerinin uygun sayıdaki 6- veya 12 oyuklu plakalarını tohumlayın.
    2. Virüsü dondurucudan çıkarın ve tüplerde veya 96 oyuklu plakalarda DMEM +% 2 FBS içinde seri 10 kat dilüsyonlar yapın.
      NOT: Kurtarılan klonlardan beklenen titre 1 x 10 6 ile 5 x 10 7 PFU / mL arasındadır.
    3. 200 o ekleSırasıyla bir 12 veya 6 oyuklu plakanın bir çukuruna çiftli olarak her bir seyreltmenin 400 uL'lik bir miktarı.
    4. 37 ° C inkübatörde plakalar koyun ve her 15 dakikada bir, ~ 1-1.5 saatlik adsorpsiyon periyodu boyunca kaya yerleştirin.
    5. Viral inokülumu çıkarın ve her göze 1 mL (12-kuyucuklu) veya 2 mL (6-kuyucuklu) DMEM-Tragacanth kaplama ekleyin.
      NOT: Buraya agaroz, agar, metilselüloz veya diğer kaplama malzemeleri kullanmak mümkündür.
    6. 5 gün boyunca 37 ° C inkübatöre hücreleri inkübe edin. Uygun plak oluşumunun süresi, kullanılan kaplamaya bağlı olarak değişir.
    7. Hücreleri düzeltmek için, plakaları inkübatörden çıkarın ve dezenfektana hafifçe dökün.
    8. Kaplamak ve karıştırmak için girdap yapmak için her oyuğa yeterli% 20 etanol /% 0.1 kristal mor (CV) ekleyin.
      NOT: Birçok başka fiksatif var ve burada kullanılabilir. Buna ek olarak, bir agaroz veya agar kaplaması kullanılıyorsa, sabitlemesiz plakları görselleştirmek için nötr kırmızı ile birlikte ikinci bir kaplama kullanılabilir. % 20 etanol var olduğu gösterildiÖnceki çalışmalarda zarflı virüslerin inaktivasyonunda etkili; Zarflanmamış virüsler için bu miktarı kullanmayın, aksi halde devre dışı bırakılmaz 19 .
    9. Plakaları oda sıcaklığında 30-60 dakika inkübe edin (sınıf II biyogüvenlik kabininde); CV'yi atın (yerel yönetmeliklere göre) ve musluk suyuyla yıkayın.
    10. Plakaların kurumasına izin verin ve plakları manuel olarak sayın.
      NOT: Referans 20, plak tahlilleri yapmak için ek bir referans olarak kullanılabilir.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Burada açıklanan protokol, bulaşıcı klon türevi Zika virüsünün iyileşmesine izin verir. İki plazmid bulaşıcı klon sisteminin manipülasyonu, son derece dengesiz olan tam uzunluktaki versiyonlara kıyasla (bakınız veriler gösterilmemiştir), özen gösterildiğinde açıktır. Sindirimden ve iki ayrı parçanın bağlanmasından sonra, T7 polimeraz ile in vitro transkripsiyon kullanılarak kapaklı RNA üretilir ve daha sonra Vero hücrelerine elektroporasyon yapılır ( Şekil 1 ). Doğru plasmid sekansı, miniprep sonrası bir proxy olarak ( Şekil 2a ) kısıtlama sindirimini kullanarak ve RCA veya maxiprep ile büyük ölçekli DNA üretiminden sonra Sanger dizilimi kullanılarak izlenebilir. Sekanslama yoluyla klonların onaylanmasından sonra bulaşıcı virüsün iyileştirilmesi sadece sindirim, ligasyon, in vitro transkripsiyon ve nihayetinde elektroporasyona ihtiyaç duyar. Bu adımlar bir gün içinde yapılabilir. Doğru rakamStrons ve ligasyon agaroz jel elektroforeziyle izlenebilir ( Şekil 2b ), gerekirse sorun gidermeye izin verir.

    Şekil 3'te gösterildiği gibi bulaşıcı klon türevli virüs, çeşitli hücre dizilerinde in vitro ebeveyn izolatı ile benzer seviyelere çoğalmakta ve cDNA'dan alınan virüsün birincil izolata benzer biçimde çoğaldığını düşündürmektedir. Buna ek olarak, Aedes aegypti sivrisineklerinde farelerde hayatta kalma oranları, enfeksiyon, yaygınlaşma ve bulaşma oranları açısından bulaşıcı klon türevi virüs ile ebeveyn izolatı arasında anlamlı bir fark gözlenmemiştir ( Şekil 4 ).

    Şekil 1
    Şekil 1: İki-plasmid cDNA klonundan ZIKV kurtarma iş akışı.ZIKV suşu PRVABC59 genomu iki ayrı parçada bir pACYC177 plasmid omurgasına klonlandı. Daha sonra iki plazmid sindirilmiş ve T4 DNA ligazı ile bağlanmıştır. Kapatılan enfeksiyöz RNA daha sonra in vitro transkripsiyon ile Vero hücrelerine elektroporasyon yoluyla üretildi. (Şekil 21'den uyarlanmış şekil). Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

    şekil 2
    Şekil 2: cDNA klonunun sindirimini ve ligasyonunu izlemek için jel elektroforezi. ( A ) Genetik stabiliteyi değerlendirmek için miniprep türevli plasmidlerin başlangıç ​​kısıtlaması sindirimi. ( B ) İki plazmid klon sisteminden bulaşıcı virüsün toplanması sırasında sindirim ve ligasyon ürünlerinin örnekleri. Href = "http://ecsource.jove.com/files/ftp_upload/55857/55857fig2large.jpg" target = "_ blank"> Bu rakamın daha büyük bir sürümünü görmek için lütfen tıklayınız.

    Şekil 3
    Şekil 3: Klon türevi virüsün in vitro büyüme kinetiği. İnsan (SH-SY5Y, Jar ve NTERA2 cI.D1), sivrisinek (C6 / 36, Aag2) ve insan olmayan primat (Vero) hücre dizileri üzerinde vahşi tip PRVABC59 ve bulaşıcı klon türevi virüsün büyüme kinetiği, plak tahlili ile değerlendirildi. N = 3 Hata çubukları ortalamadan standart sapmayı temsil etmektedir. (Şekil 21'den uyarlanmış şekil). Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

    55857fig4.jpg "/>
    Şekil 4: Farelerde ve sivrisineklerde klon türevi virüsün in vivo karakterizasyonu. ( A ) 4 haftalık erkek ve kadın interferon alfa, beta ve gamma reseptör nakavt AG129, farelere 1,000 PFU PRVABC59 veya enfeksiyöz klon türevi virüs ile intraperitonal olarak inoküle edildi ve hayatta kalmak için zamanla izlendi (n = 11). Aedes aegypti sivrisineği, ZIKV içeren bulaşıcı bir kan mezesine verildi ve 14 gün sonra disseke edildi. ( B ) Plak tahlilleri, enfeksiyöz virüs için sivrisinek bedenlerini (enfeksiyon), bacakları (yayılımı) veya tükrük sekresyonlarını (iletim) değerlendirmek için kullanıldı. Oranlar, test edilen toplam sivrisineklerin yüzdesi olarak sunulmuştur (Referanstan Şekil 21'e uyarlanmıştır). Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Yazarların açıklayacak bir şeyi yok.

    Acknowledgments

    Yazarlar Klon'dan türeyen virüsün karakterize edilmesine yardım ettikleri için Kristen Bullard-Feibelman, Milena Veselinovic ve Claudia Rückert'e teşekkür etmek istiyorlar. Bu çalışma, Ulusal Allerji ve Enfeksiyon Hastalıkları Enstitüsü (NIH) tarafından hibe AI114675 (BJG) ve AI067380 (GDE) altındaki hibelerden kısmen desteklenmiştir.

    Materials

    Name Company Catalog Number Comments
    NEB Stable CompetentE. coli New England BioLabs C3040H
    Carbenicillin, Disodium Salt various
    Zyppy Plasmid Miniprep Kit Zymo Research D4036
    ZymoPURE Plasmid Maxiprep Kit Zymo Research D4202
    SalI-HF New England BioLabs R3138S 20,000 units/ml
    NheI-HF New England BioLabs R3131S 20,000 units/ml
    ApaLI New England BioLabs R0507S 10,000 units/ml
    EcoRI-HF New England BioLabs R3101S 20,000 units/ml
    BamHI-HF New England BioLabs R3136S 20,000 units/ml
    HindIII-HF New England BioLabs R3104S 20,000 units/ml
    illustra TempliPhi 100 Amplification Kit GE Healthcare Life Sciences 25640010
    NucleoSpin Gel and PCR Clean-up Macherey-Nagel 740609.5
    Shrimp Alkaline Phosphatase (rSAP) New England BioLabs M0371S 1,000 units/ml
    Alkaline Phosphatase, Calf Intestinal (CIP) New England BioLabs M0290S 10,000 units/ml
    T4 DNA Ligase New England BioLabs M0202S 400,000units/mL
    HiScribe T7 ARCA mRNA Kit New England BioLabs E2065S
    Vero cells ATCC CCL-81
    ECM 630 High Throughput Electroporation System BTX 45-0423 Other machines are acceptable.
    LB Broth with agar (Miller) Sigma L3147 Can be homemade as well.
    Terrific Broth Sigma T0918 Can be homemade as well.
    Petri Dish Celltreat 229693
    Culture Tubes VWR International 60818-576
    T75 flasks Celltreat 229340
    T182 flasks Celltreat 229350
    1x PBS Corning 21-040-CV
    RPMI 1640 with L-glutamine Corning 10-040-CV
    DMEM with L-glutamine and 4.5 g/L glucose Corning 10-017-CV
    Fetal Bovine Serum (FBS) Atlas Biologicals FP-0500-A
    Tragacanth Powder MP Bio MP 104792
    Crystal Violet Amresco 0528-1006
    Ethanol Denatured VWR International BDH1156-1LP
    6 well plate Celltreat 229106
    12 well plate Celltreat 229111
    Sequencing Oligos IDT see table 1
    Qubit 3.0 ThermoFisher Qubit 3.0 other methods are acceptable.
    Qubit dsDNA BR Assay Kit ThermoFisher Q32850 other methods are acceptable.
    Qubit RNA HS Assay Kit ThermoFisher Q32852 other methods are acceptable.
    Class II Biosafety Cabinet Varies N/A This is necessary for live-virus work.

    DOWNLOAD MATERIALS LIST

    References

    1. Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 94, (9), 675C-686C (2016).
    2. Oehler, E., et al. Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013. Euro Surveill. 19, (9), (2014).
    3. Li, D., Aaskov, J., Lott, W. B. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome. PLoS One. 6, (3), e18197 (2011).
    4. Pu, S. Y., et al. A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J Gen Virol. 95, (Pt 7), 1493-1503 (2014).
    5. Pu, S. Y., et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 85, (6), 2927-2941 (2011).
    6. Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1, (3), 285-296 (1989).
    7. Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. Development and application of a reverse genetics system for Japanese encephalitis virus. J Virol. 77, (11), 6450-6465 (2003).
    8. Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 79, (Pt 3), 437-446 (1998).
    9. Johansen, I. E. Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc Natl Acad Sci U S A. 93, (22), 12400-12405 (1996).
    10. Shan, C., et al. An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe. 19, (6), 891-900 (2016).
    11. Schwarz, M. C., et al. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere. 1, (5), (2016).
    12. Tsetsarkin, K. A., et al. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development. MBio. 7, (4), (2016).
    13. Gadea, G., et al. A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene. Virology. 497, 157-162 (2016).
    14. Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene. 162, (2), 175-180 (1995).
    15. Messer, W. B., et al. Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization. PLoS Negl Trop Dis. 6, (2), e1486 (2012).
    16. Kinney, R. M., et al. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol. 87, (Pt 12), 3611-3622 (2006).
    17. Chang, A. C., Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, (3), 1141-1156 (1978).
    18. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. 91, (1), (2017).
    19. Roberts, P. L., Lloyd, D. Virus inactivation by protein denaturants used in affinity chromatography. Biologicals. 35, (4), 343-347 (2007).
    20. Baer, A., Kehn-Hall, K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp. (93), e52065 (2014).
    21. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. (2016).
    22. Grubaugh, N. D., et al. Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching. Cell Host Microbe. 19, (4), 481-492 (2016).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics