Een protocol voor meerdere gene-knock-out in muizen, kleine darmorganen, met behulp van een CRISPR-concatemer

Bioengineering
 

ERRATUM NOTICE

Summary

Dit protocol beschrijft de stappen voor het kloneren van meerdere single-guide RNA's in een RNA-concatemervector, die bijzonder geschikt is voor het creëren van multi-gen-knockouts met behulp van CRISPR / Cas9-technologie. De opkomst van dubbele knockouts in darmorganoïden wordt getoond als een mogelijke toepassing van deze methode.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Merenda, A., Andersson-Rolf, A., Mustata, R. C., Li, T., Kim, H., Koo, B. K. A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. J. Vis. Exp. (125), e55916, doi:10.3791/55916 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CRISPR / Cas9-technologie heeft de haalbaarheid en snelheid van verlies-van-functie studies aanzienlijk verbeterd die essentieel zijn voor het begrijpen van de genfunctie. Bij hogere eukaryoten kunnen paraloge genen een potentieel fenotype maskeren door het verlies van een gen te compenseren, waardoor de informatie die kan worden verkregen uit genetische studies op basis van enkelvoudige gen-knockouts, worden beperkt. We hebben een nieuwe, snelle kloneringsmethode ontwikkeld voor guide-RNA (gRNA) concatemers om multi-gen knockouts te creëren na een enkele transfectie in de kleine darmorganoïden van de muis. Onze strategie zorgt voor de concatemerisatie van maximaal vier individuele gRNA's in een enkele vector door een enkele Golden Gate shuffling reactie met geflatteerde gRNA oligos en een vooraf ontworpen retrovirale vector uit te voeren. Dit maakt het mogelijk de gelijktijdige uitslag van maximaal vier verschillende genen of verhoogde knock-out efficiëntie na te streven naar het doel van één gen door meerdere gRNA's. In dit protocol tonen we in detailHoe om meerdere gRNA's efficiënt te klooneren in de retrovirale CRISPR-concatemervector en hoe u zeer efficiënte elektroporatie in darmorganoïden kunt bereiken. Als voorbeeld laten we zien dat tegelijkertijd uitzetten van twee genen die coderen voor negatieve regulatoren van de Wnt-signaalbaan (Axin1 / 2 en Rnf43 / Znrf3) intestinale organoïden resistent maken tegen de terugtrekking van belangrijke groeifactoren.

Introduction

De omgekeerde genetica benadering is een veel gebruikte methode om de functie van een gen te onderzoeken. In het bijzonder, loss-of-function studies, waarbij ontwrichting van een gen fenotypische veranderingen veroorzaakt, een sleutelrol spelen in het bouwen van ons begrip van biologische processen. De CRISPR / Cas9 methode vertegenwoordigt de meest recente vooruitgang in de genome engineering technologie en heeft de huidige praktijk van genetica in cellen en organismen omgezet. Cas9 is een RNA-geleidend endonuclease dat bindt aan een specifieke DNA-sequentie die complementair is met het gRNA en genereert een double-strand break (DSB). Deze DSB werft DNA-reparatiemachines aan die, in afwezigheid van een DNA-sjabloon voor homologe recombinatie, de gesneden DNA-streng via een foutgebonden niet-homologe eindverbinding zullen herlichamen, die aldus kan resulteren in inserties of deleties van nucleotide (s) Veroorzaakt veranderingen in frameshift 1 .

Het grote gemak en de veelzijdigheid van de CRISPR / Cas9 apprOach heeft het een zeer aantrekkelijk gereedschap gemaakt voor genoom schaal knockout schermen gericht op het ontrafelen van onbekende genfuncties 2 , 3 . Niettemin zijn enkelvoudige genknockout benaderingen van beperkt gebruik als meerdere paralogenen met redundante functies bestaan. Aldus kan het ablatie van een enkel gen niet genoeg zijn om de functie van dat gen te bepalen, waardoor mogelijke vergoeding door paralogenen wordt veroorzaakt, wat weinig of geen fenotypische verandering tot gevolg heeft 4 . Het is daarom belangrijk parallelle parallels uit te schakelen door meerdere gRNA-vectoren te leveren die de verschillende paralogegenen richten om de invloed van genetische compensatie te overwinnen.

Om het gebruik van CRISPR / Cas9 uit te breiden tot paraloge gen-knock-out, hebben we onlangs een snelle, een-stap-kloneringsmethode ontwikkeld om maximaal vier voorafgegloeide gRNA's in een enkele retrovirale vector 5 te kloonmen. De ruggengraat, genaamd CRISPR-concatemer, is gebaseerdOp een MSCV retrovirale plasmide die repetitieve gRNA expressiecassettes bevat. Elke cassette bevat twee omgekeerde herkenningssites van het Type IIS-restrictie-enzym Bbs I, die onomkeerbaar kan worden vervangen door een geflatteerde gRNA-oligo met bijpassende overhangen door gebruik te maken van een Golden Gate-shuffling-reactie in een enkele buis 6 . Deze kloneringsmethode bestaat uit herhalende cycli van vertering en ligatie die gelijktijdige assemblage van meerdere DNA-fragmenten mogelijk maken door de verschillende overhangsequenties die door Bbs I worden gegenereerd te exploiteren. De uniekheid van dit enzym is bijvoorbeeld het vermogen om asymmetrische snijdingen buiten zijn herkenning uit te voeren volgorde; Daarom kan elke cassette een andere sequentie hebben met aangepaste overhangende flankerende Bbs I kernplaats en op deze manier kan elk gRNA in een specifieke positie en oriëntatie van de concatemervector worden gekloneerd.

Als principieel bewijs hebben we het gebruik van deze strategie aangetoondMuizen darmorganoïden door tegelijkertijd twee paren paraloge negatieve regulatoren van de Wnt-weg te verstoren door één ronde elektroporatie 5 .

In de afgelopen jaren hebben veel andere groepen soortgelijke strategieën ontwikkeld die gebaseerd zijn op meerdere gRNA-expressievectoren die zijn geconstrueerd met behulp van Golden Gate shuffling 7 om multi-gen knock-out te bereiken in diverse modelsystemen, zoals menselijke cellijnen 8 , 9 , zebravis 10 en Escherichia coli 11 . In hun protocollen worden gRNA's eerst gekloneerd in afzonderlijke tussenvectoren en dan samengevoegd in één eindproduct. Daarentegen is het belangrijkste voordeel van onze CRISPR-concatemerstrategie het gemak van een enkele Bbs I shuffling, kloningstap. Net als bij andere gRNA concatemers, maakt onze methode het mogelijk om tegelijkertijd de gelijktijdige uitschakeling van maximaal vierVerschillende genen of verhoogde CRISPR knock-out efficiëntie als gevolg van de targeting van een of twee genen met meerdere gRNA's ( Figuur 1 ).

In dit protocol beschrijven we elke stap in de generatie van CRISPR-concatemervectoren, van gRNA-ontwerp tot de Golden Gate-reactie en tot bevestiging van succesvol klonen. Wij bieden ook een zeer efficiënt protocol voor de transfectie van CRISPR-concatemers in kleine darmorgano's door middel van elektroporatie en daaropvolgende groeifactor-onttrekkingsexperimenten.

Protocol

1. GRNA Ontwerp voor de CRISPR-concatemer Vector

Opmerking: Het doel van dit gedeelte is om uit te leggen hoe u de beste targetingstrategie kunt kiezen en hoe u gRNA's wilt ontwerpen die specifieke overhangen voor de CRISPR-concatemervector bevatten.

  1. Ontwerp gRNA's tegen de genen die interessant zijn met behulp van een CRISPR gRNA design tool van keuze. Zie de tabel van materialen voor een voorbeeld.
    OPMERKING: Bij het richten op een paar paraloge genen, hoewel het mogelijk is om één gRNA per gen te ontwerpen, is het raadzaam twee gRNA's per gen te ontwerpen om de kansen te vergroten om een ​​dubbele knock-out te verkrijgen ( Figuur 1 ).
  2. Zorg ervoor dat de gRNA's de herkenningssite van Bbs I niet bevatten door gebruik te maken van een restrictie-mapping tool (zie de tabel van materialen voor een voorbeeld).
  3. Voeg specifieke overtrekken van de CRISPR-concatemer toe aan elke oligo, zoals getoond in Tabel 1 .
"Voor: keep-together.within-page =" 1 "voor: keep-with-next.within-page =" always "> Cassette 1 Cassette 2 Cassette 3 Cassette 4 Sequentie (5'-3 ') CACCGG [gRNA1] GT ACCGG [gRNA2] G CCGG [gRNA3] ACACCGG [gRNA4] GTT Sequentie (5'-3 ') TAAAAC [RC-gRNA1] CC AAAAC [RC-gRNA2] C AAAC [RC-gRNA3] CTAAAAC [RC-gRNA4] CCG

Tabel 1: Overhangen voor elke cassette van de CRISPR-concatemer Vector.

2. Klonen van gRNA's in de CRISPR-concatemer Vector

  1. Fosforylering en annealing van oligo's
    OPMERKING: Deze stap illustreert hoe tO anneale bovenste en onderste strengen voor elke gRNA oligo en hoe ze hun einden in een enkele reactie fosforyleren.
    1. Bereid het reactiemengsel voor fosforylerende oligo's en annealing boven- en onderstrengen op ijs, volgens de onderstaande instructies.
      OPMERKING: Alle oligo's kunnen in één reactie worden samengevoegd; Bijvoorbeeld, in het geval van een 4 gRNA-concatemervector, 8 oligo's samenvoegen.
    2. Voor 3 concatemers gebruikt u 3,0 μL gRNA topstreng (1,0 μL van elk gRNA, 10 μM, 1 μL / gRNA), 3,0 μL gRNA bodemstreng (1,0 μL van elk gRNA; 10 μM, 1 μL / gRNA), 2,0 μl T4 DNA ligasebuffer (10x), 1,0 pl T4 PNK en voeg H2O tot totaal volume van 20,0 pl.
    3. Meng goed door pipetten en laat deze in een thermocycler draaien met de volgende instellingen: 37 ° C gedurende 30 minuten, 95 ° C gedurende 5 minuten, helling tot 25 ° C bij 0.3 ° C / min, houd bij 4 ° C.
  2. Bbs ik schudde reactie
    OPMERKING: In deze sectie worden de voorgegloeide gRNA-oligo's in een geschikte positie van de concatemervector in één stap opgenomen door wisselende cycli van vertering en ligatie.
    1. Verdun het reactiemengsel 1: 100 in DNase / RNase-vrij water om 3 en 4 gRNA-concatemervectoren te genereren.
      OPMERKING: bij het klonen van 2 gRNA-concatemers is deze stap niet nodig.
    2. Monteer de Bbs I shuffling reactie op ijs, volgens de onderstaande instructies. Inclusief een negatieve controle die alleen de vector bevat.
    3. Gebruik 100 ng CRISPR-concatemervector, 10,0 μl oligomengsel, 1,0 μl BSA bevattende restrictie-enzymbuffer (10x), 1,0 μl DTT (10 mM), 1,0 μL ATP (10 mM), 1,0 μl Bbs I, 1,0 μl T7-ligase en H2O tot totaal volume van 20,0 pl.
    4. Meng goed door pipettering en loop dit in een thermocycler met de volgende instellingen: Run 50 cycli voor het klonen van 3 en 4 gRNA-concatemers en houd bij 15 ° C bij 37 ° C, dan 4 ° C voor altijd.
  3. Exonuclease behandeling
    OPMERKING: Deze stap wordt sterk aanbevolen aangezien het de efficiëntie van het klonen verhoogt door het verwijderen van lijnen van gel lineariseerd DNA.
    1. Behandel de Bbs I shuffling reactie met een DNA exonuclease (zie Table of Materials ) als volgt.
    2. Neem 11,0 μl ligatiemix uit de vorige stap (2.2.3), voeg 1,5 μL exonucleasebuffer (10x), 1,5 μL ATP (10 mM), 1,0 μL DNA exonuclease toe en breng het totale volume tot 15,0 μL met water op. Incubeer bij 37 ° C gedurende 30 min gevolgd door 70 ° C gedurende 30 min.
      OPMERKING: Deze stap verwijdert elk residueel gelineariseerd DNA in het mengsel en verhoogt daarmee de kloneringsefficiëntie.
    3. Gebruik 2 μL van het reactiemengsel voor transformatie in chemisch compeTent E. coli bacteriën door hitte schok 12 .
      OPMERKING: Alternatief kan de reactie gedurende maximaal een week bij -20 ° C worden opgeslagen.
  4. Beperking spijsvertering
    OPMERKING: Het doel van deze stap is om door middel van restrictievertering het succes van de kloneringsprocedure te beoordelen.
    1. Om de aanwezigheid van gRNA-inserts in de CRISPR-concatemervector te bevestigen, kies 4 tot 8 bacteriële kolonies met een inoculatielus, groei elke kloon in 4 ml LB-medium 's nachts bij 37 ° C in een orbitale shaker. Extract DNA met behulp van een plasmide miniprep kit volgens de instructies van de fabrikant (zie de Tabel van Materialen ).
    2. Digest ~ 200 ng DNA met 10 U EcoR I + 5 U Bgl II in een 10 μL reactie door het gedurende 3 uur bij 37 ° C in een bacterie-incubator te incuberen. Inclusief een afzonderlijk reactiemengsel met de corresponderende originele vector als een positieve controle voor groottevergelijking.
      OPMERKING: ThiS zal bevestigen of alle concatemers aanwezig zijn, aangezien deze twee restrictie-enzymen volledige concatemers zullen accijnzen. Dit zijn de verwachte maten voor elke concatemer: 2 gRNA-concatemer (800 bp), 3 gRNA-concatemer (1,2 kbp) en 4 gRNA-concatemer (1,6 kbp).
    3. Voer digestie reacties op een 1% agarosegel bij 90 V gedurende ongeveer 20 minuten.
    4. Visualiseer de gel met behulp van een UV-transilluminator. Identificeer de klonen met de juiste invoeggrootte door ervoor te zorgen dat hun bandpatroon overeenkomt met de oorspronkelijke vector en dat elk fragment de verwachte grootte heeft door een DNA-ladder te gebruiken.
    5. Digest de geselecteerde klonen met 5 U Bbs I bij 37 ° C gedurende 3 uur in een bacterie incubator. Inclusief een aparte reactiemix met de corresponderende originele vector als een controle.
      OPMERKING: Deze extra spijsverteringstap is om te bevestigen dat gRNA's in de juiste positie zijn gekloneerd en bijgevolg zijn alle Bbs I herkenningsplaatsen verloren gegaan.
    6. Voer digestie reacties opEen 1% agarosegel bij 90 V gedurende ongeveer 20 minuten. Beschouw als correct alleen de vectoren die niet door Bbs I worden gesneden aangezien ze alleen gRNAs bevatten.
  5. Vector sequentiebepaling
    OPMERKING: Het doel van deze stap is het bevestigen van de aanwezigheid van gRNA-sequenties in die vectoren die zijn geïdentificeerd als correct door restrictie-verteringsanalyse.
    1. Bevestig positieve concatemervectoren door Sanger sequencing 13 met behulp van de volgende primers:
      Vooruit: TCAAGCCCTTTGTACACCCTAAG (voor het controleren van de eerste gRNA cassette)
      Linker1_Forward: GACTACAAGGACGACGATGACAA (voor het controleren van de tweede gRNA cassette)
      Linker2_Reverse: GGCGTAGTCGGGCACGTCGTAGGGGT (voor het controleren van de tweede gRNA-cassette)
      Linker2_Forward: ACCCCTACGACGTGCCCGACTACGCC (voor het controleren van de derde gRNA cassette)
      Linker3_Reverse: TCCTCCTCTGAGATCAGCTTCTGCAT (voor het controleren van de derde gRNA cassette)
      Reverse: AGGTGGCGCGAAGGGGCCACCAAAG (voor het controleren van de laatste gRNAcassette)
    2. Controleer de aanwezigheid van alle gRNA's door hun sequenties te zoeken in de sequentiebepaling.

3. Transfectie van darmorganoïden door elektroporatie

OPMERKING: Houd er rekening mee dat deze procedure is gebaseerd op het protocol dat door Fujii et al is gepubliceerd . In 2015, met aanpassing voor kleine darmorganoïde culturen van de muis 14 .

  1. Pre-elektroporatie
    OPMERKING: In dit gedeelte wordt beschreven hoe u de maagdarmorganoïden voorbereidt voor elektroporatie door alle antibiotica en geconditioneerde media uit hun cultuurmedium te verwijderen. Dit voorkomt mogelijke toxische effecten tijdens elektroporatie.
    1. Op dag 0 van de transfectie procedure, gesplitst organoïden in een 1: 2 verhouding.
      OPMERKING: Intestinale organoïdeculturen kunnen worden verkregen door het uitvoeren van cryptisolatie volgens eerder ingestelde protocollen 15 . Gelieve te verwijzen naar
    2. Bij het splitsen van organoïden voor elektroporatie, zaaien minimaal 6 putjes van een 48-putjesplaat per transfectie.
    3. Zaad de organoids in 20 pl-kelder matrix druppels en groeien ze in WENR + Nic medium (Wnt + EGF + Noggin + R-spondin + Nicotinamide) bij 37 ° C, 5% CO2 in een bevochtigde incubator (zoals eerder beschreven 15) .
  2. Op dag 2, verander het medium door WENR + Nic te vervangen door 250 μL EN (EGF + Noggin) + CHIR99021 (Glycogen Synthase Kinase-3 inhibitor) + Y-27632 (ROCK inhibitor), zonder antibiotica (zie tabel 2 ).
    OPMERKING: In alle stappen wordt de hoeveelheid medium toegevoegd aan elke putje van een 48-putjesplaat 250 μL.
  3. Op dag 3, verander het organoid medium naar EN + CHIR99021 + Y-27632 + 1,25% v / v Dimethyl sulfoxide (DMSO), zonder antibiotica.
  • Bereiding van de cellen
    NOTITIE:Hier beschrijven we hoe u organoïden in kleine celclusters kunt fragmenteren door mechanische en chemische dissociatie. Deze stappen zijn van cruciaal belang voor het succes van de procedure.
    1. Op dag 4, verstrooi de keldermatrixkoepels met een pipetip van 1 ml en overbreng organoïden naar een 1,5 ml buis. De inhoud van de pool van vier putjes van een 48-putjesplaat in een buis.
    2. Mechanisch breken organoïden in kleine fragmenten door pipettering omhoog en omlaag met een P200 pipet ongeveer 200 keer. Centrifuge bij kamertemperatuur, 5 minuten bij 600 x g.
    3. Verwijder het medium en resuspendeer de pellet in 1 ml van een recombinant protease van celkweekgraad (zie tabel van materialen). Incubeer bij 37 ° C gedurende maximaal 5 minuten en controleer dan een 50 μL druppel monster onder een omgekeerde lichtmicroscoop met een 4x objectief.
      OPMERKING: Clusters van 10-15 cellen zijn gewenst, omdat dit celoverleving na elektroporatie toeneemt.
    4. Breng de celsuspensie over naar een laagbindende 15 ml buis en stop deDissociatie door 9 ml basaal medium zonder antibiotica toe te voegen (zie tabel 2 ). Centrifugeer bij kamertemperatuur, 5 minuten bij 600 xg, doe dan de supernatant af en verwijder de pellet in 1 ml gereduceerd serummedium (zie tabel van materialen ).
    5. Tel het aantal cellen met een kamer van Bürker en gebruik minimaal 1 x 10 5 cellen per elektroporatie-reactie. Voeg 9 ml gereduceerd serummedium toe aan de 15 ml buis en centrifuge bij kamertemperatuur, 3 min bij 400 x g.
  • elektroporatie
    OPMERKING: In de volgende secties worden instructies gegeven over het uitvoeren van elektroporatie en organoïden te herstellen.
    1. Verwijder al het supernatant en resuspendeer de pellet in een elektroporatie-oplossing (zie tabel van materialen ). Voeg een totale hoeveelheid 10 μg DNA toe aan de celsuspensie en voeg elektroporatieoplossing toe aan een eindvolume van 100 μl en houd de cel-DNEen mengsel op ijs. Gebruik CRISPR-concatamer-vectoren in combinatie met een Cas9-expressieplasmide ( bijv. Addgen # 41815) in een verhouding van 1: 1.
      OPMERKING: Het totale volume van het toegevoegd DNA moet minder dan of gelijk zijn aan 10% van het totale reactievolume.
    2. Inclusief een aparte transfectiemengsel die een GFP-plasmide bevat om transfectie-efficiëntie te evalueren ( bijv . PCMV-GFP, Addgen # 11153 of een ander generisch GFP-expressieplasmide).
    3. Voeg het cel-DNA-mengsel toe aan de elektroporatie-cuvette en plaats het in de elektroporatorkamer. Meet de impedantie door op de juiste knop op de elektroporator te drukken en ervoor te zorgen dat het 0,030-0,055 Ω is. Voer elektroporatie uit volgens de instellingen in tabel 3 .
      OPMERKING: als de impedantiewaarde buiten het toegestane bereik valt, moet u het volume van de oplossing in de cuvette aanpassen.
    4. Voeg 400 μL elektroporatiebuffer + Y-27632 toe aan de cuvette en laat deze vervolgens overbrengen naar een 1,5 ml buis. IncubaTe bij kamertemperatuur gedurende 30 minuten om cellen te laten herstellen en vervolgens gedurende 3 minuten op kamertemperatuur te draaien bij 400 x g.
    5. Verwijder de supernatant en resusteer de pellet in 20 μL / putje van de keldermatrix. Zaai ongeveer 1 x 10 4 tot 1 x 10 5 cellen per putje in een 48-putjesplaat en voeg EN + CHIR99021 + Y-27632 + 1,25% v / v DMSO-medium toe. Incubeer bij 37 ° C.
    6. Op dag 5, verander het medium naar EN + CHIR99021 + Y-27632, en controleer transfectie-efficiëntie door GFP-expressie te waarnemen ( Figuur 2 ). Houd organoïden bij 37 ° C en ververs EN + CHIR99021 + Y-27632 medium na 2 dagen.
    7. Op dag 9, verander het medium naar WENR + Nic + Y-27632 en incubeer bij 37 ° C.
      OPMERKING: Y-27632 kan na 7-10 dagen verwijderd worden (op dag 16-19).
  • Poring puls Transferpuls
    Spanning 175V 20V
    Pulslengte 5 ms 50 msec
    Pulse interval 50 msec 50 msec
    Aantal pulsen 2 5
    Decay rate 10% 40%
    Polariteit + +/-

    Tabel 3: Elektroporatie instellingen.

    4. Groei Factor Intrekking

    Opmerking: Hier wordt een voorbeeld gegeven van het uitvoeren van een groeifactor-terugtrekkingsexperiment bij het uitschakelen van negatieve regulatoren van de Wnt-weg in darmorganoïden.

    1. 10-14 dagen avteR elektroporatie, verdeel de organoïden in een 1: 3 verhouding in een 48-putjesplaat volgens de bovenstaande stappen (3.2.1 - 3.2.2).
    2. Resuspendeer de organoidpellet in 20 μl basementmembraanmatrix en laat het gedurende 10 minuten bij 37 ° C stollen. Vervolgens overlay 250 μL groeifactor-beroofd medium ( bijvoorbeeld EN) om te testen of knock-out van de doelgenen is bereikt 5 .
    3. Verdeel de organoïden onder groeifactor-beroofde omstandigheden voor een minimum van 2 - 3 passages om een ​​verschil in overleving te zien tussen wildtype (WT) controleorganoïden en mutante organoïden 5 , 15 .
      OPMERKING: Wildtype-organoïden mogen niet overleven in groeifactor-beroofd medium over twee passages, terwijl mutantlijnen kunnen groeien.

    Representative Results

    Om de aanwezigheid van het juiste aantal gRNA-inserts in de concatemervector te bevestigen, wordt restrictievertering uitgevoerd met enzymen ( EcoR I + Bgl II) die alle gRNA-expressiecassettes flankeren (elke cassettegrootte is ~ 400 bp, Figuur 1 ). Bijvoorbeeld, bij het genereren van een 4 gRNA-concatemervector is de verwachte grootte van de onderste band in de agarosegel ongeveer 1,6 Kbp; Elke band die lager is dan dit geeft aan dat niet alle 4 gRNA cassettes in de vector worden ingevoegd ( Figuur 2A ). Bovendien wordt het altijd aanbevolen om te controleren of alle Bbs I herkenningssites verloren gaan en het enzym niet de vector snijdt ( Figuur 2B ).

    Zodra de constructen zijn bevestigd, kunnen ze door middel van elektroporatie aan muizen darmorganoïden worden afgeleverd om optima te bereikenL-niveaus van transfectie-efficiëntie (tot 70%), zoals blijkt uit de GFP-controle ( Figuur 3 ).

    Ten slotte, om de efficiëntie van deze strategie functioneel te testen, werden intestinale organoïden getransfecteerd met Cas9 en concatemervectoren tegen Axin1 / 2 en Rnf43 / Znrf3 gekweekt in EN (R-spondine-terugtrekking) en EN + IWP2 (R-spondin en Wnt-terugtrekking, IWP2 : Porcupine inhibitor, 2,5 μM) media voor minimaal 3 passages ( Figuur 4 ). Terwijl niet-getransfecteerde WT-organoïden onder beide omstandigheden overleed, hebben Axin1 / 2-knock-out-organoïden overgebleven in beide door de stroomopwaartse activering van de Wnt-weg; Daarnaast overleven Rnf43 / Znrf3 mutante organoïden in afwezigheid van R-spondine, maar kunnen niet overleven in aanwezigheid van IWP2, waardoor de Wnt wordt veroorzaakt die de wint activeert. Samengevat laten deze waarnemingen zien dat uitputting van deze paralogenen mogelijk is door het genereren van tHij verwacht organoid fenotype. Details van deze resultaten zijn gepubliceerd in Ontwikkelingsbiologie 5 .

    Figuur 1
    Figuur 1: Schematische weergave van de CRISPR-concatemer met 4 cassettes. Schema van de 4 gRNA-concatemer vector met elke 400 bp cassette die een U6 promotor bevat, twee omgekeerde herhaalde Bbs I plaatsen (ook aangeduid als BB) en gRNA scaffold in deze volgorde. Tijdens de shuffling reactie worden Bbs I sites vervangen door gRNA fragmenten met bijpassende overhangen en daarmee verloren. Bindende plaatsen van de sequentieprimers voor het controleren van de juiste invoeging van gRNA-oligo's worden getoond door de blauwe pijlen. Fwd = voorwaartse primer, Rev = reverse primer, Link 1/2/3 = linker gebieden 1/2/3. Gelieve cLik hier om een ​​grotere versie van deze figuur te zien.

    Figuur 2
    Figuur 2: Representatieve digestiepatronen van Concatemervectoren. ( A ) Dubbele vertering van 3 en 4 gRNA-concatemervectoren met EcoR I en Bgl II. Het juiste spijsverteringpatroon wordt gemarkeerd met een groene vinkje, terwijl vectoren met slechts 1 of 2 gRNA inserties gemarkeerd zijn met een rood kruis. Laan 1 toont vertering van een 4 gRNA-concatemer ouderlijke vector gebruikt als positieve controle (gemarkeerd door "+"); Op soortgelijke wijze toont baan 5 vertering van een 3 gRNA-concatemer ouderlijke vector, gemarkeerd door "+". ( B ) Spijsvertering met Bbs I, met de juiste grootte van onverteerde concatemervectoren (aangegeven door de groene tekenluikjes). Digestie van een gRNA-bevattende concatemervector die Bbs I-sites heeft verloren, wordt gebruikt als een positieve controle anD is gemarkeerd met "+". Klik hier om een ​​grotere versie van deze figuur te bekijken.

    Figuur 3
    Figuur 3: Representatief beeld van succesvol geëlektroporeerde darmorganoïden. Transfectie van een GFP plasmide is instrumenteel om transfectie-efficiëntie te evalueren. Ongeveer 24 uur na elektroporatie, zijn organoïden die een klein aantal cellen bevatten, al zichtbaar en, als de elektroporatieprocedure succesvol was, vertoonde tot 70% groene fluorescentie. BF = helder veld, GFP = groen fluorescerend eiwit. Schaalbalk = 2.000 μm. Klik hier om een ​​grotere versie van deze figuur te bekijken.


    Figuur 4: Representatieve beelden van mutant darmorganoïden. Knock-out van de negatieve regulatoren van de Wnt-route Axin1 en Rnf43, samen met hun paraloggen, maakt de darmorganoïden resistent tegen groeifactor-deprivatie. In het bijzonder kunnen Axin1 / 2 knockout organoïden (Axin1 / 2 KO) groeien in afwezigheid van zowel R-spondine (EN: EGF + Noggin) en Wnt (EN + IWP2: EN + Porcupine inhibitor), terwijl Rnf43 / Znrf3 mutante organoïden (R & Z KO) kan alleen overleven bij afwezigheid van R-spondine (EN). In tegenstelling, kunnen WT organoïden alleen overleven in de controlecultuur conditie, WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nicotinamide). Schaalstaven = 1000 μm. Klik hier om een ​​grotere versie van deze figuur te bekijken.

    Basaal medium Comments
    Bewaar bij 4 ° C gedurende 4 weken
    Celcultuurmedium 500 ml Zie tabel van materialen
    L-Glutamine 100x 5 ml
    Buffermiddel 1 M 5 ml Zie tabel van materialen
    Penicilline Streptomycine 100x 5 ml
    WENR + Nic (Wnt + EGF + Noggin + R-spondine + Nicotinamide)
    Bewaar bij 2 ° C bij 4 ° C
    Basaal medium Tot 50 ml
    Neuronale cel serumvrije aanvulling (50x) 1 ml Zie tabel van materialen
    Neuronale cel serumvrije aanvulling (100x) 500 μl Zie tabel van materialen
    N-acetylcysteïne (500 mM) 125 μl
    Muis EGF (100 μg / ml) 25 μl
    Muis Noggin (100 μg / ml) 50 μl
    R-Spondin geconditioneerd medium 5 ml
    Wnt3a geconditioneerd medium 25 ml
    Nicotinamide (1 M) 250 μl
    EN + CHIR + Y-27632 (EGF + Noggin + CHIR + Y-27632)
    Bewaar bij 2 ° C bij 4 ° C
    Basaalmedium zonder Penicilline Streptomycine Tot 20 ml
    Neuronale cel serumvrije aanvulling (50x) 400 μl Zie tabel van materialen
    Neuronale cel serumvrije aanvulling (100x) 200 μl Zie tabel van materialen
    N-acetylcysteïne (500 mM) 50 μl
    Muis EGF (100 μg / ml) 10 μl
    Muis Noggin (100 μg / ml) 20 μl
    Y-27632 (10 uM) 20 μl
    CHIR99021 (8 μM) 10 μl
    EN (EGF + Noggin)
    Bewaar bij 4 ° C gedurende 4 weken
    Basaal medium Tot 50 ml
    Neuronale cel serumvrije aanvulling (50x) Zie tabel van materialen
    Neuronale cel serumvrije aanvulling (100x) 500 μl Zie tabel van materialen
    N-acetylcysteïne (500 mM) 125 μl
    Muis EGF (100 μg / ml) 25 μl
    Muis Noggin (100 μg / ml) 50 μl

    Tabel 2: Organoid Media Compositie.

    Discussion

    In dit protocol worden alle stappen beschreven die nodig zijn om CRISPR-concatemers te genereren en CRISPR-concatemers in maagdarmorganen toe te passen teneinde tegelijkertijd meerdere genen uit te schakelen. Zoals eerder vermeld, heeft deze strategie diverse voordelen, zoals snelheid, hoge efficiëntie en kosteneffectiviteit.

    Om de hele procedure succesvol uit te voeren, zijn er een aantal kritische aspecten om te overwegen. Ten eerste is het van essentieel belang dat alle gRNA-oligo's goed gehydneerd en gefosforyleerd worden, aangezien zij het uitgangsmateriaal voor de Bbs I-kloneringsreactie vormen die op zichzelf zeer efficiënt is. Ten tweede, wanneer de elektro-organiserende organoïden, hoe meer cellen per conditie gebruikt worden, hoe hoger de maximale mogelijke transfectie-efficiëntie. Daarnaast is het ook belangrijk dat na celledissociation kleine cellenclusters over enkele cellen overheersen.

    Niettemin is het mogelijk technische problemen te ondervindenLems wanneer het voor het eerst de kloning of de transfectie probeert; In het geval van problemen tijdens gRNA-klonen, wordt aanbevolen de gRNA-oligo-sequentie te controleren en, indien juist, extra bacteriële kolonies voor restrictie-digestie-screening te selecteren. Als transfectie-efficiëntie en cellevendabiliteit laag zijn na elektroporatie, is het raadzaam om het protocol te herhalen met meer cellen per conditie en de tijd van celledissociatie tot 3 minuten te verminderen.

    Hoewel de generatie CRISPR-concatemers relatief goedkoop en makkelijk is, is het uitvoeren van grotere schaalgenetische schermen in organoïden niet, aangezien de schaal beperkt wordt door de kosten die verband houden met organo-cultuur en door zijn arbeidsintensieve aard. In dit geval is het vermeldenswaardig dat de CRISPR-concatemer methode ook compatibel is met cellijnen, zoals HEK293 en muis embryonale stamcellen.

    Ongeacht het cellulaire systeem, een ander potentieel nadeel van deze sTrategy kan worden geconfronteerd als het richt op de gelijktijdige uitklap van drie of vier verschillende genen. Bijvoorbeeld, elke gRNA zal een andere targeting efficiëntie hebben en de veranderingen om alle genen tegelijk te slaan kunnen relatief laag zijn; Om deze reden is het raadzaam het concatemer systeem aan te zetten om meer dan één gRNA tegen hetzelfde gen te leiden.

    Alternatieve strategieën die op gelijke wijze gebaseerd zijn op Golden Gate shuffling zijn in de loop der jaren voorgesteld om multiplex gRNA-vectoren 7 , 8 te genereren. In onze methode is het echter mogelijk om meerdere gRNA's rechtstreeks in één enkele retrovirale vector samen te stellen in een enkele ronde kloning, waardoor het geschikt is voor het genereren van gRNA-bibliotheken om paraloggen te richten.

    Onze CRISPR-concatemer is gebouwd in de MSCV retrovirale vector ruggengraat. Zo kan gRNA concatemer-bevattende retrovirus gebruikt worden om stabiele cellijnen te genereren die overexploiterenRess gRNAs. Wanneer gecombineerd met een Cas9-induceerbaar systeem, kan men inducible paralogue knockouts uitvoeren met behulp van ons systeem.

    Samenvattend beschrijven we hoe u in één stap maximaal vier verschillende gRNA's in dezelfde vector kunt klooneren en hoe u deze strategie toepast op organo-cultuur met een hoge transfectie-efficiëntie. Verder bieden we nuttige suggesties om de kansen op succes te maximaliseren door de gehele procedure.

    Disclosures

    De auteurs hebben niets te onthullen. De auteurs hebben geen verklaard belangconflict.

    Acknowledgments

    Wij danken Christopher Hindley voor de kritische lezing van het manuscript. AM wordt ondersteund door Wntsapp (Marie Curie ITN), AA-R. Wordt ondersteund door de Medical Research Council (MRC) en BK.K. En RM worden ondersteund door een Sir Henry Dale Fellowship van de Wellcome Trust en de Royal Society [101241 / Z / 13 / Z] en ontvangen ondersteuning via een kernbijdrage van Wellcome Trust en MRC naar Wellcome Trust - MRC Cambridge Stamcelleninstituut .

    Materials

    Name Company Catalog Number Comments
    Optimized CRISPR Design Tool Feng Zhang group CRISPR gRNA design tool; http://crispr.mit.edu/
    Webcutter 2.0 restriction mapping tool; http://rna.lundberg.gu.se/cutter2/
    T4 PNK (Polynucleotide Kinase) New England Biolabs M0201L
    T4 DNA ligase buffer New England Biolabs M0202S
    T7 DNA Ligase New England Biolabs M0318L
    DTT (dithiothreitol) Promega P1171
    ATP (adenosine triphosphate) New England Biolabs P0756S
    FastDigest BbsI (BpiI) Thermo Fisher FD1014
    Tango buffer (BSA-containing restriction enzyme buffer) Thermo Fisher BY5
    BglII New England Biolabs R0144
    EcoRI New England Biolabs R0101
    Plasmid-safe exonuclease Cambio E3101K
    Thermal cycler Applied biosystems 4359659
    10G competent E. coli bacteria Cambridge Bioscience 60108-1
    Plasmid mini kit Qiagen 12125
    Table top microcentrifuge Eppendorf UY-02580-01
    Inoculating loops Microspec PLS5
    Bacteria incubator Sanyo MIR-262
    Luria-Bertani broth (LB) Sigma-Aldrich L3522
    Agarose Sigma-Aldrich A4718
    Agarose gel electrophoresis apparatus Bioneer A-7020
    Advanced DMEM/F12(cell culture medium) Invitrogen 12634-034
    Glutamax (L-Glutamine) 100x Invitrogen 35050-068
    HEPES 1 M (buffering agent) Invitrogen 15630-056
    Penicillin-streptomycin 100x Invitrogen 15140-122
    B27 supplement (Neuronal cell serum-free supplement) 50x Invitrogen 17504-044
    N2 supplement (Neuronal cell serum-free supplement) 100x Invitrogen 17502-048
    n-Acetylcysteine 500 mM Sigma-Aldrich A9165-5G
    Mouse EGF 500 µg/mL Invitrogen Biosource PMG8043
    Mouse Noggin 100 µg/mL Peprotech 250-38
    Nicotinamide 1 M Sigma N0636
    R-Spondin conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Wnt conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Y-27632 10 µM Sigma-Aldrich Y0503-1MG
    Standard BD Matrigel matrix BD Biosciences 356231
    48-well Plate Greiner Bio One 677980
    CHIR99021 Sigma-Aldrich A3734-1MG
    IWP-2 Cell Guidance Systems SM39-10
    TrypLE (recombinant protease) Invitrogen 12605-010
    Opti-MEM (reduced serum medium ) Life technologies 51985-034
    Electroporation Cuvettes 2 mm gap NepaGene EC-002S
    Low binding 15 mL tubes Sigma-Aldrich CLS430791
    Bürker’s chamber Sigma-Aldrich BR719520-1EA
    NEPA21 Super Electroporator NepaGene contact supplier
    Protein LoBind tubes low binding Thermo Fisher 10708704
    BTXpress electroporation buffer Harvard Apparatus 45-0805
    DMSO (Dimethyl sulfoxide) AppliChem A3672

    DOWNLOAD MATERIALS LIST

    References

    1. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    2. Koike-Yusa, H., Li, Y., Tan, E. -P., Velasco-Herrera, M. D. C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotech. 32, (3), 267-273 (2014).
    3. Bassett, A. R., Kong, L., Liu, J. L. A Genome-Wide CRISPR Library for High-Throughput Genetic Screening in Drosophila Cells. J Genet Genomics. 42, (6), 301-309 (2015).
    4. Diss, G., Ascencio, D., DeLuna, A., Landry, C. R. Molecular mechanisms of paralogous compensation and the robustness of cellular networks. J Exp Zool B Mol Dev Evol. 322, (7), 488-499 (2014).
    5. Andersson-Rolf, A., Merenda, A., Mustata, R. C., Li, T., Dietmann, S., Koo, B. -K. Simultaneous paralogue knockout using a CRISPR-concatemer in mouse small intestinal organoids. Dev Biol. 420, (2), 1-7 (2016).
    6. Ran, F. A., Hsu, P. P. D., Wright, J., Agarwala, V., Scott, D., Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8, (11), 2281-2308 (2013).
    7. Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S. Golden gate shuffling: A one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS ONE. 4, (5), (2009).
    8. Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., Yamamoto, T. Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 4, (5), 5400 (2014).
    9. Kabadi, A. M., Ousterout, D. G., Hilton, I. B., Gersbach, C. A. Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 42, (19), 1-11 (2014).
    10. Yin, L., et al. Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 200, (2), 431-441 (2015).
    11. Cress, B. F., Toparlak, O. D., et al. CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. ACS Synth Biol. 4, (9), 987-1000 (2015).
    12. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J Vis Exp. (6), e253 (2007).
    13. Zimmermann, J., Voss, H., Schwager, C., Stegemann, J., Ansorge, W. Automated Sanger dideoxy sequencing reaction protocol. FEBS Letters. 233, (2), 432-436 (1988).
    14. Fujii, M., Matano, M., Nanki, K., Sato, T. Efficient genetic engineering of human intestinal organoids using electroporation. Nat. Protoc. 10, (10), 1474-1485 (2015).
    15. Andersson-Rolf, A., Fink, J., Mustata, R. C., Koo, B. -K. A video protocol of retroviral infection in primary intestinal organoid culture. J Vis Exp. (90), e51765 (2014).

    Erratum

    Formal Correction: Erratum: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer
    Posted by JoVE Editors on 01/02/2018. Citeable Link.

    An erratum was issued for: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. There was a typo in step 3.3 of the Protocol.

    Step 3.3 was corrected from:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 Ω

    to:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 kΩ

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics